ID: 905553018

View in Genome Browser
Species Human (GRCh38)
Location 1:38859325-38859347
Sequence ACGCCCGGGAGGGCGGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 476}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905553018_905553039 15 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553039 1:38859363-38859385 CCTGAGAACCGGGGAGGGGGCGG 0: 1
1: 1
2: 5
3: 85
4: 1038
905553018_905553034 10 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553034 1:38859358-38859380 GGCCACCTGAGAACCGGGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 171
905553018_905553035 11 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553035 1:38859359-38859381 GCCACCTGAGAACCGGGGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 227
905553018_905553033 9 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553033 1:38859357-38859379 CGGCCACCTGAGAACCGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 102
905553018_905553044 23 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553044 1:38859371-38859393 CCGGGGAGGGGGCGGGGGACTGG 0: 1
1: 3
2: 22
3: 283
4: 2768
905553018_905553041 17 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553041 1:38859365-38859387 TGAGAACCGGGGAGGGGGCGGGG 0: 1
1: 0
2: 1
3: 51
4: 510
905553018_905553045 24 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553045 1:38859372-38859394 CGGGGAGGGGGCGGGGGACTGGG 0: 1
1: 1
2: 11
3: 203
4: 1962
905553018_905553030 5 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553030 1:38859353-38859375 CTACCGGCCACCTGAGAACCGGG 0: 1
1: 0
2: 2
3: 7
4: 83
905553018_905553031 6 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553031 1:38859354-38859376 TACCGGCCACCTGAGAACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 39
905553018_905553040 16 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553040 1:38859364-38859386 CTGAGAACCGGGGAGGGGGCGGG 0: 1
1: 0
2: 3
3: 62
4: 546
905553018_905553042 18 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553042 1:38859366-38859388 GAGAACCGGGGAGGGGGCGGGGG 0: 1
1: 0
2: 6
3: 91
4: 1020
905553018_905553037 12 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553037 1:38859360-38859382 CCACCTGAGAACCGGGGAGGGGG 0: 1
1: 0
2: 0
3: 16
4: 243
905553018_905553029 4 Left 905553018 1:38859325-38859347 CCGGCCGCCGCCCTCCCGGGCGT 0: 1
1: 0
2: 3
3: 33
4: 476
Right 905553029 1:38859352-38859374 GCTACCGGCCACCTGAGAACCGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905553018 Original CRISPR ACGCCCGGGAGGGCGGCGGC CGG (reversed) Intronic
900243897 1:1629094-1629116 ACGCCGGTGAGGGCGGGCGCCGG - Intronic
900269215 1:1778557-1778579 CCGCGCGGGCGGGAGGCGGCGGG + Intronic
900503655 1:3018580-3018602 GGGCCGGGGAGGGCGGGGGCGGG + Intergenic
900629289 1:3625159-3625181 CGGCCCGGGCGGGGGGCGGCCGG + Exonic
900792445 1:4689427-4689449 AGGCCCAGGAAGGCGGAGGCGGG + Intronic
901063842 1:6485671-6485693 TCGCCCGGGCAGGCGGAGGCGGG - Intronic
902018734 1:13328615-13328637 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
902019087 1:13329437-13329459 CCGTCCGGGAGGGCGGTGGGGGG + Intergenic
903081678 1:20816307-20816329 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
903132769 1:21290330-21290352 GCGGCCTGGAGGGCGGGGGCGGG - Intronic
903637494 1:24832913-24832935 CCGTCCGGGAGGGCGGTGGGGGG - Intronic
903637903 1:24833839-24833861 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
903962286 1:27064612-27064634 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
904252896 1:29237526-29237548 CCGCCCGAGGGGGCGGTGGCAGG + Intronic
904784435 1:32974274-32974296 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
905553018 1:38859325-38859347 ACGCCCGGGAGGGCGGCGGCCGG - Intronic
906662544 1:47593273-47593295 AGCCCCGGGCTGGCGGCGGCGGG - Intergenic
906761513 1:48382637-48382659 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
906761664 1:48382961-48382983 CCGCCCGGGAGGGAGGTGGGGGG - Intronic
907216608 1:52869968-52869990 CCGCCCGGGAGGGGGGTGGGGGG - Intronic
908370225 1:63473327-63473349 CCGTCCGGGAGGGAGGTGGCGGG + Intronic
911351666 1:96762500-96762522 CCGTCCGGGAGGGAGGTGGCGGG - Intronic
912752088 1:112294245-112294267 CCGTCCGGGAGGGAGGCGGCGGG + Intergenic
913994210 1:143638864-143638886 CCGTCCGGGAGGGAGGCGGCGGG + Intergenic
914824790 1:151132860-151132882 CCGCCCAAGAGGGCGGGGGCGGG + Exonic
914888252 1:151600961-151600983 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
915213389 1:154325729-154325751 GCGCCCGGGAGCGCGGGGCCAGG + Intronic
915530477 1:156499996-156500018 GGGCCTGGGAGGGCGGCGGGAGG - Intronic
915539210 1:156557144-156557166 CCGTCCGGGAGGGAGGTGGCGGG + Intronic
918255166 1:182741504-182741526 CCGTCCGGGAGGGAGGTGGCGGG - Intergenic
919994952 1:202740237-202740259 CCGTCCGGGAGGGAGGCGGGAGG - Intronic
921039617 1:211416942-211416964 ACTCCCAGGAGGGCGGCGGGCGG - Intergenic
921140022 1:212298454-212298476 CCGTCCGGGAGGGCGGTGGGGGG - Intronic
921140275 1:212299054-212299076 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
