ID: 905580677

View in Genome Browser
Species Human (GRCh38)
Location 1:39081284-39081306
Sequence AGCGCGCATCGGGGGGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905580677 Original CRISPR AGCGCGCATCGGGGGGCGGG GGG Intergenic
900023313 1:199946-199968 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
900368813 1:2322503-2322525 AGCAAGCCTCGGGGGCCGGGAGG + Intronic
901836289 1:11926101-11926123 GGCGCGCGGCGGGCGGCGGGCGG - Exonic
902072124 1:13749277-13749299 GGCGCGCACCGGGACGCGGGCGG - Intronic
905199463 1:36306489-36306511 AGAGGGCAGCGGGGGTCGGGGGG - Intronic
905518368 1:38578662-38578684 AGCGCGCAGCCGAGGGCGCGGGG - Intergenic
905580677 1:39081284-39081306 AGCGCGCATCGGGGGGCGGGGGG + Intergenic
906614543 1:47225482-47225504 AGCGCGCGGCCGGGGGCGGCGGG + Exonic
907089187 1:51709034-51709056 AGCGGGCAGCGGAGGGAGGGAGG - Intronic
912492713 1:110070730-110070752 CGCGCGCCGCGGGGGGCGGGGGG + Intronic
913506380 1:119519865-119519887 AGGGCCTATCGGGGGGTGGGGGG - Intergenic
916107020 1:161440336-161440358 AGCGCGGAGCTGCGGGCGGGCGG - Intergenic
916108581 1:161447750-161447772 AGCGCGGAGCTGCGGGCGGGCGG - Intergenic
916110169 1:161455131-161455153 AGCGCGGAGCTGCGGGCGGGCGG - Intergenic
916111754 1:161462541-161462563 AGCGCGGAGCTGCGGGCGGGCGG - Intergenic
916113341 1:161469922-161469944 AGCGCGGAGCTGCGGGCGGGCGG - Intergenic
920171095 1:204073056-204073078 AGCGCGCAGGGGGAGGAGGGAGG - Intergenic
921912516 1:220565561-220565583 AGCGGGGGTCGGGGGGAGGGAGG + Intronic
923890233 1:238206904-238206926 AGGGCCTATCGGGGGGTGGGGGG + Intergenic
1065243075 10:23727799-23727821 AGGGCCCATCGGGAGGTGGGGGG - Intronic
1065712776 10:28533323-28533345 ACCGCGAACCGGGGGGAGGGGGG - Intronic
1069634736 10:69918218-69918240 AGGGGGCAGCAGGGGGCGGGGGG - Intronic
1069837642 10:71319349-71319371 AGCGCGAGTCTGGGGGCGGCCGG - Intronic
1070896073 10:79983587-79983609 TGCGCACATCGGGGGGCTGCAGG - Intergenic
1074402266 10:113151903-113151925 AGGGAGAAGCGGGGGGCGGGTGG + Intronic
1077123581 11:922373-922395 AGTGCTCATCACGGGGCGGGTGG - Intergenic
1077211824 11:1374804-1374826 AGCAGGCTGCGGGGGGCGGGGGG - Intergenic
1077228953 11:1450244-1450266 AGGGCGGCTCGGGGGGCGGTGGG - Intronic
1078245916 11:9573449-9573471 AGCGAGCCTGGGGCGGCGGGGGG - Intergenic
1080034894 11:27700528-27700550 AGCGGGGGGCGGGGGGCGGGGGG - Intronic
1080034899 11:27700535-27700557 AGCGGGGAGCGGGGGGCGGGGGG - Intronic
1081576250 11:44320091-44320113 TGCGCGGGGCGGGGGGCGGGGGG - Intergenic
1081863531 11:46347522-46347544 GGCGCGCGGCGCGGGGCGGGCGG + Intronic
