ID: 905580535

View in Genome Browser
Species Human (GRCh38)
Location 1:39080859-39080881
Sequence AAGAGCGCCAAGGGCGGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905580527_905580535 14 Left 905580527 1:39080822-39080844 CCGCAGGATCTGCAGGACGCTCT 0: 1
1: 0
2: 0
3: 18
4: 139
Right 905580535 1:39080859-39080881 AAGAGCGCCAAGGGCGGGGACGG 0: 1
1: 0
2: 2
3: 13
4: 190
905580526_905580535 15 Left 905580526 1:39080821-39080843 CCCGCAGGATCTGCAGGACGCTC 0: 1
1: 0
2: 0
3: 9
4: 160
Right 905580535 1:39080859-39080881 AAGAGCGCCAAGGGCGGGGACGG 0: 1
1: 0
2: 2
3: 13
4: 190
905580529_905580535 -9 Left 905580529 1:39080845-39080867 CCGAGAGCTGGAGCAAGAGCGCC 0: 1
1: 0
2: 0
3: 14
4: 163
Right 905580535 1:39080859-39080881 AAGAGCGCCAAGGGCGGGGACGG 0: 1
1: 0
2: 2
3: 13
4: 190
905580524_905580535 24 Left 905580524 1:39080812-39080834 CCTATAGGACCCGCAGGATCTGC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 905580535 1:39080859-39080881 AAGAGCGCCAAGGGCGGGGACGG 0: 1
1: 0
2: 2
3: 13
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905580535 Original CRISPR AAGAGCGCCAAGGGCGGGGA CGG Intergenic
900650579 1:3728150-3728172 ACCGGCACCAAGGGCGGGGACGG - Exonic
900713959 1:4132420-4132442 AAGAGAGGAGAGGGCGGGGAGGG - Intergenic
901513647 1:9730978-9731000 AAGAGCGCCAAGCCCTGGCATGG + Intronic
901917504 1:12511277-12511299 AAGACCACCTAGGGCGGGGCTGG + Exonic
904138097 1:28329576-28329598 AAGAGAGCCAAGGCCGGGCGCGG - Intronic
905580535 1:39080859-39080881 AAGAGCGCCAAGGGCGGGGACGG + Intergenic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
909443597 1:75724413-75724435 AAGAGAGCCAGGGCGGGGGAGGG - Intronic
915865017 1:159490349-159490371 AAGAGAGACAAGGGTGGGGAAGG - Intergenic
920380561 1:205532386-205532408 CAGAGCCACAAGGGCTGGGAAGG - Intronic
921177660 1:212608325-212608347 AAGAGCGGGGGGGGCGGGGAAGG - Intronic
1063114954 10:3066995-3067017 GGGAGCGCCGATGGCGGGGAGGG - Intronic
1063662309 10:8043252-8043274 AGGAGAGCCAAAGGCGGGGAAGG + Intergenic
1065101953 10:22340542-22340564 AAGAGCGCCCTGGCCGGGAAAGG - Intergenic
1067804858 10:49385428-49385450 AAGAGTTCCAGGGGCGAGGAGGG - Intronic
1069286458 10:66721180-66721202 AAGAGACCCAAGGGTGTGGAAGG + Intronic
1070911978 10:80126969-80126991 AAGAGCGTCAGTGGCTGGGAGGG - Intergenic
1074697931 10:116067511-116067533 AAGAGTTCCAAGGGCTGGGAAGG + Intronic
1075801807 10:125159291-125159313 AAGTGCGGCCCGGGCGGGGAAGG + Intronic
1076016341 10:127030358-127030380 GCGAGGGCCAAAGGCGGGGAAGG - Intronic
1077186820 11:1239246-1239268 AAGAGTTCCAAGGGCAGGGCTGG + Intronic
