ID: 905551518

View in Genome Browser
Species Human (GRCh38)
Location 1:38844468-38844490
Sequence AAGAAACAGGAGAGGTGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 483}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905551518 Original CRISPR AAGAAACAGGAGAGGTGGTC GGG Intronic
900465321 1:2822452-2822474 AGGAAACAGGGCAGGTGGGCAGG + Intergenic
901130304 1:6958390-6958412 ATGAAAGAGCAGAGGTGGCCAGG - Intronic
901464286 1:9411326-9411348 AAGAAAAGAGAGAGGTGGGCAGG - Intergenic
901503657 1:9670211-9670233 CAGAAACAGAAGTTGTGGTCTGG - Intronic
901917662 1:12512319-12512341 AAGAAACAGCAAAGGAGGCCGGG + Intergenic
901944824 1:12693215-12693237 AAGCGAAAGGAGAGGTGTTCGGG + Intergenic
904027227 1:27512142-27512164 AAGAAACAGGAGGGGGCTTCTGG - Intergenic
904922300 1:34018064-34018086 AAGAAACAGTTGACGTGGGCAGG - Intronic
904979327 1:34483767-34483789 AAGAATCAGGACAAGTGGACAGG - Intergenic
905125727 1:35714928-35714950 AAGGGAAAGGAGAGGTGGCCTGG + Exonic
905303269 1:36999783-36999805 AAGAAATAGAAGATGGGGTCAGG - Intronic
905459216 1:38111407-38111429 AAGAAACAGGATGCGTGGTCAGG + Intergenic
905551518 1:38844468-38844490 AAGAAACAGGAGAGGTGGTCGGG + Intronic
905867985 1:41386654-41386676 AAGAAATAGGAGAGGAGGTGTGG - Intergenic
907039514 1:51245968-51245990 AAGAAAGAAGACAGGTGGCCAGG + Intronic
907720820 1:56970595-56970617 ATGAAACAGGAGAGGCAGGCAGG + Intergenic
907755636 1:57307744-57307766 AACAAACAGGAAAGGAGGTGTGG - Intronic
907786974 1:57622026-57622048 AAGAAACAGGAGAGGTGGGAGGG + Intronic
908237803 1:62164225-62164247 AAGAAACATTAGAGGTTGGCTGG - Intergenic
909418155 1:75430890-75430912 AAGTTACAAGAGAGGTGGTGGGG - Intronic
909790171 1:79666999-79667021 AAGAAACAGAAGGGTTGTTCTGG - Intergenic
910368335 1:86489595-86489617 AAGAAACAGGAGAAGTAGCAGGG + Intronic
910623163 1:89278153-89278175 AAGAAACAGGAGAGAGGATCAGG - Intergenic
912334251 1:108847533-108847555 AGGAGACAGGGGAGGTGGACAGG - Intronic
912674625 1:111667227-111667249 GAGAAACAGGAGAGGAGGGTAGG - Intronic
913036273 1:114969346-114969368 AGGAAACTAGAGAGGTGGTCTGG + Intronic
913145946 1:115990094-115990116 AAGAAACAGGAGAGGACTTCTGG + Intronic
914943287 1:152041746-152041768 AAGAAAGAAGAGAGATGATCAGG + Intronic
915014330 1:152719183-152719205 AAGAAAGAGGAGAGGAGGCTTGG + Intergenic
915307730 1:154990310-154990332 AAGAAACAGAAGTAGGGGTCGGG - Intronic
915606076 1:156951825-156951847 AAGAGTCAGGAGATGTGTTCTGG + Intronic
916337251 1:163686838-163686860 AAAAAATATGAGAGGTGGTATGG + Intergenic
916996374 1:170306028-170306050 AACAAACAGGAGAGGCAGCCTGG - Intergenic
918739218 1:188105903-188105925 AAGAGACATGGGAGGTGGTGTGG - Intergenic
920061531 1:203230033-203230055 GAGAAGCAAGAGAGCTGGTCTGG - Intronic
920742846 1:208597896-208597918 CAGAAACAGGAGAGGTATACTGG - Intergenic
920991689 1:210945875-210945897 ATGAAACAGGGAAGGGGGTCTGG - Intronic
921079880 1:211730624-211730646 AAGAGAGAGGAGAGCTGGACAGG + Intergenic
921328664 1:214013766-214013788 CAGATAAAGGAGAGGTGGCCTGG - Intronic
921329357 1:214020013-214020035 AAAAAGTAGGAAAGGTGGTCAGG - Intronic
921601721 1:217113360-217113382 CAGAAACAGGGGAGGTGGGATGG - Intronic
921716825 1:218425500-218425522 AAGAAACAGAAGACCAGGTCGGG - Intronic
922996922 1:229971510-229971532 AAGACCCAGGAGAGGAGGACGGG - Intergenic
924293558 1:242563108-242563130 AAGTAACAGGAGAGGAGGCAGGG + Intergenic
924601083 1:245489939-245489961 AAGAAACAGGAGTTCTGGGCAGG + Intronic
1063137636 10:3231229-3231251 AAGACACAAGGGAGGGGGTCAGG - Intergenic
1063440222 10:6067002-6067024 AAAAAAGGGGAGAGGTGGTGAGG + Intergenic
1064115677 10:12575384-12575406 AAGAAACAGGAGTGATGGCTGGG - Intronic
1066577345 10:36840810-36840832 AAGAAAAAGAAGGGCTGGTCCGG + Intergenic
1067539043 10:47138361-47138383 GAGACACAGGAGAGGTGATGGGG - Intergenic
1067693554 10:48519774-48519796 CGGAAACCAGAGAGGTGGTCTGG + Intronic
1067784223 10:49231053-49231075 AAGAACCAGGAGAGATGTACAGG - Intergenic
1068705580 10:60071727-60071749 AAGAATCAGGAGATTTGGTGGGG + Exonic
1069221065 10:65884301-65884323 AAGAAACAGGAAAGCTGAACAGG - Intergenic
1069526231 10:69174498-69174520 AATAAACAAGAGACGTGGCCAGG + Intergenic
1069872929 10:71544205-71544227 CAGATGCAGGAGAGGTGGACGGG + Intronic
1069873684 10:71548487-71548509 AAGCAACATCAGAGGTGGGCTGG + Intronic
1069903240 10:71717842-71717864 AAGAAAGAAGAGAGGTGGGGTGG + Intronic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1070871598 10:79758726-79758748 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG + Intronic
1071638519 10:87280889-87280911 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071656723 10:87457063-87457085 GAGAAAAAGGAAAGGTGGTAAGG - Intergenic
