ID: 905553199

View in Genome Browser
Species Human (GRCh38)
Location 1:38859924-38859946
Sequence GAGTCACGAGGAGGGCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905553194_905553199 -5 Left 905553194 1:38859906-38859928 CCGCGGAGGGGGGAGGAGGAGTC 0: 1
1: 0
2: 0
3: 22
4: 331
Right 905553199 1:38859924-38859946 GAGTCACGAGGAGGGCGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 157
905553183_905553199 26 Left 905553183 1:38859875-38859897 CCGTCACGTGCCGGAATCACCTG 0: 1
1: 0
2: 0
3: 3
4: 45
Right 905553199 1:38859924-38859946 GAGTCACGAGGAGGGCGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 157
905553182_905553199 27 Left 905553182 1:38859874-38859896 CCCGTCACGTGCCGGAATCACCT 0: 1
1: 0
2: 1
3: 5
4: 39
Right 905553199 1:38859924-38859946 GAGTCACGAGGAGGGCGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 157
905553188_905553199 7 Left 905553188 1:38859894-38859916 CCTGACTCAGAGCCGCGGAGGGG 0: 1
1: 0
2: 1
3: 7
4: 109
Right 905553199 1:38859924-38859946 GAGTCACGAGGAGGGCGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 157
905553184_905553199 16 Left 905553184 1:38859885-38859907 CCGGAATCACCTGACTCAGAGCC 0: 1
1: 0
2: 0
3: 14
4: 182
Right 905553199 1:38859924-38859946 GAGTCACGAGGAGGGCGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 157
905553181_905553199 28 Left 905553181 1:38859873-38859895 CCCCGTCACGTGCCGGAATCACC 0: 1
1: 0
2: 0
3: 2
4: 25
Right 905553199 1:38859924-38859946 GAGTCACGAGGAGGGCGGCCCGG 0: 1
1: 0
2: 1
3: 7
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905553199 Original CRISPR GAGTCACGAGGAGGGCGGCC CGG Intronic
900553917 1:3270365-3270387 CAGTCAGGAGGAGGACAGCCAGG + Intronic
900578215 1:3394526-3394548 GAGCCAAGGGGCGGGCGGCCAGG + Intronic
900637297 1:3672202-3672224 GTGTCCAGAGGAGGGTGGCCAGG + Intronic
901787623 1:11635235-11635257 GAATAAAGAGGAGGCCGGCCGGG + Intergenic
902700394 1:18168174-18168196 GAGTGACGAGGAGGGGGCTCTGG - Intronic
903261497 1:22134036-22134058 GAGTCAAGAGGAGAGGGGACGGG + Intronic
903641481 1:24863128-24863150 GATGCAGGAGGAGGGTGGCCAGG - Intergenic
904388211 1:30161466-30161488 CAGCCACGGGGAGAGCGGCCAGG - Intergenic
905399740 1:37692609-37692631 TAGGGACGAGGAGGGCGGACGGG - Exonic
905553199 1:38859924-38859946 GAGTCACGAGGAGGGCGGCCCGG + Intronic
907523453 1:55039972-55039994 GCGTTCCGAGGAGGACGGCCTGG + Exonic
907578205 1:55547652-55547674 GTTACACCAGGAGGGCGGCCTGG + Intergenic
908404780 1:63804115-63804137 GACTCAGGAGGGGGGCGTCCTGG + Intronic
918407569 1:184225957-184225979 GAGGCAGGAGGAGCGGGGCCTGG - Intergenic
921325374 1:213982954-213982976 GAGGGACCAGCAGGGCGGCCTGG + Intergenic