1077630551 11:3808549-3808571 CAGAGCGCGAACGGCGGGGGCGG - Exonic
1077914701 11:6603731-6603753 AAGAGCGCCACGGGCGGGGCGGG + Intronic
1078084118 11:8223640-8223662 AAGCTCCCCAAGGGCAGGGACGG + Intergenic
1078086919 11:8239439-8239461 AAGAGGGCACAGGGCTGGGAAGG + Intronic
1080894670 11:36439321-36439343 AAGAGGGCAAAGGTTGGGGAGGG + Intronic
1081607542 11:44536863-44536885 AAGAGAAGCAAGGGCGGGCAGGG + Intergenic
1081799105 11:45845469-45845491 AAGAGAGCGAGGGGAGGGGAGGG + Intergenic
1083875840 11:65524282-65524304 AAGAGGCCAAAGGGCTGGGAGGG - Intergenic
1083958710 11:66002181-66002203 AAGACGGACAAGGGAGGGGACGG - Exonic
1083998964 11:66285655-66285677 AAGAGCTCACAGGGAGGGGAGGG + Intronic
1084215748 11:67646030-67646052 AAGAGGGCCACGGGCAGGGGTGG - Intronic
1084774817 11:71368351-71368373 AAGAGCGCCAAGGGTGAGCAGGG + Intergenic
1087058216 11:93954107-93954129 AAGAAAGCCAAGGGAGGAGAAGG + Intergenic
1089083924 11:115800806-115800828 AAGAGGGCCAAGGGCCAGAAAGG + Intergenic
1089632855 11:119794316-119794338 GAGACCCCCAACGGCGGGGAGGG - Intergenic
1090256114 11:125285849-125285871 AAGAGCCTCAAGGGCATGGATGG - Intronic
1092904383 12:13088744-13088766 CAAAGCCCCAAGGGAGGGGAGGG + Intronic
1096204210 12:49707465-49707487 AAGAGCGCGGGGGGCGGGGAGGG - Intronic
1098166697 12:67705853-67705875 AAGAGAGCCAAGGGACGGGCAGG + Intergenic
1103236336 12:119375879-119375901 AAGAGCTTCAAGGGAGGGGCTGG - Intronic
1103620706 12:122185573-122185595 AAGAAAGCCAAGGGTTGGGAAGG - Intronic
1105596857 13:21847032-21847054 GAGAGCGCGAGGTGCGGGGAAGG - Intergenic
1106519027 13:30480763-30480785 ATGAGAGAGAAGGGCGGGGAGGG - Intronic
1107866800 13:44710908-44710930 AATAGCCACAAGGGCTGGGAAGG + Intergenic
1108041413 13:46342640-46342662 AAGATCCTCAAGGGCAGGGATGG + Exonic
1110630024 13:77697611-77697633 AAGAGCGCCGAGGGGGCGGGTGG - Intergenic
1113450852 13:110408229-110408251 AAGGGTCCCCAGGGCGGGGAGGG + Intronic
1113579449 13:111418691-111418713 AAGAGGGCAATGGGAGGGGATGG + Intergenic
1115028502 14:28767760-28767782 GAGGGCGGCAAGGACGGGGAGGG + Exonic
1117041701 14:51774412-51774434 ATGAGAGCCAGGGGCGGCGAGGG + Intergenic
1118592532 14:67412095-67412117 AGGAGCGCGAGGCGCGGGGAAGG - Exonic
1121027765 14:90629022-90629044 AGGAGGGCCAAGGCCGGAGATGG - Intronic
1121412774 14:93759439-93759461 AGGAGAGCGAAGGGCGGGGCGGG + Intronic
1127806886 15:62529504-62529526 AAGAGAGGCAAGGGAGGGGCAGG - Intronic
1128582332 15:68818748-68818770 AAGGGCGCCAAGCGCGGGGCCGG - Intronic
1128723882 15:69973711-69973733 AAGAGCCCCAAGGCAGGGGCAGG + Intergenic
1129115132 15:73361407-73361429 GAGAGGGCCATGGGCGGGCAGGG - Intronic