1072112530 10:92336819-92336841 AAGAAAAACGAGAGATGTTCTGG + Intronic
1072430092 10:95363362-95363384 ATGAAACAGTAGAGGTCCTCCGG - Intronic
1072812426 10:98473187-98473209 AAGAAAATTGAAAGGTGGTCAGG + Intronic
1072940452 10:99759205-99759227 AGGAAAAAGTATAGGTGGTCTGG + Intergenic
1073148852 10:101298201-101298223 ATGAAACAGGGCAGGTGGCCAGG + Intergenic
1073301832 10:102475595-102475617 AGGAATCAGGAGTTGTGGTCTGG + Intronic
1074132191 10:110589978-110590000 CAGCAACAGGAAAGGTGGGCAGG + Exonic
1074491238 10:113941532-113941554 AAGAAGCAGGAGAAATGGGCTGG - Intergenic
1074701786 10:116098678-116098700 GAGAAACAGGAGATGTGGAGAGG - Intronic
1076266407 10:129112722-129112744 AAAAAACAGGAGAGAAGGGCTGG + Intergenic
1078139248 11:8680106-8680128 AAGATTCAGGACATGTGGTCAGG + Intergenic
1078758600 11:14234052-14234074 AAGAAACAGCACTGGGGGTCGGG - Intronic
1079006307 11:16793704-16793726 AAGAAATAGGAGATGTGGTCAGG - Intronic
1079151992 11:17908231-17908253 ATGAGACAGGAGAGGTCATCTGG - Intronic
1079995088 11:27287278-27287300 CAGAAAGAGGAGAGCTGGACAGG - Intergenic
1081623096 11:44630730-44630752 AAGGAAGAGGAGAGGTGGAGGGG + Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1082873614 11:57966505-57966527 AAGAAACAGGAGGGAAGGACTGG + Intergenic
1082903588 11:58283018-58283040 AGGAATCTGGAGAGGTAGTCTGG + Intergenic
1083175152 11:60945075-60945097 ATGAAGCAGAAGTGGTGGTCTGG + Intronic
1083315800 11:61814430-61814452 GAGAAACAGGAGAGATGGGTGGG + Intronic
1083421518 11:62556014-62556036 GAGAAACTGGAGAAGGGGTCGGG - Intronic
1083763368 11:64830645-64830667 GAGACACAGGAGAGGTTGTGCGG - Intronic
1083791772 11:64990313-64990335 AGGAAACAGGAAATGTGGCCGGG - Intronic
1083956699 11:65987783-65987805 AAGAAGCAGGACAGATGGGCAGG + Intergenic
1084463197 11:69307674-69307696 AAGGAACAGCAAAGGTGGGCTGG - Intronic
1084518202 11:69647706-69647728 AAGACACAGGACAGGTGATGGGG - Intronic
1084594989 11:70111551-70111573 AAGAAACCCCAGAGGTGGCCGGG + Intronic
1085271301 11:75271738-75271760 AGGAGGCAGGAGAAGTGGTCAGG + Intronic
1085474622 11:76782139-76782161 AAGACACTAGAGAGGTGGTGAGG - Intergenic
1086066001 11:82745460-82745482 AAGTGGCAGGAGAGGTGGCCAGG + Intergenic
1087119913 11:94562958-94562980 AAGGAACAGGAGAGAGGGCCTGG + Intronic
1087390607 11:97527473-97527495 AGGAAACAGGAGAGATGAACAGG - Intergenic
1088037799 11:105338534-105338556 AAGAAACAACAGATGTGGTGAGG + Intergenic
1088497977 11:110451429-110451451 AAGAAACAACAGATGTGGTGAGG + Intronic
1088515954 11:110634068-110634090 AAGAAAAAGTAGTGGTGGTCAGG + Intronic
1090663197 11:128895983-128896005 GAGATGCAGGAGAGGTGGTTGGG - Intronic
1090758815 11:129817299-129817321 AAGAATCAGGACACGTGGTTAGG + Intronic
1091794821 12:3292069-3292091 AAGACACAGGAGAGCGGGGCAGG + Intergenic
1091981040 12:4864209-4864231 AAGAAACTAGAGAGGTGGGTTGG + Intergenic
1092146746 12:6219871-6219893 AGGACACAGGAGAGGAGATCTGG + Intronic
1093129539 12:15373511-15373533 AAGAAACAGCAGAGTGGGTGGGG - Intronic
1093177260 12:15926439-15926461 AAGAAACAAGAGAATTGGCCGGG + Intronic
1093239079 12:16646856-16646878 AAGAAAGAAGAGAGGTAGACAGG + Intergenic
1095050948 12:37554018-37554040 AAGACACACGAGAGGTCCTCAGG + Intergenic
1095341918 12:41100176-41100198 AAGAAAGAGGAGAACTGGTTTGG + Intergenic
1095484416 12:42670427-42670449 AAGAAACTGGAGAATTGGCCAGG + Intergenic
1095640516 12:44480767-44480789 AGGAAACAAGTTAGGTGGTCAGG + Intergenic
1096648526 12:53050653-53050675 AAGAGAGAGGAGAGGGAGTCAGG + Intronic
1097179213 12:57161583-57161605 AAGAGACCAGAGAGGGGGTCAGG - Intronic
1098262273 12:68683461-68683483 AAGAAACTGGAGAAAAGGTCTGG - Intergenic
1100208622 12:92378224-92378246 AAGAGAAAGGAAAGGAGGTCTGG + Intergenic
1100353382 12:93806156-93806178 AAAAAACAAGAGAGGTGGCCGGG + Intronic
1100549194 12:95631012-95631034 AAGACAGAGGAGAGGTGATGGGG + Intergenic
1100646932 12:96541579-96541601 AAAAGAGAGGAGAGGTGGTTGGG - Intronic
1101579391 12:106028239-106028261 AATAAACAGGAGTTGTGATCTGG + Intergenic
1102571696 12:113830723-113830745 AAGAACCAGGAAAGGTGGGAAGG + Intronic
1103226872 12:119295342-119295364 AGGAAAAAGGAGAGGTGAGCGGG + Intergenic
1103400033 12:120637557-120637579 ATGAAACTGGAGAGGAGGCCGGG - Intergenic
1104115579 12:125746251-125746273 AGGAATCTAGAGAGGTGGTCTGG + Intergenic
1104143428 12:126009752-126009774 AAGAAACAGGAAGGATGGCCAGG + Intergenic
1104369755 12:128213596-128213618 AATAGGCAGGAGAGGTGGTGGGG - Intergenic
1104836292 12:131794004-131794026 TAGGAACAGGACAGCTGGTCAGG - Intronic
1105623740 13:22093410-22093432 AAGAAGGAAGAGAGGTGATCAGG + Intergenic