921142343 1:212320580-212320602 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
921142499 1:212320944-212320966 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
921142552 1:212321071-212321093 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
921814232 1:219546228-219546250 ACGTCCGGGAGGGAGGTGGGGGG + Intergenic
922102701 1:222488329-222488351 ACGTCCGGGAGGGAGGTGGGGGG + Intergenic
922513151 1:226186479-226186501 GAGCCCGGGGAGGCGGCGGCTGG - Exonic
922695483 1:227728935-227728957 ACGCAGGGGAGGGGGGCGGCAGG + Intronic
922958555 1:229625809-229625831 GCGCGCGGGCGGGCGGGGGCCGG - Intronic
923119546 1:230978203-230978225 ATCCTCGGGAGGCCGGCGGCGGG + Intronic
1062774789 10:135759-135781 GGGCCTGCGAGGGCGGCGGCGGG + Intronic
1063200394 10:3781604-3781626 GGGCCCCGGAGGGCGGCCGCTGG - Intronic
1063714444 10:8513612-8513634 AAGCCCGGGAGGAAGGCCGCAGG - Intergenic
1064108337 10:12519400-12519422 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1064208803 10:13347316-13347338 ACGCCCGCGTCGGAGGCGGCCGG + Intronic
1064230964 10:13528995-13529017 GCTGCGGGGAGGGCGGCGGCGGG + Intergenic
1064231007 10:13529116-13529138 CCCCCGGGGATGGCGGCGGCCGG - Intergenic
1064982020 10:21174366-21174388 GAGCCCAGGTGGGCGGCGGCTGG + Intergenic
1065024351 10:21526513-21526535 GGGGCTGGGAGGGCGGCGGCGGG - Intergenic
1065055444 10:21837901-21837923 CCGTCCGGGAGGGAGGTGGCGGG + Intronic
1066085815 10:31970974-31970996 CCGTCCGGGAGGGCGGTGGGGGG + Intergenic
1066986910 10:42475999-42476021 GCGCCGGGGAGGGCGGCCTCAGG + Intergenic
1068969825 10:62948284-62948306 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1069052609 10:63811455-63811477 ACGTCCGGGAGGGAGGTGGGGGG - Intergenic
1069645349 10:69992838-69992860 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
1069698334 10:70404235-70404257 GCGGCTGAGAGGGCGGCGGCGGG + Intergenic
1070138365 10:73715651-73715673 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1070312401 10:75283310-75283332 ACGCCTTGGAGGGCGGGGCCAGG - Intergenic
1072602159 10:96941067-96941089 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1072641000 10:97211329-97211351 GGGCCCAGGAGGGCGGCAGCTGG - Intronic
1073462912 10:103676839-103676861 ACCCCAGGGAGGGAGGTGGCTGG - Intronic
1076707248 10:132308480-132308502 AGGCCCGGGATGCGGGCGGCGGG + Intronic
1076858815 10:133130020-133130042 ACTCCGGGGGTGGCGGCGGCAGG + Exonic
1076864663 10:133160759-133160781 GCGCACGGGACGGCGGCGGGTGG + Intronic
1077011814 11:382193-382215 AGGTCCGGAAGGGCTGCGGCTGG - Intergenic
1077048244 11:555515-555537 AGGGTCGTGAGGGCGGCGGCCGG + Intronic
1077148681 11:1058067-1058089 ACGCCCGGGAGTGGGACAGCTGG + Intergenic
1079020788 11:16907545-16907567 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1079444963 11:20548854-20548876 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1081969146 11:47186308-47186330 ACGCGCGGGTAGGCGGCGGCGGG - Intronic
1083862401 11:65428754-65428776 AGGTCCTGGAGGGTGGCGGCGGG - Intergenic
1084165383 11:67372865-67372887 ACGGCCGGGGAGCCGGCGGCAGG - Intronic
1084174356 11:67415793-67415815 GAGCCAGGGAGGGGGGCGGCCGG + Intronic
1084178279 11:67434564-67434586 AAGCCCTGGGGGGCGGAGGCAGG - Exonic
1084388836 11:68861702-68861724 CCGTCCGGGAGGGAGGTGGCGGG + Intergenic
1084839259 11:71831562-71831584 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1084924780 11:72502645-72502667 CCGTCCGGGAGGGAGGTGGCGGG - Intergenic
1086122474 11:83316691-83316713 CCGTCCGGGAGGGAGGTGGCGGG - Intergenic
1086366174 11:86110960-86110982 ACGTCCGGGAGGGAGGTGGGGGG + Intergenic
1086697315 11:89860958-89860980 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1086708844 11:89983529-89983551 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
1089248973 11:117144180-117144202 GCGCCCGGGAGAGCGAAGGCGGG + Intergenic
1090635942 11:128690551-128690573 TCCCCCGGGAGGGGAGCGGCGGG - Intronic
1091378827 12:42662-42684 CCGTCCGGGAGGGCGGTGGGGGG + Intergenic
1091740846 12:2959507-2959529 CGGCCCGTGAGGGCGCCGGCGGG - Intronic
1092239583 12:6828693-6828715 ACGGCGGGGAGCGCGGCGCCCGG - Exonic
1092249489 12:6884752-6884774 ACGCGGGGGAGGGAGCCGGCGGG - Intronic
1092295980 12:7199979-7200001 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1095810871 12:46372410-46372432 CCGCGCGGGAAGGCGGCCGCGGG - Intronic
1096024702 12:48350808-48350830 GCGCCCGGGAGGGAGGCACCGGG - Intronic
1098412855 12:70202499-70202521 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1098412931 12:70202646-70202668 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1098413007 12:70202823-70202845 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1099255346 12:80307746-80307768 CCGTCCGGGAGGGAGGTGGCGGG - Intronic
1100570273 12:95840474-95840496 CCGTCCGGGAGGGCGGTGGGGGG - Intergenic
1100570680 12:95841394-95841416 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1101409849 12:104458512-104458534 GCGCCCTCGAGCGCGGCGGCCGG + Intronic