1130056795 15:80533170-80533192 TAGACAGCCAAGGGCGAGGATGG + Intronic
1132355399 15:101167952-101167974 AAGTGCGCCCAGGGCAGTGAGGG + Intergenic
1133807748 16:9138443-9138465 CAGAGAGCCATGGGCAGGGACGG - Intergenic
1136517517 16:30776849-30776871 AAGACAGCCAAGGTCGGGGTGGG - Intergenic
1137913601 16:52404210-52404232 AAGAGGGACAATGTCGGGGAGGG + Intergenic
1138551823 16:57752690-57752712 CAGAGGGCCCAGGGCAGGGAGGG - Intronic
1139598018 16:67969134-67969156 TAGAGGGCCCAGGGCTGGGACGG - Intronic
1140475608 16:75238066-75238088 AAGAGCACCTGGGGAGGGGAGGG - Intronic
1141861798 16:86722200-86722222 AAGAGCCCCAAGCCCGGGCACGG + Intergenic
1142280579 16:89145686-89145708 CAGAGAGCCAAGGGGCGGGAAGG + Intronic
1142804232 17:2363144-2363166 ATGAGCCCAAAGGGTGGGGAGGG - Intronic
1143212157 17:5196396-5196418 AGGATCTCCAAGGGAGGGGAGGG - Intergenic
1143375766 17:6466184-6466206 AAGAGGGCCAGGGCCAGGGATGG - Intronic
1144828975 17:18121339-18121361 CAGAGCCCCAGGGGCGGCGAGGG - Exonic
1144907769 17:18650343-18650365 GGGAGCGCCCCGGGCGGGGAAGG - Intronic
1147742991 17:42679289-42679311 CAGAGAGCCAAGCGCGGGGCAGG + Exonic
1149593698 17:57850496-57850518 AAGAAAACCAAGGCCGGGGAGGG + Intergenic
1149599213 17:57882314-57882336 GAGACTGCCAAGGGAGGGGAGGG + Intronic
1151309794 17:73286046-73286068 AAGAAGGCCAATGACGGGGAGGG - Exonic
1151404369 17:73877202-73877224 AAGAGCTGCAAGGGAGAGGAAGG - Intergenic
1152758961 17:82098453-82098475 AGGAGCGCCGGGGGCGGGGCGGG + Intergenic
1152871018 17:82752877-82752899 AAGCGCGCCTCGGGTGGGGAGGG + Intronic
1158954765 18:62526846-62526868 AAGGGCGCCGGGGGCGGGGCCGG - Intronic
1159961111 18:74556395-74556417 AACAGCGCCGGGGGCGGGGAGGG - Exonic
1160238597 18:77106002-77106024 AAGAGCCCCAAGGCCAGGGCAGG - Intronic
1160864395 19:1250590-1250612 AAGAGCGCGCCGCGCGGGGAAGG + Intronic
1161126652 19:2561519-2561541 AAGAGTGCTAAGAGCTGGGAGGG - Intronic
1161317902 19:3626818-3626840 GAGAGCGCCGTGGGCGAGGAAGG - Intergenic
1163609688 19:18294450-18294472 AAGAGAGCCAGGGGCGATGATGG - Intergenic
1165091491 19:33390578-33390600 CAGCCCGCCAAGGGCAGGGATGG + Intronic
1166299106 19:41904150-41904172 CAGTGAGCCAAGGGCGGGGAGGG + Intronic
1166435659 19:42764861-42764883 AAAAACACCAAGGGCGTGGAGGG - Intronic
1167348796 19:48962718-48962740 AAGAGGGCCAAAGGTGGGGTGGG - Intergenic
1168410059 19:56134172-56134194 AAGATCCCCCAGGGCAGGGATGG - Intronic
926945743 2:18185751-18185773 AAGAGGGCCAAGGCAGGAGAGGG + Intronic
927088156 2:19690470-19690492 AAAAGCAGGAAGGGCGGGGAGGG + Intergenic
927249046 2:20981745-20981767 AAGAGAGCCAAGGACGAGGCTGG + Intergenic