922471822 1:225881821-225881843 GAGTCCTGAGGAGGGAGGCTGGG - Intronic
1063565669 10:7170838-7170860 GTGTCACGAGGAAGCCGGCTAGG + Intronic
1065286895 10:24195100-24195122 GAGTCAAGGGGAGGGTTGCCTGG - Intronic
1066460454 10:35608263-35608285 GACTGACGAGGAGGGTGGGCGGG + Exonic
1067757595 10:49016682-49016704 GAGTCAAGAGGTGGGAGGCCTGG + Exonic
1067777304 10:49172867-49172889 GAGTCACGTGGAGTGCCTCCTGG - Intronic
1068941994 10:62689503-62689525 GAGCCTGGAGGAGGGCAGCCTGG + Intergenic
1070306206 10:75240637-75240659 GAGTCACTAGGGGCGCTGCCAGG - Intergenic
1070698240 10:78579000-78579022 GAGCCACGAGGATGGCTGCGTGG + Intergenic
1075632102 10:124006638-124006660 GAGTCAGGAGCAGGACGGCTGGG - Intergenic
1077031753 11:471620-471642 CTGTCAGGCGGAGGGCGGCCTGG + Intronic
1077031779 11:471712-471734 GGGTGACGTGGATGGCGGCCTGG + Intronic
1077031792 11:471756-471778 GGGTGACGCGGATGGCGGCCTGG + Intronic
1077031805 11:471800-471822 GGGTGACGTGGATGGCGGCCTGG + Intronic
1077031844 11:471936-471958 GGGTGACGTGGATGGCGGCCTGG + Intronic
1077031857 11:471980-472002 GGGTGACGCGGATGGCGGCCTGG + Intronic
1077031864 11:472002-472024 GGGTGACGCGGATGGCGGCCTGG + Intronic
1077031881 11:472059-472081 GGGTAACGCGGATGGCGGCCTGG + Intronic
1077031893 11:472103-472125 GGGTGACGCGGATGGCGGCCTGG + Intronic
1077076988 11:706404-706426 GGGGCACTTGGAGGGCGGCCGGG + Intronic
1077488564 11:2850187-2850209 GGGTCCCGGGGTGGGCGGCCGGG - Intergenic
1078345094 11:10540973-10540995 GAGGCCCGGGGAGGGCGGCGGGG + Intronic
1079128633 11:17735275-17735297 AAGGAACGAGGAGGGCGGGCGGG + Exonic
1080016516 11:27512540-27512562 GAGGCAGGAGGATGGAGGCCGGG + Intergenic
1081835081 11:46146801-46146823 GAGTCATGGGGAGGGAGTCCAGG + Intergenic
1084372297 11:68751664-68751686 GAGTCGCGAGGGGCGGGGCCTGG + Intergenic
1084965692 11:72743443-72743465 GAGGCAAGAAGAGGGTGGCCAGG + Intronic
1085254714 11:75165879-75165901 GAGTCATGAGCAGGCCCGCCAGG - Exonic
1094199322 12:27780456-27780478 GAGCCAGGAGGCCGGCGGCCCGG + Exonic
1096996620 12:55842257-55842279 GGGTCAGGAGGAGGTGGGCCTGG + Intronic
1103948219 12:124538682-124538704 GAGTGATGTGGCGGGCGGCCAGG + Intronic
1103996558 12:124834006-124834028 GAGTCACGAGGAGGCAGTGCAGG - Intronic
1104964117 12:132501362-132501384 CAGCCATGGGGAGGGCGGCCCGG - Intronic
1107058451 13:36131063-36131085 GAGCTGCGGGGAGGGCGGCCGGG - Intronic
1110550810 13:76809487-76809509 GTGTCACCAGGAGGGCTTCCAGG + Intergenic
1112419861 13:99238479-99238501 GAGGCAGGAGGAGGGCGAGCAGG - Exonic
1122270888 14:100568089-100568111 GAGTCACGGGGGCCGCGGCCGGG - Intronic
1122275928 14:100590814-100590836 GAGCAACGATGAGGGGGGCCTGG + Intergenic