1083766246 11:64842930-64842952 AGCCCGCAGCGGGGGCGGGGTGG + Intronic
1083811077 11:65107405-65107427 AGCGCACATGGGGGCGGGGGAGG - Intronic
1084694039 11:70743391-70743413 TGCTCGCATTGGGGGGCGAGGGG - Intronic
1091377012 12:31484-31506 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1091386599 12:99932-99954 AACACAGATCGGGGGGCGGGTGG - Intronic
1094763300 12:33560804-33560826 AGCACGGTTCGGGGGGCGGTAGG + Intergenic
1095958539 12:47819726-47819748 CGCGCGCAGGGCGGGGCGGGGGG + Intronic
1097191202 12:57220390-57220412 GGCGCGGGGCGGGGGGCGGGGGG + Intronic
1100869417 12:98894923-98894945 GGCGCGCGGCGGGGGGTGGGGGG - Intronic
1101830654 12:108253856-108253878 AGAGAGGATGGGGGGGCGGGGGG + Intergenic
1102101327 12:110281156-110281178 AGCGCCCAGCGCGGCGCGGGCGG - Intronic
1102521628 12:113480742-113480764 AGCTGGAAGCGGGGGGCGGGGGG + Intergenic
1103698544 12:122835647-122835669 AGCGGGCGGCGGGCGGCGGGCGG + Intronic
1103800311 12:123533610-123533632 AGGGCGCAGCGGGCAGCGGGCGG + Exonic
1103953865 12:124566302-124566324 AGCGCGCGACAGGCGGCGGGAGG + Intronic
1105019970 12:132809438-132809460 ACCGGGAACCGGGGGGCGGGGGG - Intronic
1106481359 13:30139547-30139569 AGGGCCTATCGGGGGGTGGGGGG + Intergenic
1110573056 13:77026914-77026936 AGCGCGAAGCGGGGGGCCAGGGG - Exonic
1113464977 13:110506618-110506640 AGCAGGCAACGGGGGCCGGGTGG - Intronic
1117279601 14:54225443-54225465 AGGGGGCTTCCGGGGGCGGGTGG + Intergenic
1119646580 14:76352900-76352922 AGCGCTCAGCGAGGGGCGCGCGG - Intronic
1120565916 14:86056888-86056910 AGGGCCCGTCGGGGGGTGGGAGG - Intergenic
1120993225 14:90396873-90396895 GGCGCGCAGGGGGCGGCGGGAGG + Intronic
1123799104 15:23802925-23802947 AGCGGGAACCGGGGTGCGGGCGG + Intergenic
1126738087 15:51751714-51751736 TGAGCGCCCCGGGGGGCGGGTGG + Intronic
1127606182 15:60591291-60591313 AGCGGGCGGCGGGCGGCGGGCGG + Intronic
1127674828 15:61228986-61229008 GGCGCGGAGCGGGGGGCGGCCGG - Intronic
1129710985 15:77820086-77820108 AGCGCGCAGTGGGCGGCGAGGGG + Intronic
1129780140 15:78264594-78264616 GGCGCGGGGCGGGGGGCGGGCGG + Intronic
1129983561 15:79896742-79896764 TGCGCGCGCCGGGGGGTGGGGGG + Intronic
1132449908 15:101961510-101961532 AGGGCGCAGCGGAGGGCGAGCGG + Intergenic
1132481107 16:166503-166525 AGCGCGCAGCCGGGGTGGGGGGG + Intronic
1133015161 16:2936446-2936468 AGAGGCCAGCGGGGGGCGGGAGG - Intronic
1133325034 16:4937086-4937108 GGCGCGCACCGAGGGGCGGGCGG + Exonic
1134531925 16:14990024-14990046 GGCGCGCAGCGGGCGGCGGGCGG - Intronic
1135821827 16:25692191-25692213 GGCGGGCAGCGTGGGGCGGGGGG + Exonic
1139952700 16:70679872-70679894 AGTGCGCTGCGGAGGGCGGGCGG + Exonic