1106190597 13:27449442-27449464 AAGAAACTGGAGAGGTGGGAAGG - Intronic
1106194312 13:27480272-27480294 AAGGAATAGGAGAGGAGGGCTGG + Intergenic
1106229746 13:27812732-27812754 CAGAAACAGGAGAGGCAGCCTGG + Intergenic
1106347602 13:28894261-28894283 AAGAAGAAGGAGAGTTGGTGGGG + Intronic
1106429012 13:29661660-29661682 AGGAAAGAGGAGAGTGGGTCAGG + Intergenic
1107824321 13:44313813-44313835 CATAGACAAGAGAGGTGGTCAGG + Intergenic
1107872961 13:44763913-44763935 AGGAAACAGGAGAGGGGCTATGG + Intergenic
1109226572 13:59703492-59703514 AGAAAACAGGAGAGGTGAACAGG - Intronic
1109826406 13:67727834-67727856 AAGAAACAGTGGTGGTAGTCTGG - Intergenic
1112220051 13:97479429-97479451 AAACAAAAGGAGAGGTGGGCAGG + Intergenic
1112641002 13:101275100-101275122 CAGAAACAGGAGGCGTGGCCGGG - Intronic
1112985505 13:105444634-105444656 AAGAAACTTTAGAGGTGGTTTGG - Intergenic
1113176689 13:107572960-107572982 AAGTACCAGGAGATGGGGTCTGG - Intronic
1113477928 13:110598560-110598582 ATGTGACAGGAGAGGTGGCCTGG + Intergenic
1113823336 13:113231317-113231339 AAGAATGAGCAAAGGTGGTCAGG + Intronic
1114636198 14:24188335-24188357 GAGCAACGGGAGAGGTGGGCTGG - Exonic
1114675639 14:24438522-24438544 CAGTAACAGCAGAGTTGGTCTGG - Exonic
1115162318 14:30410156-30410178 AAGAATCTAGAGAGGTAGTCTGG + Intergenic
1115549169 14:34489693-34489715 AAGAAAGGAGAGAGGTGGCCAGG - Intergenic
1117955963 14:61123823-61123845 AAGAAACAGAAGAGATGCTTTGG - Intergenic
1118044109 14:61948041-61948063 ACCAAACTGGAAAGGTGGTCTGG + Intergenic
1118247761 14:64127922-64127944 AAGAAACAAAAAAAGTGGTCAGG + Intronic
1118338454 14:64875189-64875211 GAGAAAAATGAAAGGTGGTCTGG + Intronic
1118733117 14:68683329-68683351 TAAAAAGAGGAGGGGTGGTCGGG + Intronic
1118989140 14:70782115-70782137 AAGATACATGAGATGGGGTCTGG - Intronic
1119277497 14:73371934-73371956 AAGAAAGAGGAGAAGTGACCAGG + Intronic
1121078565 14:91089341-91089363 AAGAAGCAGGAGAGACGGTGAGG + Intronic
1121495312 14:94388130-94388152 AAGCAGTAGGAGAGGTGGTGAGG + Intronic
1123000026 14:105288492-105288514 AAGAAGCTGGAGTGGTGGCCGGG + Intronic
1123462242 15:20483743-20483765 AAGAAAAATGACACGTGGTCGGG + Intergenic
1123655817 15:22516628-22516650 AAGAAAAATGACACGTGGTCAGG - Intergenic
1124129263 15:26970660-26970682 AATAAACAGTAGAGGTGGAAAGG - Intergenic
1124272929 15:28299754-28299776 AAGAAAAATGACACGTGGTCGGG + Intronic
1124834824 15:33186310-33186332 AGGAAACATGATTGGTGGTCAGG - Intronic
1125165902 15:36703993-36704015 AAGATACAGGACAGGTTGTAGGG - Intronic
1125194937 15:37035110-37035132 ACCAAACAGGTGAGCTGGTCAGG + Intronic
1126446633 15:48753382-48753404 AAGGAACAGAATAGGTGGTATGG + Intronic
1127112479 15:55689479-55689501 AAGAAAAAGGGGAGGGAGTCTGG + Intronic
1127217092 15:56834567-56834589 AAAAGACAAGAGAGGTGGTCAGG + Intronic
1127704476 15:61533447-61533469 AGGAAACGGGAGATGTGGTGGGG + Intergenic
1128240689 15:66099184-66099206 AAGAAAAAGGAGGGGTGGGAGGG - Intronic
1128312128 15:66637367-66637389 AGGAGACAGGAGAGGTGGGAGGG + Intronic
1129536787 15:76319649-76319671 AAGAAATATGGAAGGTGGTCAGG - Intergenic
1129605376 15:77022502-77022524 GAGACACAGTAGAGGTGCTCAGG + Intronic
1129671285 15:77609241-77609263 AAGAAGCAGGAAAGGTGATATGG + Intergenic
1129761741 15:78132712-78132734 AAAAAACAGGAGATGAGGCCGGG - Intronic
1130333150 15:82936846-82936868 TAGAAATAGGAGAGCTGGCCAGG - Intronic
1130926038 15:88386578-88386600 AAGATAAAGAAGAGGTGGACTGG + Intergenic
1131167306 15:90151784-90151806 AAGATACAGGAGACCTGGCCAGG + Intergenic
1133009265 16:2901331-2901353 AAAGAACAGGAGAGGGGCTCCGG - Intergenic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1134334869 16:13289175-13289197 AAGAAAGAGGAGAGGAGGGTGGG - Intergenic
1134602164 16:15542051-15542073 AAAAAAAAAGACAGGTGGTCGGG - Intronic
1135041668 16:19122147-19122169 ATGAAACAGTAGTTGTGGTCAGG + Intronic
1135179382 16:20259723-20259745 AAGAGAGAGGAGAGGAAGTCAGG + Intergenic
1135860665 16:26052770-26052792 AAGAAGCATGAGAGTTGGTGAGG - Intronic
1136532138 16:30876821-30876843 AAGGGGCAGGAGAGGTGGGCAGG + Intronic
1136620187 16:31423463-31423485 AAGAAAGAGGAGAGATAGGCGGG - Intronic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1138648405 16:58442232-58442254 AAGAAACATGAAAGGTGGCTTGG - Intergenic
1138878940 16:60987340-60987362 AAGAAACAAGAGAGGAGCCCTGG - Intergenic
1139033742 16:62917569-62917591 AAGAAACAGAAGAGGAAGTAGGG + Intergenic
1139542150 16:67626141-67626163 AAGAATCAGGAGAAATGGGCTGG + Intronic
1139824713 16:69747860-69747882 AAGAAACAGGAATAGTGGCCAGG + Intronic
1140823658 16:78685912-78685934 AAGAAAAAAGAGAGGTGGGTAGG + Intronic