1122317545 14:100835028-100835050 GTGTCCCCAGGAGGGCGGGCCGG + Intergenic
1126944008 15:53797793-53797815 GAGTCACGAGTTGTGCAGCCTGG - Intergenic
1127753443 15:62068033-62068055 GGGTCCCCAGGAGGGCGTCCGGG - Exonic
1131118905 15:89810994-89811016 GAGGCACTTGGAGGGCTGCCTGG - Intronic
1132763828 16:1524608-1524630 GAGCCAGGAGGAGGTCGGGCAGG - Exonic
1132994680 16:2816987-2817009 GGGTCACCAAGAGGGCAGCCGGG + Intergenic
1133356943 16:5143594-5143616 GAGGCTGGAGGAGGGCGGCGGGG + Intergenic
1134084204 16:11345564-11345586 GCGCGACGCGGAGGGCGGCCCGG + Exonic
1136577038 16:31131118-31131140 GAGCCCAGAGGAGGGCAGCCAGG + Exonic
1137711810 16:50571931-50571953 GAGTGAGGTGAAGGGCGGCCGGG - Intronic
1138927426 16:61609750-61609772 GAGTCATGAAGAGAGTGGCCAGG - Intergenic
1139761483 16:69187523-69187545 GAAGCAAGAGGCGGGCGGCCTGG + Exonic
1140476165 16:75240148-75240170 GAGTGACAAGGATGGTGGCCAGG - Intronic
1141170150 16:81685911-81685933 GTCTCACAAGGAGGGTGGCCCGG - Intronic
1142108682 16:88319578-88319600 GAGGCCCTAGGAGGGCAGCCTGG - Intergenic
1142185873 16:88694505-88694527 GAGTCCTGAGGAGGGGGTCCTGG + Intergenic
1142508589 17:380913-380935 GAGGCATGAGGAGGGCTTCCGGG - Intronic
1142508664 17:381133-381155 GAGGCATGAGGAGGGCTTCCGGG - Intronic
1142795329 17:2303247-2303269 CAGGCCCGCGGAGGGCGGCCTGG + Intronic
1143371635 17:6444236-6444258 GAGCCACGAGGCTGGCGGCGGGG + Intergenic
1146000103 17:29125839-29125861 GCCTCAGGAAGAGGGCGGCCAGG + Intronic
1147882993 17:43665789-43665811 GAGTCACGAGGAGGTCCCCCAGG + Intergenic
1148031993 17:44628047-44628069 GAGTGAAGAGGAGGCCGTCCTGG - Intergenic
1148206790 17:45784440-45784462 GCGGCACGGGGTGGGCGGCCGGG - Intronic
1151362166 17:73595589-73595611 GAGTCACCAGAAAGGCAGCCTGG + Intronic
1151785716 17:76273952-76273974 GAGGCACGTGGGGGGCTGCCTGG + Intergenic
1152082137 17:78194545-78194567 GAGCCCAGATGAGGGCGGCCAGG - Intronic
1152423797 17:80208189-80208211 GAGGCAGGAGGAGGGAGACCTGG + Exonic
1159021337 18:63145466-63145488 GAGTCACGAGGGGTGCCTCCAGG - Intronic
1159065624 18:63565206-63565228 GAGTGACGGGGATGGGGGCCAGG - Intronic
1160735420 19:660161-660183 GAGTCACCAGGAGAGCGGCCAGG + Intronic
1160807963 19:1000880-1000902 GAGTCAGGACGAGGGGGACCCGG + Intronic
1162460514 19:10811521-10811543 GAGGCACGCACAGGGCGGCCTGG - Intronic
1163424786 19:17235430-17235452 AGGTTAGGAGGAGGGCGGCCTGG - Intronic
1164028860 19:21381837-21381859 GTGTCAGGGTGAGGGCGGCCTGG + Intergenic
1165098036 19:33420854-33420876 GACTGACCAGGAGGGGGGCCAGG - Intronic
1165157183 19:33795939-33795961 GAGACCCTGGGAGGGCGGCCAGG + Intronic