929444279 2:41990664-41990686 AAGTGCCCCAAGGGAAGGGATGG - Intergenic
931235213 2:60406981-60407003 AAGAGAGCCTAGGGTGGGGCTGG - Intergenic
932224640 2:70029945-70029967 AACAGAGCAAAGGGAGGGGAAGG - Intergenic
932769205 2:74491207-74491229 AAGAGCACCAAGTGCCAGGAAGG + Intronic
936595128 2:113840302-113840324 GTGACCGCCAAGGGAGGGGATGG + Intergenic
938081823 2:128374253-128374275 AGGAGCACCAAGGGCAGTGAGGG + Intergenic
938420680 2:131143900-131143922 ACGAGAGCCAAGGGCAAGGATGG - Intronic
941905705 2:170715369-170715391 GCGAGGGGCAAGGGCGGGGAGGG + Exonic
942085265 2:172437742-172437764 GAGGGCACCAAGGACGGGGATGG + Intronic
942546756 2:177073421-177073443 AAGAGGGCCAAGTGAAGGGAGGG - Intergenic
944142787 2:196475394-196475416 AAGAGAGTGAAGGGAGGGGAGGG + Intronic
944457697 2:199911936-199911958 AAGGGCGCCAAGGGCGTGGAAGG - Intronic
947065206 2:226216807-226216829 TGGAGCACCTAGGGCGGGGAGGG + Intergenic
1169469467 20:5871709-5871731 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
1171036103 20:21714124-21714146 AAGGGCGCAGAGGGCTGGGAAGG - Intronic
1171811372 20:29746098-29746120 CAGAGCTCCTACGGCGGGGAGGG + Intergenic
1175206836 20:57317604-57317626 AAGAGGGCGAAGGGCAGGGATGG + Intergenic
1175610499 20:60347385-60347407 AAGAGGGCCCAGGGAAGGGAGGG + Intergenic
1179881602 21:44295387-44295409 AAAAGCCCCAAGGGCAGGGCTGG - Intronic
1180056137 21:45360091-45360113 AAGGGCGGCAGGGCCGGGGAAGG - Intergenic
1181022797 22:20112501-20112523 CAGGGCCCCAGGGGCGGGGAAGG - Exonic
1183240416 22:36653627-36653649 AAGAGTTCCAAGGGTTGGGACGG + Intronic
1183250993 22:36730277-36730299 AACAGCCCCAAGGCCTGGGAGGG - Intergenic
1183966927 22:41447600-41447622 AGGAGCGCCAGAGGCGGTGAGGG - Intergenic
1184059352 22:42072874-42072896 AAACGCGGCAAGAGCGGGGAGGG - Intergenic
1184092248 22:42298926-42298948 GAGAGGGCCCAGGGCAGGGAGGG + Intronic
1184481931 22:44752924-44752946 GAGAGAGGCGAGGGCGGGGAAGG - Intronic
1185394113 22:50578161-50578183 AGGAGCCCCAAGGACGGCGAAGG + Intronic
949970283 3:9397800-9397822 GAGCGAGCCAAAGGCGGGGAGGG - Exonic
950181766 3:10918456-10918478 AAGTTCGCCAAAGGTGGGGATGG + Intronic
954792260 3:53142187-53142209 AGGAGCTCCAAGGGCAGGCAGGG - Intergenic
956208352 3:66777166-66777188 GAGAGAGCCAAGTGTGGGGAGGG - Intergenic
960613912 3:119579885-119579907 GAGAGCGCCAGGGGCGGGGGAGG - Exonic
961797849 3:129422575-129422597 AAGAGTGCCCAGGGTGTGGATGG - Intronic
965722603 3:171678069-171678091 CAGAGTGGGAAGGGCGGGGAGGG + Intronic
966915507 3:184582147-184582169 GACAGCACCAAGGGCGGGGGTGG - Exonic
968048993 3:195641302-195641324 AAGAGGAACAAAGGCGGGGAAGG - Intergenic