1141220214 16:82062564-82062586 AAGACACAGCAGAGGTAGTTTGG - Intronic
1141463122 16:84190033-84190055 AAGAAGCAGGTGTGGTGGGCTGG - Intergenic
1141660995 16:85441357-85441379 ACAAAACAGGGGACGTGGTCTGG + Intergenic
1142138041 16:88460517-88460539 AAGAAACAGGGGAGATGGTCTGG + Intronic
1142778080 17:2157434-2157456 GAGGAACAGGAGAGGTAGTTGGG - Intronic
1142827385 17:2522292-2522314 GAGAAGCAGGAGAGGCTGTCGGG + Intergenic
1146475343 17:33158090-33158112 ATAAAACAGGAGAGGAGGACAGG - Intronic
1147602301 17:41754187-41754209 AAGGAAGAGGGGAGGTGGGCAGG + Intergenic
1147864339 17:43542979-43543001 AAGAGACAGGAGAGGAGGCTGGG + Intronic
1149779564 17:59386591-59386613 AAGAGGCAGGAGAGGTGGCATGG + Intronic
1149784917 17:59426478-59426500 AAGAAAAAGGATTGGAGGTCAGG + Intergenic
1150990818 17:70256719-70256741 AAAAAATATGAGAGGTGGACAGG - Intergenic
1152364360 17:79846598-79846620 AAGAAAAAGGATGGGTGGGCCGG - Intergenic
1152509650 17:80777291-80777313 AAGAGACAGGAAAGGTCATCTGG + Intronic
1152535056 17:80945848-80945870 AAGGAAGAGGAGTGGTGATCGGG - Intronic
1203157851 17_GL000205v2_random:21359-21381 AGGAAACAGGAGGAGTGTTCTGG + Intergenic
1152978685 18:251256-251278 AAGAAACATTAGAGGTAGTGTGG - Intronic
1155212954 18:23619002-23619024 AGCAAACAGCATAGGTGGTCAGG + Intronic
1155320881 18:24617763-24617785 AACAAGCAGGAGAGTTGTTCTGG - Intergenic
1155491642 18:26406448-26406470 CGGAAACAGGAGAGGTGGGGTGG - Intergenic
1156069247 18:33186375-33186397 TACAGACAGAAGAGGTGGTCTGG - Intronic
1157320755 18:46632046-46632068 AAGAAACAGAAGAGGCAGTGGGG + Intronic
1159778850 18:72637741-72637763 AAGATCCAGGAGAGGTGGGATGG - Intronic
1159819707 18:73124624-73124646 AAGAAACAGCTGACGAGGTCAGG - Intergenic
1161552428 19:4921449-4921471 ACGAAAAAGGAAAGTTGGTCAGG + Intronic
1161649668 19:5476703-5476725 AAAAAAAAGGAGAGGCGGCCGGG + Intergenic
1161705807 19:5820896-5820918 AAGAGAGAGGAGAGGAGGTTTGG - Intergenic
1162596059 19:11630195-11630217 AAGAAACTTGAAAGGTAGTCAGG + Intergenic
1163087104 19:14989574-14989596 AAGAAAAAAGATAAGTGGTCAGG + Intronic
1163216483 19:15881947-15881969 TAGAAACAGGAGTGGAGGTCGGG + Intronic
1163817804 19:19477600-19477622 CAGAGACCGGAAAGGTGGTCTGG + Intronic
1164077725 19:21835648-21835670 TAGAAACAGGAGAGTCGGCCGGG - Intronic
1164510678 19:28894511-28894533 ATGAAACAGGAGAAGTGGGGTGG + Intergenic
1165564389 19:36712032-36712054 AAGAAAAAGAACAGGTGGACTGG - Exonic
1165797414 19:38526994-38527016 AAGACACAGATGAGGAGGTCCGG + Exonic
1166282822 19:41806479-41806501 AAGGAACAGGAGAGGTGCCAGGG + Intronic
1166510613 19:43406450-43406472 AAGAGACAGGAGAGGGGGATCGG + Exonic
1166549753 19:43657380-43657402 ACGAGGCAGGAGAGGTGCTCAGG - Intronic
1167583048 19:50357770-50357792 GAGAAACAGGAGATGAGATCCGG + Intronic
1167725136 19:51206718-51206740 AAGAAACAGCAGAGATGCTCAGG + Intergenic
1167771314 19:51521141-51521163 AAGGTACAGGAGAGGGCGTCCGG - Intronic
926110295 2:10178516-10178538 AACAAACAGGAGGGGTGGCCAGG - Intronic
926731731 2:16040692-16040714 GAGACCCAGGAGAGGTGGGCAGG + Intergenic
927231706 2:20830412-20830434 AAAAAAAAGGAGAGGTGGGGTGG - Intergenic
927348877 2:22082432-22082454 CAGAAACTAGAGAGGTGGTAGGG + Intergenic
927471173 2:23378674-23378696 ATGAAACAGGATAGGTGATGAGG - Intergenic
927868466 2:26608250-26608272 AAAAAAAAGGAGAGTGGGTCTGG + Intronic
929199469 2:39219831-39219853 AACAGACATGTGAGGTGGTCTGG + Intronic
930114639 2:47708061-47708083 AGGAAGCTGGAGAGGTGGGCAGG + Intronic
930815308 2:55590771-55590793 AAGAAAAAGGACAGGTAGTTGGG - Intronic
931515424 2:63048259-63048281 AAGAAAGAGGAGAGGGGGAGAGG - Intergenic
932430561 2:71671581-71671603 AAGTAAGAGGAGAGATGATCTGG + Intronic
932523411 2:72437605-72437627 AGGAATCAAGAGAGGTAGTCTGG + Intronic
932754590 2:74398063-74398085 AAAAAAAAGGTGGGGTGGTCAGG + Intergenic
932759663 2:74430941-74430963 AGGGATCTGGAGAGGTGGTCAGG - Intronic
934055245 2:88246092-88246114 AAGAAACAGGATAGGTGGATAGG - Intergenic
934709482 2:96505518-96505540 AGGAAACAGGAATGGGGGTCTGG + Intronic
934750770 2:96792804-96792826 AAAAAAAAAGAGAGGAGGTCAGG + Intronic
935579502 2:104744409-104744431 AGGATACAGGAGAGGTAGTGTGG + Intergenic
935813811 2:106827500-106827522 AGGCAACAGAAGATGTGGTCTGG - Intronic
935951250 2:108330968-108330990 AAGAAGCATGAGAGGTGGGAAGG + Intergenic
936028827 2:109054823-109054845 TAGAAACTGGAGAGGGGGCCAGG - Intergenic
936549961 2:113428426-113428448 AGGAAACAGCAGAGGTGATATGG - Intergenic
939117970 2:138082827-138082849 AAGTAGCAGGAGAGGGTGTCTGG + Intergenic
939215916 2:139238286-139238308 AAGAAACAGGAGAGGCACTGGGG - Intergenic