1168702787 19:58451679-58451701 GGGGCCCGAGGCGGGCGGCCAGG + Exonic
925671264 2:6311990-6312012 GAGTGGGGAGGAGGGCGGCCAGG - Intergenic
925850911 2:8081263-8081285 GAAGCAGGAGGAGGGCTGCCTGG - Intergenic
926328179 2:11803281-11803303 GAGTTAGGAGGAAGGCAGCCTGG + Intronic
926996407 2:18740689-18740711 GAGACAGCTGGAGGGCGGCCTGG - Intergenic
929899184 2:45986664-45986686 GAGGCACGAGGAGGGTGGTGAGG + Intronic
930090776 2:47529969-47529991 GAGTCATGAGTAGGGTTGCCAGG - Intronic
938895122 2:135742088-135742110 GCGTCTCGGGGAGGGCGGGCCGG - Intronic
941933740 2:170967243-170967265 GAGTGTCCAGCAGGGCGGCCAGG - Intergenic
942944356 2:181656955-181656977 GAGTGCCCTGGAGGGCGGCCGGG - Exonic
948386780 2:237585593-237585615 GTGTTAGCAGGAGGGCGGCCTGG + Intronic
948566790 2:238892285-238892307 GCGGCACGAGGAGGGGGCCCTGG + Intronic
1168921206 20:1537650-1537672 TAGTCAGGAGGAGGGCTCCCGGG + Intronic
1172803050 20:37591693-37591715 GAGTCTCAAGGAGGGCGACCAGG + Intergenic
1175429807 20:58892557-58892579 GAGTCGGGAGGGGGGCGGCGAGG + Intronic
1178923282 21:36754317-36754339 GGTTCACCAGGAGGGCGGCGAGG - Exonic
1179729186 21:43358202-43358224 AAGCCAGGAGGAGGGCGGCGAGG - Intergenic
1180228569 21:46412971-46412993 GAGTCTGGAGGACGGCGGCAAGG + Exonic
1180966093 22:19788668-19788690 GGGAGACGAGGAGGGCGGGCAGG - Exonic
1180967029 22:19795728-19795750 GAGTCACATGGAAGGTGGCCAGG + Intronic
1181902786 22:26169680-26169702 GAGTCCCGCGGCGGGCGGCCGGG - Exonic
1182458310 22:30466857-30466879 GAGTCACAATGAGGGAGCCCAGG + Intronic
1183412819 22:37665513-37665535 CAGTCAGCAGGAGGGCGGCAGGG - Intronic
1183646905 22:39132304-39132326 GAGCTGCGAGGAGGGCGGGCAGG + Exonic
1183723685 22:39576786-39576808 CACCCACGAGGAGGGCGGCCGGG - Intronic
1183980854 22:41539300-41539322 GACTCAGGCGGAGGGAGGCCTGG + Intronic
949459950 3:4280740-4280762 CAGACACTAGGAGGGAGGCCTGG - Intronic
954327777 3:49872947-49872969 GAGTCACAAGGTGGGGGGCGGGG - Intergenic
954684277 3:52362010-52362032 TAGCCACGTGCAGGGCGGCCAGG + Intronic
955322712 3:57985781-57985803 GATTCTCGAGGAGCTCGGCCTGG + Intergenic
959279706 3:104323026-104323048 GAGCCATCAGGAGGGTGGCCAGG + Intergenic
960506347 3:118499549-118499571 GAGTCAGGAGGATGGAAGCCAGG - Intergenic
965520372 3:169663796-169663818 GAGCCGCGGGGAGGGCGGCGGGG + Intergenic
967134768 3:186503969-186503991 GAGGCCTGAGGAGGGTGGCCAGG + Intergenic
968809337 4:2792998-2793020 GGGCCAGGAGGAGGGCGGACTGG + Intergenic
968876264 4:3269388-3269410 AAGTCAGGAGGAAGGAGGCCAGG + Intronic
969684620 4:8664178-8664200 GAGCCACCAGCTGGGCGGCCTGG - Intergenic
976339890 4:83935076-83935098 GAGTCAAGAGAAGAGCGGCTGGG - Intergenic