1102294031 12:111723473-111723495 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1104256730 12:127146132-127146154 ACGGCTAGGAGGGCGGGGGCGGG - Intergenic
1104669019 12:130667717-130667739 CCCCCAGGGAGGGCGGGGGCTGG + Intronic
1104961334 12:132489905-132489927 GCGCCCGGGAGGGGCGGGGCCGG + Exonic
1107447162 13:40479712-40479734 ACGCCCGTGAGGGAGCTGGCAGG + Intergenic
1107499088 13:40955756-40955778 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1107499165 13:40955932-40955954 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1108059161 13:46515562-46515584 CCGTCCGGGAGGGCGGTGGGGGG - Intergenic
1113201065 13:107867593-107867615 GCGCGGGGGCGGGCGGCGGCGGG + Intergenic
1113484687 13:110645480-110645502 AAGACCGTGAAGGCGGCGGCAGG - Intronic
1113655912 13:112067732-112067754 CCGCCGGGGCGGGCGGCGGCGGG + Exonic
1113724357 13:112587624-112587646 ACGCCGGGGCGGGAGGCGGGAGG - Intronic
1114427945 14:22637843-22637865 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1115028185 14:28766608-28766630 GCGCCCGAGGGGGCGGCAGCCGG + Intergenic
1115703402 14:35977074-35977096 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1115703474 14:35977242-35977264 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1115847630 14:37555648-37555670 CCGTCCGGGAGGGAGGTGGCGGG - Intergenic
1116841083 14:49821197-49821219 ACGCCCGGGAGGGAGGTGGGGGG + Intronic
1118340769 14:64894778-64894800 CCGTCCGGGAGGGCGGTGGGGGG - Intergenic
1118341175 14:64895699-64895721 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1119666968 14:76491711-76491733 ACTCCGGTAAGGGCGGCGGCGGG + Exonic
1121622522 14:95360438-95360460 GCGCCTGGGAGGACGGGGGCTGG - Intergenic
1122082385 14:99274593-99274615 ACGCGCGGGCGGGCGGACGCAGG + Intergenic
1122130857 14:99604040-99604062 GCGCGCGGGCGGGGGGCGGCCGG + Intergenic
1122212421 14:100181288-100181310 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1122238287 14:100345031-100345053 CCGTCCGGGAGGGAGGTGGCGGG + Intronic
1122483607 14:102063673-102063695 ACGCCTGGGGGAGCGGCGGCCGG + Intergenic
1122582035 14:102777264-102777286 AAGGCCGGGCGGGCGGCCGCCGG + Intergenic
1122829923 14:104390891-104390913 ACTCCCAGGAGGGCGGCAGCAGG - Intergenic
1122960911 14:105093331-105093353 TCGCCCGCGAGGGGGGTGGCGGG + Intergenic
1122978520 14:105180995-105181017 CCGCCCGGGAGATCGGCGGGAGG + Intronic
1202940285 14_KI270725v1_random:138321-138343 AAAGCCGCGAGGGCGGCGGCGGG + Intergenic
1123396611 15:19943897-19943919 ACGGCGGGGAAAGCGGCGGCGGG - Intergenic
1124029893 15:26001191-26001213 ACTCCAGGGAGGGCTGAGGCCGG - Intergenic
1124500339 15:30222998-30223020 ACGCGCGCGGGGGCGGCGGGCGG + Intergenic
1124743234 15:32315668-32315690 ACGCGCGCGGGGGCGGCGGGCGG - Intergenic
1125180873 15:36880205-36880227 ACGCCAGGAAAGGAGGCGGCTGG - Intergenic
1125201327 15:37102496-37102518 ACGCCAGGGAGAGGGGCTGCGGG + Intergenic
1125459361 15:39893738-39893760 CCGCCCGGGAGGGAGGTGGGGGG - Intronic
1125577175 15:40763944-40763966 GCCGCCGGGAGGGCGGGGGCGGG + Intergenic
1125577751 15:40766893-40766915 AGCCCAGGGAGGGCGGCAGCAGG + Exonic
1125694081 15:41621144-41621166 ACGCCCGGGAGGTGAGCGCCAGG + Intergenic
1125740738 15:41962658-41962680 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1127584324 15:60366786-60366808 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1128109630 15:65068167-65068189 GCGCTCGGGAGGGTGACGGCAGG - Intronic
1128489828 15:68134849-68134871 CCGTCCGGGAGGGCGGTGGGGGG - Intronic
1128582698 15:68820216-68820238 AGGCGCGGGAGGGGGGCGGAAGG + Intronic
1128970434 15:72101448-72101470 CCGTCCGGGAGGGAGGTGGCGGG + Intronic
1128970586 15:72101800-72101822 CCGTCCGGGAGGGAGGTGGCGGG + Intronic
1129322319 15:74782171-74782193 AGGAGCGGGAGGGCGGCAGCGGG - Exonic
1129431688 15:75504495-75504517 ACGTCCGGGAGGGAGGTGGGGGG + Intronic
1130115438 15:81001448-81001470 ACGCCCGGGCGTGTGGCGGGCGG + Exonic
1130335295 15:82952715-82952737 AGGCGCGGGCGGGCGGGGGCTGG + Exonic
1132522231 16:397135-397157 GCTCCCGGGCGGGCGGGGGCGGG + Intronic
1132779370 16:1614364-1614386 ACGCCCGGGCCGGCGGCGGGAGG - Intronic
1133032920 16:3020303-3020325 CCGCCCCGGAAGGCGGGGGCGGG + Exonic
1135565792 16:23510207-23510229 CCGCAGGGGAGGCCGGCGGCCGG - Intronic
1136153093 16:28364963-28364985 ACACCCGGGGCGGCCGCGGCAGG - Intergenic
1136209990 16:28750310-28750332 ACACCCGGGGCGGCCGCGGCAGG + Intergenic
1136426122 16:30169733-30169755 CCGTCCGGGAGGGAGGTGGCGGG + Intergenic
1136426197 16:30169909-30169931 CCGTCCGGGAGGGAGGTGGCGGG + Intergenic
1136426349 16:30170261-30170283 CCGTCCGGGAGGGAGGTGGCGGG + Intergenic
1136683653 16:31981956-31981978 GAGCCCGGGCTGGCGGCGGCGGG + Intergenic
1136784280 16:32925516-32925538 GAGCCCGGGCCGGCGGCGGCGGG + Intergenic
1136885504 16:33928290-33928312 GAGCCCGGGCCGGCGGCGGCGGG - Intergenic
1137728623 16:50673668-50673690 AGGGCCGGGACGGCGGCCGCAGG + Exonic
1137785583 16:51134932-51134954 AAGCCAGAGAGGGCGGCGGGGGG - Intergenic
1138043620 16:53698700-53698722 CCGCCCGGGAGGGAGGTGGGGGG + Intronic
