ID: 905548300

View in Genome Browser
Species Human (GRCh38)
Location 1:38817248-38817270
Sequence CCTCAGTGTCCCCACCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905548290_905548300 13 Left 905548290 1:38817212-38817234 CCCAAGTGACCTTGGCAAAGGCC No data
Right 905548300 1:38817248-38817270 CCTCAGTGTCCCCACCTCCAAGG No data
905548289_905548300 14 Left 905548289 1:38817211-38817233 CCCCAAGTGACCTTGGCAAAGGC No data
Right 905548300 1:38817248-38817270 CCTCAGTGTCCCCACCTCCAAGG No data
905548294_905548300 -8 Left 905548294 1:38817233-38817255 CCTTCCCCCTCTAGGCCTCAGTG No data
Right 905548300 1:38817248-38817270 CCTCAGTGTCCCCACCTCCAAGG No data
905548291_905548300 12 Left 905548291 1:38817213-38817235 CCAAGTGACCTTGGCAAAGGCCT No data
Right 905548300 1:38817248-38817270 CCTCAGTGTCCCCACCTCCAAGG No data
905548292_905548300 4 Left 905548292 1:38817221-38817243 CCTTGGCAAAGGCCTTCCCCCTC No data
Right 905548300 1:38817248-38817270 CCTCAGTGTCCCCACCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905548300 Original CRISPR CCTCAGTGTCCCCACCTCCA AGG Intergenic
No off target data available for this crispr