984822240 4:183892181-183892203 GAGACGAGGGGAGGGCGGCCCGG - Intronic
985104265 4:186485747-186485769 GAGTCACGAGGAAGCCAGACAGG + Intronic
986253662 5:6083637-6083659 GAGGCATGGGGAGGCCGGCCTGG - Intergenic
987276951 5:16372794-16372816 GAAACACCAGGAGGTCGGCCTGG + Intergenic
1000681848 5:164194885-164194907 AAGTCTCCAGGAGGGAGGCCAGG - Intergenic
1002633702 5:180596822-180596844 GAGCCATGAGGAGGGAGGACGGG - Intergenic
1003484097 6:6560534-6560556 GATTCACTAGGAGGGCTCCCAGG - Intergenic
1004413144 6:15400286-15400308 GAGTAAGGGGGAGGGCGGGCTGG + Intronic
1005965147 6:30721585-30721607 CAGTCACGTGGAGGGCGGGGGGG + Intronic
1006320530 6:33316956-33316978 AAGAAAGGAGGAGGGCGGCCGGG + Exonic
1006799125 6:36748291-36748313 GAGTCACCTGGAGGGAGGCAGGG + Intronic
1012245754 6:96924395-96924417 GAGCGAGGAGGAGGGCGGCGTGG + Intergenic
1012887290 6:104859963-104859985 GAGTCACGTTGGGGGCGCCCAGG + Intergenic
1013005964 6:106073739-106073761 GACCCATGAGGAGGGAGGCCTGG + Intergenic
1016834841 6:148466783-148466805 GAGGCAGGAGGAGAGCAGCCTGG - Intronic
1018462100 6:164008067-164008089 GAGTCACCAGGAGGCTGGCCAGG - Intergenic
1019139958 6:169936859-169936881 GAGTCGCCAGGAGGGCTGCAGGG - Intergenic
1019414370 7:920540-920562 GAACCACGTGGAGGGCGGCACGG - Intronic
1019477693 7:1251897-1251919 TAGGCACGAGGAGGGGGCCCTGG + Intergenic
1019713805 7:2529397-2529419 GAGGCACCAGGAGGGGGACCTGG - Intergenic
1019982239 7:4630124-4630146 GAGTCAGGAGGGGAGAGGCCAGG - Intergenic
1024357239 7:48426612-48426634 GAGTCACTTGGAGAGGGGCCAGG + Intronic
1024649078 7:51389475-51389497 GAGGCAGGAGGAGGTGGGCCTGG + Intergenic
1028815051 7:95133913-95133935 GAGGCAGGAGGATGGCTGCCTGG - Intronic
1029114016 7:98228201-98228223 GAGAGACGGGGAGGGCGGGCTGG + Intronic
1034269152 7:149795293-149795315 GAGCCCCCAGGAGGGCAGCCTGG - Intergenic
1034958801 7:155351590-155351612 GAGGCATGAGGAAGGCGGCTGGG + Intergenic
1036635799 8:10548779-10548801 GTGTGACCAGGAGGGCTGCCTGG - Intronic
1045551925 8:103180571-103180593 GAGTCACGAGGAACGAGGCAAGG - Intronic
1048999245 8:139814174-139814196 GAGGCAGGCGGTGGGCGGCCAGG + Intronic
1049003971 8:139843280-139843302 GAGCCAGCAGGAGGGCGGCAGGG + Intronic
1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG + Intronic
1052924675 9:34004869-34004891 GAGTCAGGAGGAGACCAGCCTGG + Intronic
1061359540 9:130132260-130132282 GAGTCTCCAGGGGTGCGGCCAGG - Intronic
1062592028 9:137278535-137278557 GAGTCCCGTGGGGTGCGGCCCGG - Intronic
1188683584 X:33042187-33042209 GAGCCATGAGGTGGGCTGCCAGG + Intronic
1198750291 X:139932143-139932165 GAGCAGCGAGGCGGGCGGCCGGG + Intronic
1200100591 X:153687796-153687818 GTGTGACGAGGAGGGCGGGAGGG + Intronic