1139968786 16:70761014-70761036 TGTGTGCATGGGGGGGCGGGGGG + Intronic
1141998058 16:87647573-87647595 AGCGGGCGTCGCGGGGAGGGAGG + Intronic
1142308257 16:89297875-89297897 AGCTCCCATCGGCAGGCGGGAGG - Intronic
1142810360 17:2393137-2393159 AGCCCGCGTTGGGGGGGGGGTGG - Intronic
1143451400 17:7038852-7038874 AGAGAGCATCGGGGGGCTGCTGG + Exonic
1144756172 17:17681800-17681822 AGCGAGCGCCGGGGCGCGGGGGG + Intronic
1145059304 17:19722521-19722543 AGCGGGCAGCGGGGGGTGCGGGG + Intergenic
1147742322 17:42676306-42676328 AGCGCGCAGCGTGTGGCTGGAGG + Intronic
1148664179 17:49362167-49362189 GGCGGGCAGCGCGGGGCGGGCGG + Intronic
1148687004 17:49506662-49506684 AGTGCGGTTCGGGGGGCGGGGGG + Intronic
1149512560 17:57256035-57256057 AGGGCACAGCGGAGGGCGGGCGG + Intronic
1151572903 17:74936110-74936132 AGCGCGGGTTGCGGGGCGGGTGG - Intronic
1151662167 17:75524999-75525021 TGGGCGCAGCGGGGTGCGGGTGG + Intergenic
1151703180 17:75753987-75754009 GGCGCGGATCGGGGGGCGGCGGG - Intronic
1151708396 17:75784995-75785017 CGCGCGCGGCGGGGGGGGGGGGG - Intronic
1152121539 17:78421891-78421913 AGAGAGCAGCGGGCGGCGGGCGG + Intronic
1152208551 17:78990500-78990522 AGGGCGCATCGGGCCGCGGCGGG - Intergenic
1152468432 17:80477942-80477964 TGCGCGCAGCCGGGGGCTGGGGG + Intergenic
1155519863 18:26656954-26656976 CGCGCGGAGCGGCGGGCGGGCGG + Intronic
1160635348 19:71037-71059 AGGGCGCAGCGGAGGGCGAGCGG - Intergenic
1161588830 19:5119543-5119565 AGCGCTCTTCTGGGGGTGGGCGG + Intronic
1162312289 19:9914283-9914305 AGCGGGCATTGGGGGGCGTGGGG + Intronic
1162572451 19:11481015-11481037 AGCGCGCAGCGCGGGCCGGAGGG - Exonic
1163102572 19:15107324-15107346 GGCGCGGGGCGGGGGGCGGGCGG + Intergenic
1165345912 19:35248763-35248785 AGCGCGCAGCGGGTGGAGTGTGG + Exonic
1165774355 19:38395989-38396011 AGCGCGCGGCGGGGCGCGGGTGG - Exonic
1167315100 19:48758136-48758158 AGCCCACATCGGGGGGCTGGGGG - Exonic
1167759900 19:51439436-51439458 AGGGCTCACCTGGGGGCGGGTGG - Intergenic
1168276959 19:55284075-55284097 AGGGCGCGTGGGGGGGCGGGGGG + Intronic
1168722075 19:58559647-58559669 AGCGTGCCTCGGAGGGCGGGAGG + Intergenic
925009114 2:468492-468514 AGGACGCAGCGGGGGGCGGGGGG + Intergenic
926874297 2:17457778-17457800 AGCCCGCAGGGAGGGGCGGGGGG - Intergenic
927472187 2:23385129-23385151 GGCGCGCAGCCAGGGGCGGGCGG - Intergenic
927794127 2:26033771-26033793 AGCGGGGAGCGGGAGGCGGGAGG + Intergenic
928998611 2:37324438-37324460 AGCGCGCGGCGGGAGGTGGGCGG - Intronic
929936672 2:46298407-46298429 AGTGGGCAAAGGGGGGCGGGAGG + Intronic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
934035821 2:88087868-88087890 GGCGCGCATCATGTGGCGGGTGG + Exonic