1138681231 16:58684772-58684794 ACGCCCGCTCGGGCGGCCGCGGG + Intronic
1139215916 16:65123630-65123652 ACGCCCGCGGGGGCGGGTGCCGG + Intronic
1139529895 16:67537852-67537874 ACGCCCGGGCCGGTGGGGGCTGG + Intronic
1139576693 16:67846741-67846763 AAGCCAGGGAGGGAGGCTGCCGG - Exonic
1139864638 16:70052142-70052164 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1141608501 16:85169023-85169045 ACGCGGGGGGAGGCGGCGGCGGG + Intergenic
1141687412 16:85578197-85578219 ACACCTGGGAGGGCGGCACCGGG + Intergenic
1142136358 16:88453579-88453601 AGCCCCGGGCGGGCGGCGGCGGG - Exonic
1142163314 16:88570574-88570596 GGGGCCGGGAGGGCGGCGGGAGG + Intronic
1142206444 16:88785255-88785277 ACGCCGGGGAGGGCGGGAGGGGG - Intergenic
1203086937 16_KI270728v1_random:1189522-1189544 TAGCCCGGGCCGGCGGCGGCGGG + Intergenic
1142693416 17:1620590-1620612 ACGGCCTGGAGGCAGGCGGCCGG - Intronic
1142699347 17:1649779-1649801 GAGCCCAGGAGGGCGGCGCCCGG - Exonic
1142789849 17:2255548-2255570 CCGTCCGGGAGGGAGGTGGCGGG + Intronic
1142818863 17:2448060-2448082 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1143183619 17:4998303-4998325 AGGCCCGGGCGGCCGCCGGCTGG + Intronic
1144536396 17:16095377-16095399 CCGCCCGGGAGGGAGGTGGGGGG + Intronic
1145049587 17:19648863-19648885 ACCCCCCGGAGGGAGGCGGAGGG + Exonic
1145418159 17:22741402-22741424 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1145733852 17:27212670-27212692 CCGTCCGGGAGGGCGGAGGGGGG + Intergenic
1146022513 17:29292597-29292619 AGGCCTGGGGGGGCGGCGGGGGG - Intronic
1146215980 17:30979539-30979561 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1146216135 17:30979864-30979886 CCGCCCGGGAGGGAGGTGGGGGG - Intronic
1146444139 17:32922210-32922232 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1146444264 17:32922485-32922507 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
1146444438 17:32922879-32922901 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1147144571 17:38477663-38477685 GAGCCCGGGCCGGCGGCGGCGGG + Exonic
1147168697 17:38606041-38606063 CCGCCCGGGGCGGCGGGGGCGGG + Intergenic
1147742529 17:42677037-42677059 CCCCCCGGGAGGGAGGGGGCCGG - Intergenic
1147865148 17:43546776-43546798 GCGCCCAGGAGGGAGGCGACCGG + Intronic
1147933034 17:43994835-43994857 ACGAACGGGAGGGCGCTGGCTGG + Intronic
1147974413 17:44238748-44238770 ACGTCCGGGAGGGAGGTGGGGGG + Intergenic
1148500878 17:48090030-48090052 ACGCCCTGGAAGGCTGAGGCAGG - Intronic
1148873507 17:50672953-50672975 ATGCCCTGGAGGGAGGCGGGGGG - Exonic
1149475908 17:56960731-56960753 ACGGCCGGGTGGGCGGCGGGCGG - Intronic
1150326512 17:64262782-64262804 TCGCCGGTGAGGGGGGCGGCAGG + Intronic
1151673798 17:75588097-75588119 AGGCCCGGGAGGCCGGCCTCAGG + Intergenic
1151728356 17:75897067-75897089 GCGCCCGGGAAGGCGGAGGGGGG + Intergenic
1151987790 17:77555360-77555382 ACGCCCGGGAGCTGGGCGCCCGG + Intergenic
1152020229 17:77776729-77776751 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1152571302 17:81122392-81122414 ACGCCCGGGGGCGCGCCGTCGGG + Exonic
1152640143 17:81445880-81445902 ACGGCCAGGAAGGGGGCGGCTGG - Intronic
1152736472 17:81999817-81999839 ACACCTGGGAGGGCAGAGGCCGG + Intronic
1152811853 17:82386117-82386139 AGGCCGGGGAAGGCGGAGGCAGG - Intergenic
1153480591 18:5543405-5543427 CCGCCCGGGCGGGTGGCGGCTGG - Intronic
1153855095 18:9137224-9137246 ACGCCGGGAGGGGCGGCGGCGGG - Intronic
1154216560 18:12420542-12420564 ACGCGGGAGAGGGCGGGGGCGGG - Intronic
1155570350 18:27185380-27185402 CTGCCCGGGCGGGCGGGGGCGGG - Intergenic
1155910385 18:31498327-31498349 CCGCCGGGGAGGGCGTCGGTAGG + Intronic
1155972259 18:32092982-32093004 ACGCTCGGGCAGGCCGCGGCGGG - Intronic
1156502016 18:37566135-37566157 GCGCCACGGCGGGCGGCGGCCGG + Intergenic
1157319063 18:46620342-46620364 AAGCCAGGGAGGGTGGTGGCCGG + Intronic
1157799725 18:50609390-50609412 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1159045636 18:63366857-63366879 GCGCCGGGGTGGACGGCGGCAGG + Intronic
1159106011 18:64002693-64002715 AAGCCGGGGAGGGCGGGTGCTGG + Intronic
1160452225 18:78973744-78973766 ACCCTCGGGTGGGCGGCGTCAGG - Intergenic
1160454791 18:78992802-78992824 GAGCCCGCGATGGCGGCGGCAGG - Exonic
1160500745 18:79400249-79400271 ACGCCCCGGGGGGCGGGGGCGGG + Intronic
1160719148 19:589950-589972 ACGCGCGCGGGGGCGGCGGGCGG + Exonic
1160886977 19:1354740-1354762 GAGCGCGGGAGGGCGGCGCCCGG + Intronic
1161001395 19:1912852-1912874 ACGGCCTGGGGGGCAGCGGCCGG - Exonic
1161241145 19:3224644-3224666 GGGCCCGGGAGGGAGGCGGGAGG + Intergenic
1161592793 19:5136343-5136365 ACGCACGGGGGGGCGGTGGCAGG + Intronic
1161851388 19:6739685-6739707 TCCCCGGGGAGGGCGGCGGGCGG + Exonic
1162019438 19:7862022-7862044 AGGGCCGGGTGGGCGCCGGCGGG + Intronic
1162535828 19:11262452-11262474 GGGCCCGGGGCGGCGGCGGCGGG - Exonic
1162778709 19:12995805-12995827 CCGGGCGGGAGCGCGGCGGCCGG - Exonic
1162892999 19:13747662-13747684 ACGCCTGGGAGGGCGGTGCCAGG + Intronic
1162935246 19:13978716-13978738 ACGCACGGGCGGGGGGCAGCGGG - Intronic
1163945338 19:20530092-20530114 ACGTCCGGGAGGGAGGTGGGGGG - Intergenic