940566388 2:155367045-155367067 AAGAAAGAAGTGAGGTGGTTGGG - Intergenic
940865512 2:158813848-158813870 AAGAAAAAGGAAAGGAGGCCGGG - Intronic
941638800 2:167965100-167965122 AACAAAGAGGAGAGGTAGTGGGG + Intronic
942013501 2:171788540-171788562 AAACAACAGGGGAGCTGGTCAGG + Intronic
942576145 2:177365221-177365243 AGGAATGAGGAGATGTGGTCTGG + Intronic
944173997 2:196809310-196809332 TAGTAGCAGGAGAGGTGCTCTGG + Exonic
944218479 2:197278857-197278879 CAGAAACAGGCGGTGTGGTCTGG + Intronic
944330327 2:198458016-198458038 AAGAAGTAGAAGAGGTTGTCTGG - Intronic
944343947 2:198637771-198637793 AAGAAAGAGGAGAGCTGGAAAGG + Intergenic
945718219 2:213384765-213384787 AAGAAACAGGATGGATGATCAGG - Intronic
945911532 2:215655365-215655387 AAGAAACAGGAGGGTGGGTGAGG + Intergenic
946109600 2:217403022-217403044 AAGAAAAAGGAGGGGTGGAAGGG - Intronic
946305472 2:218854659-218854681 AAAAATCAGGAGAGTTGGCCTGG - Intergenic
947570981 2:231234211-231234233 AAGAAAGAGGGAAGGTGGTATGG + Intronic
1169120148 20:3090856-3090878 AAGAAACAGAAGGTGTGGGCAGG - Intergenic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169737659 20:8854454-8854476 GAGAAAAAGGAGAGGTGTTGGGG - Intronic
1170836088 20:19885986-19886008 AAGGGACAGTAGAGGTGGGCGGG + Intergenic
1171182571 20:23101732-23101754 AAAAAACAGGAGAGATTCTCAGG + Intergenic
1171545477 20:25997472-25997494 AAGACACACGAGAGGTCCTCAGG + Intergenic
1172815676 20:37684010-37684032 AAGAAAAAGAAAAGCTGGTCAGG - Intergenic
1173381679 20:42550262-42550284 AAGAAATTGGAACGGTGGTCTGG - Intronic
1173659801 20:44725139-44725161 AAGAAAGAGGAGTGGAGGGCCGG + Intronic
1174175469 20:48641910-48641932 AAGAAACAGGAGGGGAGGGAAGG + Intronic
1174414802 20:50359680-50359702 ATGAGACAGGAGAGCTGGCCAGG + Intergenic
1175066078 20:56290007-56290029 AAAAAAAAGAAGAGGTGGGCAGG - Intergenic
1175176051 20:57112767-57112789 AGGAAACAGCAGAGGAGATCAGG - Intergenic
1175299862 20:57935057-57935079 AAGGGACTGGAGAGGTGGGCGGG - Intergenic
1176164776 20:63667133-63667155 AAGAAAAAGCAGAGCTGGGCCGG - Intronic
1177165917 21:17603608-17603630 AATAAAGAGGCCAGGTGGTCAGG + Intronic
1177425578 21:20918521-20918543 AAGAAACTGGAGAGTTGGGCTGG + Intergenic
1178318368 21:31585945-31585967 AAAAAAAAGGAGAGGTGGGGAGG + Intergenic
1178610693 21:34076186-34076208 AAAAAACAGGAGAGCAGCTCTGG - Intronic
1178691516 21:34754142-34754164 AAGAAGCTGGAGAGATGGTGGGG - Intergenic
1178762504 21:35416935-35416957 AACAAACAGGAAAGGTGACCAGG - Intronic
1179379269 21:40883363-40883385 AAGAAATAAAAGAGGTGGCCGGG + Intergenic
1179531053 21:42019947-42019969 AAGGGACAGCAGAGATGGTCCGG - Intergenic
1179985478 21:44918498-44918520 GTGAAACAGGAGGGGTGGTCTGG - Intronic
1180935156 22:19620619-19620641 AAGAAAAAGGAGAGGAGATTAGG + Intergenic
1182042686 22:27250634-27250656 AAGAAGCAAGAGATGGGGTCAGG + Intergenic
1182063330 22:27413341-27413363 AAGAAACAGTTAAGGTGCTCTGG - Intergenic
1182463079 22:30495824-30495846 AAGAAACAGGAGAATGGGACAGG + Intronic
1182679365 22:32066814-32066836 AAGAAAGAGCAGAGGTGGGCTGG - Intronic
1183494906 22:38137536-38137558 GAAAAACAGCAGAGGTGGCCAGG + Intronic
1183819373 22:40332953-40332975 AAGAAAGAGCAGAGGAGGTCGGG + Exonic
949394658 3:3602103-3602125 AATAAAAAGGAGAGATGGTAGGG + Intergenic
949943574 3:9173000-9173022 GGCAAACAGGAGAGGTGGTGGGG + Intronic
950275492 3:11656884-11656906 AGGAAAGAGAAGAGGGGGTCTGG + Intronic
951132721 3:19067739-19067761 AATCAAGAGCAGAGGTGGTCCGG + Intergenic
951957210 3:28270407-28270429 AAGAAACAACAGATGTGGTGAGG - Intronic
952002768 3:28806005-28806027 AAAAAAAAGGTGGGGTGGTCGGG - Intergenic
952935337 3:38393439-38393461 TAGAAACAGGAGTGCAGGTCAGG - Intronic
953518968 3:43622821-43622843 AAGAAATAGGAGAGCAGGTAAGG - Intronic
956247469 3:67199699-67199721 AAGAAACAAAAGAGGTGATGTGG + Intergenic
956771736 3:72532475-72532497 AGGAATCAAAAGAGGTGGTCAGG - Intergenic
957458628 3:80487807-80487829 AAAATACAGGAAAGGTGGCCAGG + Intergenic
958891771 3:99791575-99791597 AAGCAACAGGAGAGATTTTCAGG - Intronic
959150586 3:102602527-102602549 GGAAAACAGGAGAGGTGGTTTGG + Intergenic
959279296 3:104317250-104317272 AAGAAACATTGGTGGTGGTCGGG + Intergenic
960529902 3:118752742-118752764 AAGGAAGAGGAAATGTGGTCAGG + Intergenic
960589473 3:119351613-119351635 AAAAAAAAAGAGAGGTGGCCTGG + Intronic
961171597 3:124801416-124801438 AAGAAGCAGGAGAGGTGGCAGGG - Intronic
961502876 3:127350166-127350188 AAGGAACAGGCGAGGTGGCTGGG - Intergenic
963013942 3:140802992-140803014 AAGAATCTGGAGAGGCAGTCTGG + Intergenic
963074347 3:141332512-141332534 AACATAAAGGAGAGGTGGCCGGG - Intronic