934576113 2:95402625-95402647 CGGGCCCATCGTGGGGCGGGCGG - Intergenic
939199067 2:139011495-139011517 AGCGCCTACCGGGGGGTGGGGGG + Intergenic
942885481 2:180918696-180918718 AGCATGGCTCGGGGGGCGGGGGG + Intergenic
945647648 2:212519528-212519550 AGGGCATATCAGGGGGCGGGGGG + Intronic
948868779 2:240788029-240788051 GGCACGAAGCGGGGGGCGGGCGG - Exonic
1170476542 20:16720630-16720652 AGGGCCTATCGGGGGGTGGGGGG - Intergenic
1171473523 20:25390481-25390503 CGCGCGGAGCGGGGGGGGGGGGG - Intronic
1176194696 20:63831614-63831636 AGGGCGCAGCGGGGGCCAGGGGG - Intergenic
1176221087 20:63969683-63969705 CGGGCGCGGCGGGGGGCGGGGGG + Intronic
1179879100 21:44286148-44286170 TGGGGGCAGCGGGGGGCGGGCGG - Intronic
1180259941 21:46662087-46662109 GGCGCGCATGGGGGCACGGGTGG + Intronic
1181813810 22:25421498-25421520 ATGGGGCATCGGAGGGCGGGTGG + Intergenic
1184101386 22:42343442-42343464 CGGGCGCGGCGGGGGGCGGGGGG - Intronic
1184523002 22:45007087-45007109 GGCGCGCGGCCGGGGGCGGGGGG + Intronic
950134896 3:10574198-10574220 AGCGGGCATCGGAGGGAGGCAGG - Intronic
950153744 3:10707695-10707717 AGCGGGCACCAGGCGGCGGGCGG - Intronic
952476738 3:33718130-33718152 GGGGCGCAGCGGGCGGCGGGAGG + Intronic
956681415 3:71785119-71785141 AGCGCGGAGCGGCGGGCGGACGG + Intronic
961202513 3:125055940-125055962 AGCGGGCAGCGGGCAGCGGGCGG + Exonic
961603392 3:128077038-128077060 GGCGCGCAGCGGGCGGCGGCTGG - Intronic
961754918 3:129121832-129121854 AGGGCGGAGCCGGGGGCGGGCGG - Intronic
967977317 3:195042671-195042693 AGAATGCAGCGGGGGGCGGGGGG + Intergenic
968448420 4:663889-663911 GGGGCGCCTCGCGGGGCGGGCGG + Intronic
968756497 4:2418752-2418774 AGCGCGCCTCGGGCGGGGTGCGG - Intergenic
969285621 4:6200327-6200349 AGCTCGCAGCGGGGAGGGGGCGG - Exonic
969344845 4:6563981-6564003 GGCGCGGATCGCGGGGCGCGGGG + Intergenic
969417187 4:7068356-7068378 CGCGCGCGTCGCGGGCCGGGAGG + Intergenic
976226366 4:82798170-82798192 GGCGCGCAGCGGGAGGCGAGGGG + Intronic
976389968 4:84497526-84497548 GGCAGGCATCGGGGCGCGGGTGG + Intronic
977694332 4:99949898-99949920 AGCGCGCGGCGGGGGGCGAACGG - Intronic
983938433 4:173518842-173518864 AGCGGGGAGCAGGGGGCGGGGGG - Intergenic
987340447 5:16935472-16935494 GGCGCGCGCCGGGGCGCGGGCGG - Intronic
991922634 5:71671912-71671934 AGAGAGCATTGGAGGGCGGGGGG - Intergenic
994197548 5:96936332-96936354 AGGGAGGTTCGGGGGGCGGGCGG + Intronic
999298800 5:150477489-150477511 AGGGCGCAGTGGGGGGCGGAGGG + Intergenic
1000420542 5:161033661-161033683 TGCGCGCATTGGGTGGGGGGGGG + Intergenic
1001617733 5:173056531-173056553 AGAGCGGAACGGGGGGCGGAGGG + Intronic