1164066515 19:21721326-21721348 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1164066844 19:21722072-21722094 CCGTCCGGGAGGGCGGTGGGGGG + Intergenic
1164192514 19:22927086-22927108 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1164239241 19:23369325-23369347 ACGCCCGGGAGGGAGGTGGGGGG + Intronic
1164659243 19:29949010-29949032 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1164693129 19:30225727-30225749 CGGCGCGGGGGGGCGGCGGCGGG + Intergenic
1165199477 19:34132856-34132878 ACGTCCGGGAGGGAGGTGGGGGG + Intergenic
1165901851 19:39173025-39173047 GGGCACGGGCGGGCGGCGGCGGG - Exonic
1166162611 19:40965443-40965465 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1166351475 19:42200538-42200560 AGGCCCGGGAGGCTTGCGGCTGG + Intronic
1166425795 19:42676651-42676673 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1166558825 19:43718802-43718824 ACGCCCGTGAGAGCCGCGCCAGG - Exonic
1167072914 19:47230944-47230966 ACGCCGGAGGGGGCGGCGGTGGG + Intronic
1167258091 19:48442984-48443006 AAGCCGGGGAAGGCGCCGGCGGG - Exonic
1167416294 19:49374844-49374866 ATGCCCTGGAGGGCGGCCACTGG + Exonic
1167612773 19:50515282-50515304 AGGCCCTGGAGGGCTGGGGCTGG - Intergenic
1167970676 19:53186930-53186952 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1167970803 19:53187206-53187228 CCGCCCGGGAGGGAGGTGGGGGG - Intronic
1168100333 19:54138062-54138084 TCGCCAGGGCGGGAGGCGGCGGG - Intronic
1168658384 19:58147529-58147551 CCGCCCGGGAGGGAGGTGGGGGG + Intronic
925114890 2:1370079-1370101 ACTCCCGGGCGGGCGGCAGAAGG - Intergenic
926112473 2:10192071-10192093 AGGCCAGGGTGGGCGGGGGCTGG + Intronic
927504667 2:23605032-23605054 ACTCCAGGGAAGGCGGTGGCAGG - Intronic
928005238 2:27557644-27557666 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
928244349 2:29614434-29614456 AAGCCTGGGAGGGCAGGGGCTGG - Intronic
929065024 2:37964038-37964060 ACGTCCGGGAGGGAGGTGGGGGG - Intronic
929218072 2:39437003-39437025 CTGCCCGGGAGGGAGGCGGGGGG - Exonic
929562046 2:42962121-42962143 ATGCCCTGGAGGGAGGAGGCAGG - Intergenic
930079098 2:47433054-47433076 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
931291857 2:60881099-60881121 CGGCCTGGGAGGGCGACGGCCGG - Intergenic
931437679 2:62262982-62263004 AGGCCCGGAAGGGCTGCGGGAGG - Intergenic
931694340 2:64860376-64860398 AGGCCCTGGAGGGAGGTGGCAGG - Intergenic
932090226 2:68799753-68799775 AGGGCCGGGAGGGCTGGGGCAGG + Intronic
932771397 2:74502733-74502755 ACGCCCGGGAGGGTGGCGGTGGG - Intronic
932773252 2:74513358-74513380 GCACCGGGCAGGGCGGCGGCGGG + Intergenic
933893473 2:86790743-86790765 ACGCCCGGGAAGGCAGGGGATGG - Intronic
934753030 2:96806134-96806156 CCGTCCGGGAGGGCGGTGGGGGG - Intronic
936038376 2:109129932-109129954 ACGCGCGGGCGGGCTGCCGCCGG - Exonic
937045003 2:118846593-118846615 GCGCCCGCGCCGGCGGCGGCTGG + Exonic
937984627 2:127632991-127633013 GCTCCCGGGAAGGCGCCGGCAGG - Intronic
938088712 2:128418380-128418402 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
940643562 2:156369039-156369061 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
940751131 2:157628526-157628548 ACGCCCGCGAGGGTGGGAGCTGG - Intronic
940954363 2:159712177-159712199 GCGCCCGGGAGGGAAGGGGCTGG + Intergenic
941768846 2:169327247-169327269 ACGTCCGGGAGGGAGGTGGGGGG + Intronic
941769173 2:169327997-169328019 ACGTCCGGGAGGGAGGTGGGGGG + Intronic
941793306 2:169575343-169575365 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
942462022 2:176175206-176175228 AGACTCGGGAGGGAGGCGGCAGG - Intergenic
944532859 2:200683513-200683535 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
944598320 2:201282571-201282593 CCGTCCGGGAGGGCGGTGGGGGG - Intronic
944598800 2:201283694-201283716 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
944732935 2:202534991-202535013 CCGTCCGGGAGGGAGGTGGCAGG - Intronic
944866733 2:203869988-203870010 ATGCCAGGGAAGGCGGAGGCTGG + Intronic
945233081 2:207610902-207610924 CCGCCCGGGAGGGAGGTGGGGGG + Exonic
945233154 2:207611078-207611100 CCGTCCGGGAGGGAGGCGGGGGG + Exonic
945835616 2:214835099-214835121 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
945970366 2:216226573-216226595 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
946751046 2:222896206-222896228 CCGTCCGGGAGGGAGGCGGCGGG - Intronic
947534959 2:230934570-230934592 GCCCCGGGGAGGGAGGCGGCCGG - Intronic
948553469 2:238791572-238791594 ACTACCGGAAGGGCGGCTGCGGG - Intergenic
948699271 2:239750264-239750286 ACCCCTGGGACGGCGGCTGCAGG - Intergenic
948994400 2:241571201-241571223 CCACTCGGGAGGGCGGGGGCTGG - Intronic
1169086190 20:2825101-2825123 CCGTCCGGGAGGGCGGTGGGGGG + Intergenic
1169204616 20:3732743-3732765 GGGCCCGGGATCGCGGCGGCTGG + Exonic
1169247051 20:4033033-4033055 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1169557608 20:6767624-6767646 GCGGCCGGGAGGGAGCCGGCAGG + Intergenic
1170562631 20:17570164-17570186 ACGCGGGGGAGGGAGCCGGCGGG - Exonic
1170774552 20:19364265-19364287 ACTCAGGGGAGGGGGGCGGCTGG - Intronic