963677185 3:148327204-148327226 AAGAAAAACTAGAGGAGGTCAGG - Intergenic
963906410 3:150777169-150777191 AAGAAAGAGAAGAGCTGGCCTGG + Intergenic
963958020 3:151276825-151276847 AAGACACAGGGGAAGTGGGCCGG - Intronic
964628428 3:158781817-158781839 AAGAAACAGAGGATGTTGTCCGG + Intronic
965547885 3:169934085-169934107 ATGAGACTGGAGAGGTGGACAGG + Intronic
965609395 3:170528769-170528791 AAGAAAGAGGAGAGGAGGAAGGG - Intronic
965706396 3:171512175-171512197 ATGAGACAGGAGAAGTGTTCAGG - Intergenic
966203021 3:177377218-177377240 AAGCAACTGCAGAGGTGGTGTGG + Intergenic
966737787 3:183202767-183202789 AACAAACAGTAGAGGTGGGAAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
968255650 3:197268097-197268119 AAAAAACAGGAGAGGTGAGGAGG + Intronic
969839767 4:9872249-9872271 AACTCACAGGAGAGATGGTCTGG - Intronic
970400543 4:15713102-15713124 AAGCAAGAGGAGAGGTAGTGTGG + Intronic
970458796 4:16252279-16252301 ATGAAACAGGAAAGGTGAGCAGG - Intergenic
970652887 4:18197947-18197969 AAGAGAATGGAGAGGGGGTCAGG - Intergenic
971278642 4:25222354-25222376 AAGAAACTGTAGAGGTCCTCTGG - Intronic
972164602 4:36267039-36267061 AATAAACAGGCCAGGTGGTGTGG + Intergenic
972678616 4:41284402-41284424 AAGCTACAGGAGAGGAGGCCGGG - Intergenic
974991678 4:69099277-69099299 AAGAAGCAGGTAAAGTGGTCAGG + Intronic
975371990 4:73599753-73599775 AGCAAAGAGGAGAGATGGTCAGG - Intronic
976294125 4:83452660-83452682 AAAAAACAGGAGTGGTTGTAAGG + Intronic
976749110 4:88436100-88436122 AAGAAACAGGAGTTCTGGCCTGG + Intronic
977213611 4:94251299-94251321 ATGATAGAGGAGAGGTGGTAAGG + Intronic
978129628 4:105179377-105179399 AAGAAATAGGGGAGGTGATGGGG + Intronic
978739237 4:112119006-112119028 AGGAAACAGGAGAGGAGGGGAGG + Intergenic
979757110 4:124354658-124354680 TAGAACCAGGAGAGCTGGTACGG + Intergenic
981532886 4:145769608-145769630 CAGAAACAGGAGAGGCTGTTTGG - Intronic
981753987 4:148121170-148121192 AAGAAACAGAAAACGAGGTCTGG + Intronic
982074438 4:151724536-151724558 AGGAAGCTAGAGAGGTGGTCGGG - Intronic
984021525 4:174489472-174489494 GGGAGACAGGAGAGGTGGGCAGG - Intergenic
984821938 4:183889748-183889770 TAGAAAGAGGGGAGGTGGCCTGG - Intronic
986292653 5:6412278-6412300 GTCAATCAGGAGAGGTGGTCTGG - Intergenic
987121605 5:14773065-14773087 AGGAAGCAGGATAGGTGGTGGGG - Intronic
987134694 5:14889849-14889871 AAGAAGCAGGAGCCGTGGTCTGG + Intergenic
987452694 5:18106008-18106030 AAGAAAGAGGAGTGGAGGTAGGG + Intergenic
988569201 5:32347437-32347459 AAGAAACAAGAGAGATGGATGGG + Intergenic
988623202 5:32844544-32844566 TAGAATGAGGAGGGGTGGTCAGG + Intergenic
990181410 5:53164638-53164660 CAGTACCAGGAGGGGTGGTCAGG + Intergenic
990250739 5:53912272-53912294 AAGACACAATAGTGGTGGTCTGG + Intronic
990582665 5:57180441-57180463 AAGAAACAGAAAAGATGGTTTGG - Intronic
990608134 5:57430425-57430447 AAGAAATCGTGGAGGTGGTCGGG - Intergenic
991457364 5:66818750-66818772 AGGAAAAAGGGGAGGTGTTCAGG + Intronic
991921094 5:71657720-71657742 AAGAATAAGGAGATGTGGTCAGG - Exonic
991972967 5:72158451-72158473 AAGAAAGAGGAGAGGTGTTTGGG + Intronic
993132038 5:83911101-83911123 AAGAAACAGGAGATGGAGTGAGG - Intergenic
994364753 5:98900296-98900318 AAGAAAAAAGAAATGTGGTCAGG + Intronic
995101450 5:108311962-108311984 AAGCTACAGGAGATGGGGTCAGG - Intronic
995612387 5:113924038-113924060 AGGAATCTGGAGAGGTAGTCTGG - Intergenic
995736808 5:115310459-115310481 GAGAAGCAGGAAAAGTGGTCAGG - Intergenic
996056609 5:118989129-118989151 AAGCAATAGGAGAGCTGGCCCGG + Intergenic
996305399 5:122040682-122040704 ATGATAAAGGAGAGGTTGTCAGG + Intronic
997230508 5:132239050-132239072 AGGAGACAGGAGAGGAGATCTGG - Intronic
997290264 5:132727405-132727427 GGGAAAAAGGAGAGGGGGTCAGG + Intronic
998807510 5:145933365-145933387 TAGAAACAGGAGTGTTGGTGGGG + Intergenic
999092564 5:148950184-148950206 AAGAACCAGGTAATGTGGTCTGG - Intronic
999299464 5:150482201-150482223 AGAAAACTGGAGAGCTGGTCAGG - Intergenic
1000651288 5:163821940-163821962 AGGAAACATCAGTGGTGGTCTGG - Intergenic
1000964159 5:167635366-167635388 AAGAAAAAAGAAAGGTGGGCAGG - Intronic
1000994453 5:167944854-167944876 AAAAAGCAGAAGAGGTGATCAGG + Intronic
1001592495 5:172875110-172875132 AAGAAAAAGCAGAGGAGGTATGG - Intronic
1002714387 5:181217427-181217449 AAGAAGCCGGAGGGGTGGGCGGG - Intergenic
1002880232 6:1244408-1244430 AACTATCAGGAGAGATGGTCAGG - Intergenic
1003774657 6:9346928-9346950 GAGAAGCAGCAGAGTTGGTCAGG + Intergenic
1004217991 6:13720063-13720085 AAGAAACAAGAAAGAGGGTCAGG - Intergenic
1004869425 6:19889769-19889791 AAGAATCAGGGGTGGTGGTAGGG - Intergenic
1005506261 6:26471429-26471451 AAGAAACTGGAAAGATGGGCCGG + Intronic