968305627 3:197648631-197648653 AAGAGGAACAAAGGCGGGGAAGG + Intergenic
971941150 4:33217239-33217261 AAGATCTCAAAGGGAGGGGAGGG - Intergenic
977190965 4:94000302-94000324 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
978189399 4:105895375-105895397 AGGGGCGCCAGGGGCGGGCAGGG - Intronic
980537760 4:134150707-134150729 AAGAATGCCAAGGGTGGGGGAGG - Intergenic
981659764 4:147152495-147152517 AAGAGCGACAGGGGCTGGGGAGG + Intergenic
984753113 4:183297767-183297789 AAGAGAGACAAGGGAGGAGATGG + Intronic
985742651 5:1627823-1627845 AAGAGGAACAAAGGCGGGGAAGG + Intergenic
986680834 5:10231547-10231569 AAGAGCGCCTCGGGCAGGGTGGG - Intronic
987369712 5:17181900-17181922 GAGAACGCCAGGGTCGGGGAGGG - Intronic
995650374 5:114362248-114362270 AGGGGCGCGAAGGGCGGGCACGG - Exonic
997530767 5:134579948-134579970 CAGAGCAGCAAGGGAGGGGAGGG - Exonic
997964603 5:138347226-138347248 AAGAGAGCAATGGGCAGGGAAGG + Exonic
998157645 5:139795740-139795762 AGGAGCGGGAAGGGCGGGGAAGG - Intergenic
998442613 5:142175115-142175137 AGGAGCGCCAACGGTGGGGGAGG + Intergenic
998747471 5:145277491-145277513 AAGAGAGACAAGGACAGGGATGG - Intergenic
999023632 5:148199585-148199607 AAGATAGCCAAGTGCTGGGAGGG - Intergenic
999662321 5:153878362-153878384 AAGAAAGCCAAGGGTGGGGTGGG + Intergenic
1000137722 5:158368907-158368929 AAGAGGACCAAGGGGAGGGAGGG - Intergenic
1000345639 5:160311829-160311851 GAGAGTGACAAGGGCAGGGAGGG + Intronic
1002001098 5:176196634-176196656 AAGCCCTCCAAGGGTGGGGATGG - Intergenic
1002078457 5:176723585-176723607 GAGAGCGCCAAGAGAAGGGAGGG - Intergenic
1002253237 5:177942338-177942360 AAGCCCTCCAAGGGTGGGGATGG + Intergenic
1002893212 6:1355804-1355826 AAGAGAGGGAAGGGAGGGGAGGG + Intergenic
1006271348 6:32969221-32969243 GAGAGGGCCATGGGGGGGGAGGG + Intronic
1009995218 6:70889125-70889147 AAGGAAGCCAAGGGCTGGGAAGG - Intronic
1012247275 6:96939656-96939678 CAGAGAGCCAAGGGCAGTGAAGG + Intronic
1012410381 6:98948850-98948872 AAAAGTGCCAAGGGCGGGCGCGG - Intergenic
1017286383 6:152681203-152681225 AAGAGAGAGAAGGGAGGGGAGGG + Intergenic
1018948844 6:168365346-168365368 AAGAGGGCCGGGGTCGGGGAAGG + Intergenic
1019111993 6:169724158-169724180 GAGGGCGCCAAAGGCTGGGAGGG + Intronic
1019278635 7:188933-188955 AGGAGGGCTAAGGGCGGGGCAGG - Intergenic
1021909507 7:25370018-25370040 AAGAGAGCCAGGTGCTGGGATGG + Intergenic
1022715238 7:32892176-32892198 AAGAGCAGGAAGGGCGGGGGCGG + Intronic
1024084624 7:45883118-45883140 CAGAGCACCAAGAGCAGGGAGGG - Intergenic
1024765787 7:52657574-52657596 AAAAGCTCCATGGGCAGGGATGG - Intergenic
1026308767 7:69166144-69166166 AAGAGGGGAAAGGGGGGGGAAGG + Intergenic