1003141728 6:3477488-3477510 AACGGGGCTCGGGGGGCGGGAGG + Intergenic
1004733713 6:18384117-18384139 AGAGCGTTTCGGGGGGAGGGGGG - Intergenic
1006851614 6:37102719-37102741 AGCGCGCAGCTCGGGGAGGGAGG - Intergenic
1006855610 6:37131197-37131219 AGGGATCATGGGGGGGCGGGGGG - Intergenic
1008598527 6:53065943-53065965 GGAGTGCGTCGGGGGGCGGGGGG + Intronic
1017920672 6:158869656-158869678 CGCGCGGATCCGGGGGCGGCGGG - Intergenic
1018046320 6:159969290-159969312 AGAGCGCTGCGGGCGGCGGGCGG - Exonic
1019731569 7:2632125-2632147 CGCGCGCATCCGGAGGCGGCCGG + Exonic
1021839118 7:24707943-24707965 AGCTGGCATCGGGTGGAGGGAGG - Intronic
1022098580 7:27156076-27156098 AGCGCGGAGCGCGGGGCGCGGGG - Intronic
1022286346 7:28958311-28958333 GGTGCGCGTCGGCGGGCGGGAGG + Intergenic
1022973494 7:35537308-35537330 AGGGCGGGGCGGGGGGCGGGGGG + Intergenic
1024188176 7:46976283-46976305 AGGGCCTGTCGGGGGGCGGGGGG - Intergenic
1025981884 7:66413627-66413649 AGCGCGCATGCGCAGGCGGGTGG + Intronic
1029168994 7:98617734-98617756 AGCGCGCTGCGAGGGGCTGGCGG + Exonic
1029640446 7:101816495-101816517 AGCGGGGAGCGGGGAGCGGGCGG + Intronic
1029640451 7:101816502-101816524 AGCGGGGAGCGGGCGGCGGGGGG + Intronic
1029640454 7:101816509-101816531 AGCGGGCGGCGGGGGGCGGGCGG + Intronic
1029708194 7:102286473-102286495 AGCGCGGAGCGTGGGGCCGGGGG - Intronic
1034415173 7:150960866-150960888 AGCACGGGTTGGGGGGCGGGGGG - Intronic
1034620288 7:152451665-152451687 AGCCTGCGGCGGGGGGCGGGGGG - Intergenic
1037079036 8:14760066-14760088 AGTGCTCATCATGGGGCGGGTGG - Intronic
1037886712 8:22599551-22599573 AGCGGGGCTGGGGGGGCGGGGGG - Intronic
1039923909 8:41911900-41911922 AGCCCTCATCGTGGGGCTGGGGG - Intergenic
1041552694 8:59119312-59119334 GGCGGGGATGGGGGGGCGGGCGG - Intergenic
1042399605 8:68330888-68330910 AGCAGGAATCAGGGGGCGGGAGG - Exonic
1047739331 8:127794377-127794399 GGGGCGCACCGGGCGGCGGGCGG + Intergenic
1048029565 8:130618426-130618448 AGCACAGTTCGGGGGGCGGGGGG + Intergenic
1057259743 9:93576933-93576955 GGCGCGCAGCCGGGGGCGCGGGG - Intronic
1057871040 9:98717796-98717818 AGCTCGCATCGGGGCAGGGGAGG + Intergenic
1058051567 9:100411708-100411730 AGCGCGCAGAGCGGGGCGGTTGG - Intergenic
1059115759 9:111599211-111599233 AGCGGGCGGCGGGCGGCGGGAGG - Intronic
1060970541 9:127735083-127735105 AGCCCGGAGCGAGGGGCGGGCGG - Intronic
1062320920 9:135990244-135990266 GGCCCACAGCGGGGGGCGGGGGG - Intergenic
1186484462 X:9923310-9923332 AGAGGGCAGTGGGGGGCGGGGGG + Intronic
1196616175 X:117769308-117769330 AGCCCACAGCGGGGGGCAGGGGG - Intergenic
1196765067 X:119235908-119235930 GGCGCGCATCAGGTGGCGGAGGG + Intergenic