1171363033 20:24603587-24603609 ACGCCTGGGATGGCAGCGGAGGG + Intronic
1171899813 20:30846979-30847001 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
1171935923 20:31274684-31274706 ATGTCCTGGAGGGCGGCCGCTGG + Intergenic
1171951748 20:31427360-31427382 ACGTCCGGGAGGGAGGTGGGGGG + Intergenic
1171951805 20:31427478-31427500 ACGTCCGGGAGGGAGGTGGGGGG + Intergenic
1171957246 20:31471060-31471082 ACGTCCGGGAGGGAGGTGGGGGG - Intronic
1172118477 20:32584708-32584730 AGGTCCTGCAGGGCGGCGGCGGG - Intronic
1172118780 20:32585678-32585700 GCGGCCGGGAGGTCGGCGTCTGG - Intronic
1172360003 20:34305468-34305490 ACGCCTGGGAGGTGGGCAGCAGG + Intronic
1172402012 20:34658931-34658953 CCGTCCGGGAGGGAGGCGGAGGG + Intronic
1172474435 20:35226628-35226650 CCGCCCCGGTGGGGGGCGGCCGG - Intergenic
1173251528 20:41366443-41366465 AAGCGCGGGCGGGCGGCGGGCGG - Intronic
1174181418 20:48677248-48677270 GAGCCCAGGAGGGCGGAGGCAGG + Intronic
1174386436 20:50190692-50190714 ACCCCCGGGAGGACGGCGGCAGG - Intergenic
1175367716 20:58467213-58467235 ACGCCCGGGGCTGCGGCTGCAGG + Exonic
1175715408 20:61252097-61252119 ACGTCCAGGAGGGCAGAGGCTGG + Intergenic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1175988072 20:62774067-62774089 AGGCCGGGGAGGGCAGCGGGTGG - Intergenic
1176582862 21:8548623-8548645 AAAGCCGCGAGGGCGGCGGCGGG - Intergenic
1179504073 21:41828580-41828602 TGGCCCGGGAGGGAGGCGGCTGG - Intronic
1179628122 21:42659998-42660020 AAGCCGGGCAGGGAGGCGGCAGG + Intronic
1180265693 22:10525670-10525692 AAAGCCGCGAGGGCGGCGGCGGG - Intergenic
1181532112 22:23522715-23522737 AGGCCGCGGAGGGCGGGGGCCGG + Intergenic
1181586288 22:23855017-23855039 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1183149781 22:36028523-36028545 ACGCACGCGGGGGCGGGGGCAGG - Intergenic
1183294038 22:37019523-37019545 AGGCGCGGGATGGCGGCGGGCGG - Intronic
1183411696 22:37658752-37658774 CGGCGCGGGAGGCCGGCGGCCGG + Exonic
1183490263 22:38112076-38112098 CTGCCCGGGAGGGCAGTGGCTGG + Exonic
1183595253 22:38807187-38807209 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1183745054 22:39687241-39687263 ACCCCCAGGAGGGCGGGGGTGGG + Exonic
1183871373 22:40744788-40744810 CCGTCCGGGAGGGCGGTGGGGGG - Intergenic
1183931623 22:41238818-41238840 ACGCCCTGGAAGGCGGCTGCGGG + Exonic
1183933634 22:41249686-41249708 AGGCCCGGGAGGGAGGTGGGTGG - Intronic
1184146514 22:42614642-42614664 ACGGCGGGGACGGCGGCAGCCGG + Intronic
1184202695 22:42981464-42981486 CCGTCCGGGAGGGAGGCGGCGGG + Intronic
1184276479 22:43411947-43411969 GCGCGCGGGCGGGCGGCGGAGGG + Intronic
1184287376 22:43479130-43479152 ATGCCCGGGTGGCCGGCGCCAGG - Intronic
1184545469 22:45164362-45164384 AGGGCCGGGAGGGCGGGAGCGGG + Intronic
1185225377 22:49648853-49648875 ACTCCCGGGGGGGGGGGGGCGGG - Intronic
1185418148 22:50721034-50721056 ACACCGGGGAGGGCAGCAGCAGG - Intergenic
951039050 3:17967894-17967916 CAGGCCGGGAGGGCGGGGGCTGG + Intronic
954146182 3:48635448-48635470 ACGCTCCGGAAGGCGGCGCCGGG + Intronic
954409701 3:50365048-50365070 GCGGCGGGGAGGGCGGGGGCAGG + Intronic
959085817 3:101849746-101849768 GCGCCCGGGGCGGCGGCGGGCGG - Exonic
959415156 3:106073621-106073643 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
960780556 3:121313612-121313634 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
961780226 3:129316617-129316639 ACGGCCGGGAGCTTGGCGGCCGG + Intergenic
961962605 3:130868532-130868554 CCGCCCGGGAGGGAGGTGGGGGG + Intronic
962259723 3:133895109-133895131 GGGGCCCGGAGGGCGGCGGCTGG - Intronic
963911235 3:150820205-150820227 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
966784221 3:183608952-183608974 CGGTCCGGGAGGGAGGCGGCGGG + Intergenic
966860843 3:184230226-184230248 ACCCCCGGGGGAGCCGCGGCGGG + Intronic
967648247 3:191952752-191952774 ATGCCCAGGATGGCGGCAGCAGG - Intergenic
967858286 3:194134372-194134394 ACGCCCGGGAGGCCGCCGGCGGG - Intergenic
968514377 4:1010151-1010173 CCGGCCGGGAGGGCGGCAGGTGG + Exonic
968556749 4:1249529-1249551 GAGCGCGGGAGGGCGGCAGCTGG - Intronic
968924104 4:3538483-3538505 GCGTCCGGGAGGGAGGCGGGGGG - Intergenic
969269851 4:6092159-6092181 ACGGCTGGGAGGGAGGGGGCGGG - Intronic
970456301 4:16226816-16226838 GGGCCGGGGATGGCGGCGGCGGG + Intronic
971405631 4:26319490-26319512 GTGCCCGGGAGGCGGGCGGCGGG - Intronic
974026514 4:56737778-56737800 AACCCCGGGAGGACGGCAGCTGG - Intergenic
975686060 4:76917928-76917950 ACGTCCGGGAGGGAGGTGGGGGG + Intergenic
975686112 4:76918055-76918077 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
976265251 4:83182671-83182693 ACGTCCGGGAGGGAGGTGGGGGG + Intergenic
976265643 4:83185408-83185430 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
976455838 4:85246209-85246231 ACGCCGGACAGGGCAGCGGCCGG + Intergenic
978618935 4:110621050-110621072 CCGCCTGGGAGGGCGCCGGTGGG - Intronic
983158582 4:164383264-164383286 TCGCCCAGGAGGGCGGTTGCAGG + Exonic
984146344 4:176065936-176065958 GCGCCCGGGGGCGGGGCGGCCGG - Intronic
984803785 4:183735939-183735961 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