1026909356 7:74083586-74083608 AAGGGCGGAAGGGGCGGGGAGGG + Intronic
1028796402 7:94908111-94908133 GGGAGCGCCGCGGGCGGGGAGGG - Intronic
1028977978 7:96935077-96935099 AAGAGGGGTAAGGGCGGGGGTGG - Intergenic
1029436024 7:100564485-100564507 AAGGGAGCCAAGGGCAGGGCTGG - Intronic
1029497390 7:100903385-100903407 AAGTGCGCCCAGGACGAGGATGG - Intergenic
1031187985 7:118507388-118507410 AAGAGCTCACAGGGAGGGGAGGG + Intergenic
1033740606 7:144272562-144272584 AGGAGGGCCAAGGATGGGGATGG + Intergenic
1033753301 7:144377051-144377073 AGGAGGGCCAAGGATGGGGATGG - Intronic
1034279682 7:149844359-149844381 AAGAGCACACAGGGAGGGGACGG + Intronic
1035693387 8:1574342-1574364 CAGAGCGGCGAGGGCTGGGATGG - Intronic
1038169256 8:25113989-25114011 AAGATCTCCAAGGGCAGGGAAGG - Intergenic
1039413931 8:37377696-37377718 AAGAGGGCCCAGGGCAGGGCAGG + Intergenic
1044703647 8:94987421-94987443 AGGAGCCCCAAGGGAGAGGAGGG - Intronic
1044837479 8:96310450-96310472 AAGAGAGCCAAGGCCGGGTGCGG - Intronic
1047097621 8:121641392-121641414 AAGGGCAACAACGGCGGGGAAGG - Intergenic
1047746823 8:127851420-127851442 ATGAGGGCCATGGGCGGGGGTGG - Intergenic
1049380724 8:142314474-142314496 AAGAGCAAAAAGGGTGGGGAAGG + Intronic
1049702833 8:144022898-144022920 AAGAGGGCCATGGCGGGGGATGG - Intronic
1055874214 9:80923128-80923150 AAGAGCCCCCAGGCCGGGCACGG + Intergenic
1056853021 9:90100159-90100181 AAGAGGGCCAAGGGGAGGGCTGG + Intergenic
1060782102 9:126420450-126420472 ATGAGCACCAAGGGCTGTGAAGG - Intronic
1061838896 9:133346529-133346551 AAGACCGCCAAGGTGGGGGTGGG - Exonic
1061942799 9:133892123-133892145 AAGGGACCCAAGGGCGGGGTGGG + Intronic
1062373950 9:136253700-136253722 AGGGGCCCCGAGGGCGGGGAAGG + Intergenic
1062460285 9:136660060-136660082 CAGAGCGGCCAGGGCAGGGAAGG + Intronic
1062531523 9:137003072-137003094 AAGAACGCCAAGGCTGGGGACGG + Intergenic
1185621489 X:1453413-1453435 GCGAGCGCCGGGGGCGGGGACGG - Intronic
1186670628 X:11764224-11764246 AAGAGAGCACAGGCCGGGGAGGG + Intronic
1186706067 X:12139861-12139883 AAGAGCTCCAGGGGCAGAGAAGG - Intronic
1187469205 X:19553158-19553180 CAGAGAGCCAGGGGAGGGGATGG + Intronic
1188004476 X:25007503-25007525 CAGCGCGCCAAGGGAAGGGACGG - Intronic
1189704947 X:43750490-43750512 AAGAGCTCCAAGTGCAGAGAAGG - Intergenic
1189865590 X:45323805-45323827 AAGAGTGGGAAGGGTGGGGATGG - Intergenic
1194112594 X:89853807-89853829 ATGAGAGGCAAGAGCGGGGAGGG + Intergenic
1195522961 X:105851741-105851763 AAGGGCACCATGGGAGGGGAGGG + Intronic
1196891531 X:120295345-120295367 AAGAGACCCAAGGGCTGGGCAGG + Intronic
1200465247 Y:3508619-3508641 ATGAGAGGCAAGAGCGGGGAGGG + Intergenic