1006267985 6:32941308-32941330 AAGGAATAGGAGAGGTTATCTGG - Intronic
1006577044 6:35054060-35054082 AACAAAGAGGAGAGGCAGTCAGG - Intronic
1006995566 6:38256793-38256815 AAGAAGCTGGAAAGGTGATCTGG - Intronic
1007125669 6:39423647-39423669 GAAAAACAGGGGAGGTGTTCAGG - Intronic
1007724737 6:43908485-43908507 GAGTGAGAGGAGAGGTGGTCAGG + Intergenic
1007784661 6:44272675-44272697 ATGAAACAGAAGATGTGGACAGG - Intronic
1008546789 6:52590262-52590284 TAGAAACAGCAGAGCTGGGCAGG - Intergenic
1008762928 6:54875770-54875792 AAGAGACAGGAGAGGAGGGAAGG + Intronic
1010089091 6:71958512-71958534 AAGGAATGGGAGAAGTGGTCAGG + Intronic
1010155154 6:72784055-72784077 TAGAGCCAGGAGAGGTGGTGTGG - Intronic
1010220142 6:73441827-73441849 TGGTAACAGGAGAGGTGGCCAGG - Intronic
1010509139 6:76696198-76696220 AACAAGGAGGAGAGGTGTTCTGG + Intergenic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1010928599 6:81773258-81773280 AAAAAACAGGCTGGGTGGTCTGG - Intergenic
1011270347 6:85572381-85572403 AAGGAAAATGAGAGGTGGTGGGG + Intronic
1011450488 6:87486797-87486819 ATGAAGCAGGAGAGGTCATCAGG + Intronic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012437046 6:99226006-99226028 AAGAAACAGGCTTGGTGCTCAGG - Intergenic
1013350204 6:109298767-109298789 GGGAAGGAGGAGAGGTGGTCAGG - Intergenic
1013386024 6:109632046-109632068 AAGAAACATGAGAGGGCGTCTGG + Intronic
1014443371 6:121498579-121498601 AAGAAATAGGTTAGGTGATCTGG - Intergenic
1014980232 6:127937463-127937485 AAGAAACAGAAGCAGTGGTTTGG + Intergenic
1015161382 6:130156041-130156063 AAGAAAAAGGAAAGGAGGCCAGG + Intronic
1015460107 6:133480928-133480950 AAGAAATGGGAGAGGTGGAAGGG + Intronic
1015889986 6:137960794-137960816 AAGAAAAAAGGGAGGTGGTGGGG + Intergenic
1016563334 6:145423100-145423122 AAGAAAAAGGAAAGGTGTTGAGG - Intergenic
1016806402 6:148216712-148216734 AAGAAAAAAGAGATGAGGTCAGG - Intergenic
1016863052 6:148740919-148740941 AAGAAACTGGAGAGTTGCTCTGG - Intergenic
1017413152 6:154191207-154191229 AAAAAAGATGAGAGGTTGTCAGG + Intronic
1017718602 6:157229199-157229221 AGAAAACAAGAGAGTTGGTCAGG - Intergenic
1017972970 6:159329114-159329136 AAAAAAGAGGGGAGGTGGTGGGG + Intergenic
1018735980 6:166687513-166687535 AAGAAAAGGAAGAGGTGGTTTGG + Intronic
1019924989 7:4186031-4186053 AGCAAACAGGAGAGCTGGGCCGG - Intronic
1020005047 7:4778491-4778513 AAGAAACAGGACATGGAGTCTGG + Intronic
1020212165 7:6165438-6165460 AAGAGAGAGGGGAGGCGGTCAGG + Intronic
1020724034 7:11786370-11786392 AACAAACAGGAGAGCTTGCCAGG + Intronic
1021391448 7:20097933-20097955 AAGAAAGAGGAGAGGCTGACCGG + Intergenic
1021598285 7:22340178-22340200 AAGAAACAGGAGTGCTGTGCTGG + Intronic
1021618181 7:22523905-22523927 AACAAATAGGAGAGGTGGGTGGG + Intronic
1021819310 7:24480386-24480408 AGGAAAGAGGAGAGGTGGGATGG - Intergenic
1022694599 7:32691869-32691891 AACAAACAGGAGAGGTGGGTGGG + Intergenic
1022927779 7:35073380-35073402 AACAAATAGGAGAGGTGGGTGGG + Intergenic
1023344866 7:39261205-39261227 CAGGAGCAGGAGAGGTGGCCTGG - Intronic
1023556624 7:41430118-41430140 GAGAAACAGGAGAGGAAGGCTGG - Intergenic
1023624281 7:42100741-42100763 AAGAAAAAGAAGAGGGGGTGGGG + Intronic
1025231698 7:57207068-57207090 AAGAAAGAGGAGAGGAGGGGAGG - Intergenic
1025255683 7:57382513-57382535 ATGAGACAGGAGAGCTGGCCAGG - Intergenic
1025296882 7:57782526-57782548 AAGACACATGAGAGGTCCTCAGG + Intergenic
1026802224 7:73407513-73407535 AAGAAAAAGGAAAGGAGGCCGGG + Intergenic
1028374498 7:90132204-90132226 AACAAATAGGAGAGGTGGGTGGG - Intergenic
1028843897 7:95458846-95458868 AAGAAATAGAAGATGTGGTAGGG - Intergenic
1028881021 7:95880259-95880281 AAGAAACATCAGATGTGGACAGG - Intronic
1028950540 7:96630436-96630458 AAGGAACATCAGAGGTAGTCTGG - Intronic
1031871980 7:127097396-127097418 AAAAGAGAGGGGAGGTGGTCAGG + Intronic
1032259454 7:130323207-130323229 AAAAAACAGGAGAGGAGGGAGGG - Exonic
1032515899 7:132506027-132506049 AGGAAATAGGAGAGGTGCTATGG - Intronic
1032850453 7:135790593-135790615 AAGAACCAGAAGACTTGGTCAGG + Intergenic
1033609471 7:142952270-142952292 AAGAAGCCAGAGAGGTAGTCAGG + Intronic
1035748111 8:1975806-1975828 AAGAATCCGGAAAGGTGGTTTGG + Intronic
1036091426 8:5669767-5669789 AGGAAAAAGGAGAGGCTGTCAGG - Intergenic
1036642672 8:10593816-10593838 AAGAAAGAGGAGAGCTGGGGTGG - Intergenic
1037473713 8:19236840-19236862 AGGAAACAGGAGAGGAGGACTGG + Intergenic
1038476529 8:27872318-27872340 ACTAAAAAGGAGAGGTTGTCCGG - Intronic
1038728131 8:30099922-30099944 ACGTCACAGGAGAGGTGGGCAGG + Intronic
1041263007 8:56038036-56038058 AAGAAACAGGATGGGTGGAGAGG + Intergenic
1041801550 8:61805868-61805890 AATAAACAGGTGAGGTGGGGAGG + Intergenic