984803859 4:183736114-183736136 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
984804109 4:183736679-183736701 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
985520996 5:373838-373860 CTGCCCGGGCGGGCGGGGGCGGG + Intronic
989075720 5:37563083-37563105 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
989587562 5:43087329-43087351 CCATCCGGGAGGGAGGCGGCGGG - Intronic
990954924 5:61331935-61331957 ACGCGGGGGAGGGCGGGGTCAGG - Intergenic
992469581 5:77042590-77042612 ACGTCCGGGAGGGAGGTGGGGGG - Intronic
992469682 5:77042816-77042838 CCGCCCGGGAGGGAGGTGGGGGG - Intronic
998131859 5:139655434-139655456 ATGCCCAGGGGGGCGGCGGGGGG - Intronic
998431626 5:142075290-142075312 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
999129605 5:149272466-149272488 GCGCCAGGGAGGGAGGAGGCGGG + Intronic
1000037512 5:157460276-157460298 ACGCGCGGGCGGACGGCGCCCGG - Exonic
1001065056 5:168529542-168529564 GCGGCCGCGGGGGCGGCGGCTGG + Exonic
1001575818 5:172763232-172763254 AAGCCCCGGAGGGCGGCGGAGGG - Intergenic
1002006560 5:176238845-176238867 AAGCCCGAGAGGACTGCGGCTGG + Intronic
1002211196 5:177600280-177600302 GCGCCCGGGAGGACGGGGCCCGG - Intronic
1002219818 5:177671791-177671813 AAGCCCGAGAGGACTGCGGCTGG - Intergenic
1002455855 5:179345106-179345128 ACGCCTGGGGAGGGGGCGGCGGG + Intronic
1002717032 5:181234241-181234263 CCGCCTGGCAGAGCGGCGGCAGG + Exonic
1002784719 6:392401-392423 AGGCCCGGGAGAGCGGAGGCGGG - Intronic
1003163456 6:3655855-3655877 AAGCCCGGGGGGGCGGCGGTGGG - Intergenic
1005606730 6:27484917-27484939 CCGTCCGGGAGGGAGGTGGCGGG - Intergenic
1005837280 6:29718875-29718897 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1005837608 6:29719620-29719642 CCGTCCGGGAGGGCGGTGGGGGG + Intergenic
1006064522 6:31454382-31454404 ACGTCCGGGAGGGAGGTGGGGGG - Intergenic
1006064562 6:31454463-31454485 CCGTCCGGGAGGGAGGTGGCAGG - Intergenic
1006064699 6:31454784-31454806 ACGTCCGGGAGGGAGGTGGGGGG - Intergenic
1006064952 6:31455390-31455412 ACGTCCGGGAGGGAGGTGGGGGG - Intergenic
1006397238 6:33795448-33795470 ACGCCAGGGTGGGCGGAGGCCGG + Intronic
1006623801 6:35384419-35384441 CCGTCCGGGAGGGAGGTGGCGGG + Intronic
1006948042 6:37798537-37798559 AACCCAGGGAGGGCTGCGGCAGG + Intergenic
1007327311 6:41072583-41072605 ACGCATGCGCGGGCGGCGGCGGG - Exonic
1007390322 6:41546764-41546786 CAGCCCCGGCGGGCGGCGGCGGG + Exonic
1007444514 6:41895023-41895045 GCGCCCGGGGCGGGGGCGGCGGG - Intronic
1007498742 6:42279673-42279695 ACGACAGGGAGGGTGGTGGCTGG + Intronic
1008030398 6:46688138-46688160 ACGCCCGGAATGCCGGCGCCGGG + Exonic
1008624730 6:53305384-53305406 CCGCCCGGGAGGGAGGTGGGGGG - Intronic
1008926193 6:56894233-56894255 CCGTCCGGGAGGGCGGTGGGGGG - Intronic
1010513323 6:76744857-76744879 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1011195479 6:84774901-84774923 ACGCCAGGCAGTGCGGCGGACGG - Intergenic
1014763808 6:125388322-125388344 CCGTCCGGGAGGGCGGTGGGGGG - Intergenic
1015749965 6:136550019-136550041 GCGGCGGGGAGGGCAGCGGCCGG + Intronic
1017163955 6:151390921-151390943 GCGCCCTGGGCGGCGGCGGCCGG - Intronic
1017214976 6:151899131-151899153 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1018905197 6:168071908-168071930 AGGCCCGGGAGGCAGGAGGCAGG - Intronic
1019153321 6:170023347-170023369 ACGCACGGGAGGGCGGGCGCTGG - Intergenic
1019300596 7:301643-301665 TCCCTCGGGTGGGCGGCGGCAGG - Intergenic
1019309477 7:353186-353208 AGGGCCTGGAGGGCGGGGGCTGG + Intergenic
1019406894 7:888700-888722 AGGCCAGGGAAGGCGGCAGCAGG - Intronic
1019421642 7:953792-953814 ACGAACGGGCGGGCGGCGGGTGG + Intronic
1019458832 7:1146462-1146484 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1019458884 7:1146588-1146610 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
1019481919 7:1270810-1270832 ATGCCTGGGAGGGCTGGGGCTGG - Intergenic
1019621178 7:1992812-1992834 ACGTCAGGGAGGCAGGCGGCAGG + Intronic
1019666952 7:2256785-2256807 AAGCCCGGCAGCGCGGTGGCCGG - Intronic
1019697026 7:2451743-2451765 AGGCCCGGGAGGGTGGCCTCAGG - Intergenic
1019921095 7:4163688-4163710 ATGCCCAGGAAGGCTGCGGCTGG - Intronic
1020016526 7:4834918-4834940 AGGCCCGGGCGGGCAGGGGCTGG + Exonic
1020272927 7:6607708-6607730 GCGCCCGGGAGTGCTACGGCCGG + Intronic
1021231086 7:18086874-18086896 GGGCTCGGGAGGGCGGCAGCGGG - Intergenic
1021614391 7:22487552-22487574 ACGCCGAGGATGGCGGGGGCGGG + Intronic
1022207807 7:28180357-28180379 CCGGCGGGGAGGGAGGCGGCAGG - Intronic
1023000419 7:35801774-35801796 CAACCCGGGCGGGCGGCGGCGGG + Intronic
1023160664 7:37292900-37292922 CCGTCCGGGAGGGAGGTGGCGGG + Intronic
1023860950 7:44217493-44217515 ACGCCAGGGTGGCCGGCTGCTGG + Exonic
1024931154 7:54667686-54667708 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1025011437 7:55402254-55402276 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1025796022 7:64738900-64738922 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