1041973650 8:63772742-63772764 AATAAACACCAGATGTGGTCTGG + Intergenic
1042390390 8:68227616-68227638 AAGAGAGATGAGAGGAGGTCAGG + Intronic
1042528797 8:69794127-69794149 AAGAAACAGAACAGGTGGCAGGG + Intronic
1042993826 8:74670904-74670926 GAGAAACAGAAGAGGAGGTTAGG - Intronic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1044301022 8:90583038-90583060 AAGAAACAGAGTAGGTGTTCAGG + Intergenic
1045636962 8:104202660-104202682 AAGAGACAGCAGAGATGGACTGG - Intronic
1045806226 8:106165546-106165568 AGGAAACAGGAGAGGAGGGGAGG + Intergenic
1049364806 8:142232026-142232048 AAGAAACAGGAGCTGAGGTCAGG + Intronic
1049852533 8:144840742-144840764 GAGAAGCAGGGGAGGTGGCCAGG + Intronic
1049902983 9:188401-188423 AGGAAACAGCAGAGGTGATATGG + Intergenic
1050844567 9:10198335-10198357 GAAAAACAGGAGTAGTGGTCAGG + Intronic
1050899611 9:10929923-10929945 AAGAAACCTGAGACATGGTCAGG - Intergenic
1051856313 9:21570646-21570668 TAGGAACATGAGAGGTGGTCAGG + Intergenic
1052567920 9:30182200-30182222 AAGAAACATGAATGTTGGTCAGG - Intergenic
1052896492 9:33751818-33751840 AAGAATCAGGACACGTGGTTAGG + Intronic
1053328475 9:37179610-37179632 AAGAGACAGGTGAGCTGGACTGG - Intronic
1053746003 9:41198684-41198706 AGGAAACAGCAGAGGTGATATGG + Intronic
1054481267 9:65666533-65666555 AGGAAACAGCAGAGGTGATATGG - Intergenic
1054682340 9:68232596-68232618 AGGAAACAGCAGAGGTGATATGG - Intronic
1054826903 9:69582528-69582550 AAGAAACTGGGGAGGTGGAATGG - Intronic
1057180480 9:93027069-93027091 AAGACACAGGTGAGGCGGCCTGG - Intronic
1057190100 9:93082610-93082632 AATAAAAAGGAAAGGGGGTCAGG - Intronic
1057752346 9:97803185-97803207 AAGAAAAAGGAGAGGAGGAAAGG + Intergenic
1058377151 9:104335974-104335996 AAGAAAACGGAGAGATTGTCAGG - Intergenic
1058597249 9:106628616-106628638 AGAAAACAGGACAGGTGGTGTGG + Intergenic
1059688284 9:116658720-116658742 AAAAAAAAAGAGCGGTGGTCAGG - Intronic
1060400425 9:123345690-123345712 AACAAACCCGACAGGTGGTCAGG + Intergenic
1060627151 9:125124046-125124068 AAGCAAAAGGAGAGGTGCTTGGG - Intronic
1061576564 9:131510916-131510938 AGGTATCAGTAGAGGTGGTCAGG + Intronic
1061731282 9:132616138-132616160 AAGAAACAGGAGAGAAGGAATGG + Intronic
1062197575 9:135282786-135282808 CAGGAACAGCACAGGTGGTCAGG + Intergenic
1202782135 9_KI270718v1_random:9457-9479 AGGAAACAGCAGAGGTGATATGG + Intergenic
1203496371 Un_GL000224v1:155294-155316 AAAACACAGGAGGGGTGTTCTGG + Intergenic
1203508993 Un_KI270741v1:97216-97238 AAAACACAGGAGGGGTGTTCTGG + Intergenic
1185653485 X:1666160-1666182 AAGAGACAGAAGAGGAGGCCGGG - Intergenic
1186490120 X:9965110-9965132 AAGAAATAGGAGATTGGGTCAGG + Intergenic
1186811222 X:13190758-13190780 AAGAGCCAAGAGAGGTGGTTGGG - Intergenic
1187308541 X:18119242-18119264 AAGAAAGAGGGGAGATGGCCAGG + Intergenic
1188720988 X:33523392-33523414 GAGAAACAGGAGAGGTGATGGGG + Intergenic
1188988106 X:36785957-36785979 GGGCAAGAGGAGAGGTGGTCTGG + Intergenic
1189140703 X:38602682-38602704 AAGAGAATGGAGAGGTGGGCGGG + Intronic
1189942310 X:46137412-46137434 ATGAAACAGAAGAGGTAGTGAGG + Intergenic
1190476638 X:50834555-50834577 AAGAATCAGGAAAGGTTTTCTGG - Intergenic
1190618167 X:52259667-52259689 AAGTAACAGGACAGGTGGTTAGG + Intergenic
1190833609 X:54080872-54080894 AAAAAAAAGGAAAGTTGGTCAGG + Intronic
1191194582 X:57707622-57707644 AAGAAAAAAGAGGGGAGGTCTGG + Intergenic
1191593232 X:62912364-62912386 AATAAACAGCAGAGGTAGCCAGG - Intergenic
1192244350 X:69360450-69360472 ATGAAACTGGAGAGGTAGGCTGG + Intergenic
1192678754 X:73229505-73229527 AGGAAAAGGGAGAGGTGGTGTGG - Intergenic
1192703149 X:73497745-73497767 AGGAATCAGGAGAGGCAGTCTGG + Intergenic
1193034500 X:76934660-76934682 AGGAATCTGGAGAGGTAGTCTGG - Intergenic
1193665453 X:84310318-84310340 AGGAAACATGGGAGGTAGTCTGG + Intergenic
1194419249 X:93651765-93651787 GAGAAACAGCAGAGAGGGTCTGG - Intergenic
1194670488 X:96726521-96726543 AAGAAAGAGGTGAGGTGGGATGG + Intronic
1195067376 X:101249984-101250006 CATAAACAGGAGAGATGGTATGG + Intronic
1195778788 X:108438148-108438170 AAGAAAGAGGAGGGGAGCTCGGG + Intronic
1196417203 X:115484081-115484103 AAGAAAAAGGAGAGGGGGAAGGG + Intergenic
1196656247 X:118220498-118220520 AAGCATCAGGAGAGGCAGTCAGG - Intergenic
1198097542 X:133394978-133395000 AAGAAACATGAGAGCTCTTCAGG - Intronic
1198255450 X:134920374-134920396 AAATAACAGGAGAGGAGCTCTGG - Intergenic
1198935279 X:141897310-141897332 AAGAAATAGGAGTGGTTGTCGGG - Exonic
1200056664 X:153465061-153465083 GGGAAACAGCAGAGCTGGTCAGG + Intronic
1200076950 X:153556022-153556044 AAGAGACAAGAGAGGTGGGCGGG - Intronic
1201018163 Y:9625333-9625355 CAGACACAGAAGAAGTGGTCAGG - Intergenic