1025852926 7:65258410-65258432 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1025853021 7:65258628-65258650 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1025853205 7:65259029-65259051 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1025853335 7:65259303-65259325 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1026783189 7:73283925-73283947 ACGTCCGGGAGGGAGGTGGGGGG - Intergenic
1028417469 7:90595953-90595975 GCGGCCGGGAGGGGCGCGGCCGG + Intronic
1029376146 7:100177936-100177958 GCCCCCGGAAGGGCAGCGGCGGG + Intronic
1029414786 7:100436031-100436053 GCACCGGGGAGGGCGGCGTCAGG + Exonic
1030602839 7:111610242-111610264 ACGTCCGGGAGGGAGGTGGGGGG + Intergenic
1032156853 7:129476240-129476262 CCGCCCGGGAGGGAGGTGGGGGG - Intronic
1032569956 7:132985763-132985785 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1033324003 7:140362885-140362907 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1033339205 7:140479042-140479064 AGGCGCGGGAGGGCGGGGACCGG - Intronic
1034469792 7:151248994-151249016 ACGCCAGGGGAGGCGGCGGGGGG + Intronic
1034535709 7:151724581-151724603 GCGCCTGGGAGGGCGACGACGGG - Intronic
1034618164 7:152436245-152436267 ACGCGCGGGGGAGGGGCGGCCGG - Intergenic
1034638475 7:152585585-152585607 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1034638601 7:152585860-152585882 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
1034638773 7:152586251-152586273 CCATCCGGGAGGGAGGCGGCGGG - Intergenic
1034961371 7:155366717-155366739 CCGTCCGGGAGGGAGGTGGCGGG - Intronic
1038595264 8:28881411-28881433 CCGCCCGGGAGGGAGGTGGGGGG + Intronic
1039467830 8:37796828-37796850 AGGCCCGGGCGGGCGGGGACCGG + Intronic
1040052785 8:43033029-43033051 CCGCCCGGGAGGGAGGTGGTGGG - Intronic
1040052811 8:43033079-43033101 CCGTCCGGGAGGGAGGTGGCGGG - Intronic
1040069687 8:43179540-43179562 CCGTCCGGGAGGGAGGCGGTGGG - Intronic
1040069759 8:43179716-43179738 CCGCCCGGGAGGGAGGTGGGGGG - Intronic
1040834605 8:51718928-51718950 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1040834648 8:51719020-51719042 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1041070961 8:54125799-54125821 CCGTCCGGGAGGGAGGTGGCGGG + Intergenic
1042039670 8:64578348-64578370 ACTTTCGGGAGGGCGGAGGCTGG - Intergenic
1044507709 8:93039567-93039589 CCGTCCGGGAGGGCGGTGGGGGG + Intergenic
1046636817 8:116680019-116680041 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1049376275 8:142290797-142290819 AGGCCCGGGAGGGCGGAGGATGG - Intronic
1049407553 8:142458352-142458374 AGGCCCAGGATGGCGGCGGGAGG + Intronic
1049670859 8:143869277-143869299 CAGGCCGAGAGGGCGGCGGCCGG - Exonic
1049766027 8:144355609-144355631 ACCCCGGGGAAGGCAGCGGCAGG + Exonic
1049791096 8:144473084-144473106 GGGCCCGGGTGGGCGGCGACCGG - Exonic
1049988674 9:973256-973278 TCGCCCCGGAGGGCGGCTTCGGG + Intergenic
1051936345 9:22447146-22447168 ACGCCGGGGACGGGGGCGGAGGG - Exonic
1052858713 9:33423604-33423626 CCATCCGGGAGGGAGGCGGCGGG + Intergenic
1052998889 9:34566389-34566411 ACGGGCGGAAGGGCGGTGGCTGG + Intronic
1053893986 9:42725395-42725417 AGGCCCGGGAAGGCGCCGGTGGG - Intergenic
1055530438 9:77177920-77177942 ACCCACAGGCGGGCGGCGGCAGG - Intronic
1055722700 9:79193686-79193708 CCGCAGGTGAGGGCGGCGGCGGG + Intergenic
1056624682 9:88244727-88244749 CCGTCCGGGAGGGAGGCGGGGGG - Intergenic
1057337290 9:94166100-94166122 CCTCACTGGAGGGCGGCGGCTGG - Intergenic
1057933960 9:99221486-99221508 TCGCCGTGGAGGGCGGCCGCGGG - Intronic
1059118102 9:111617479-111617501 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
1059470936 9:114504718-114504740 CGGCCGGGGCGGGCGGCGGCGGG - Exonic
1060825107 9:126683293-126683315 CGGGCCGGGCGGGCGGCGGCGGG - Intronic
1060855911 9:126914980-126915002 CCGGCCGGGACTGCGGCGGCGGG + Intronic
1061450773 9:130665964-130665986 GTGCCAGGGAGGGCGGCGCCCGG - Intronic
1061801741 9:133116576-133116598 AGGCCCGGGAGGGGCGTGGCTGG + Intronic
1186849880 X:13569806-13569828 CCCCTCGGGAGGGCGCCGGCCGG - Exonic
1187183513 X:16964919-16964941 CCGTCCGGGAGGGAGGTGGCGGG - Intronic
1188367679 X:29333804-29333826 CCGTCCGGGAGGGAGGCGGGGGG - Intronic
1189325289 X:40107808-40107830 AGGCCCGGGAGAGGGGCGGGAGG - Intronic
1190779289 X:53579013-53579035 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1190799283 X:53772784-53772806 CCGCCCGGGAGGGAGGTGGGGGG - Intergenic
1191794090 X:65002381-65002403 CCGTCCGGGAGGGAGGCGGGGGG + Intronic
1192107186 X:68327138-68327160 CCGTCCGGGAGGGCGGTGGGGGG + Intronic
1192567896 X:72179168-72179190 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1193924392 X:87466165-87466187 CCGTCCGGGAGGGAGGCGGGGGG + Intergenic
1197736263 X:129851330-129851352 CCGCCCGGGAGGGAGGTGGGGGG + Intergenic
1200084842 X:153599047-153599069 AAGCCCCGGAGGGCGGCGGAGGG - Exonic
1200182964 X:154162370-154162392 AGGCCCAGGAGGGTGGCGGCAGG + Intergenic
1200188618 X:154199484-154199506 AGGCCCAGGAGGGTGGCGGCAGG + Intergenic
1200194267 X:154236625-154236647 AGGCCCAGGAGGGTGGCGGCAGG + Intergenic
1200200023 X:154274428-154274450 AGGCCCAGGAGGGTGGCGGCAGG + Intronic