ID: 905580896

View in Genome Browser
Species Human (GRCh38)
Location 1:39082024-39082046
Sequence CGCGCCCCTCCTCCGCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905580884_905580896 5 Left 905580884 1:39081996-39082018 CCCACCCGCGCCGCCCCAGGCTC 0: 1
1: 0
2: 1
3: 55
4: 533
Right 905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 118
905580885_905580896 4 Left 905580885 1:39081997-39082019 CCACCCGCGCCGCCCCAGGCTCG 0: 1
1: 0
2: 2
3: 38
4: 443
Right 905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 118
905580893_905580896 -10 Left 905580893 1:39082011-39082033 CCAGGCTCGCGGGCGCGCCCCTC 0: 1
1: 0
2: 2
3: 22
4: 211
Right 905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 118
905580891_905580896 -8 Left 905580891 1:39082009-39082031 CCCCAGGCTCGCGGGCGCGCCCC 0: 1
1: 0
2: 1
3: 25
4: 195
Right 905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 118
905580890_905580896 -5 Left 905580890 1:39082006-39082028 CCGCCCCAGGCTCGCGGGCGCGC 0: 1
1: 0
2: 0
3: 27
4: 177
Right 905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 118
905580886_905580896 1 Left 905580886 1:39082000-39082022 CCCGCGCCGCCCCAGGCTCGCGG 0: 1
1: 0
2: 1
3: 31
4: 381
Right 905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 118
905580882_905580896 27 Left 905580882 1:39081974-39081996 CCACGCTTGGCGGGCGCGCGGAC 0: 1
1: 0
2: 1
3: 5
4: 58
Right 905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 118
905580888_905580896 0 Left 905580888 1:39082001-39082023 CCGCGCCGCCCCAGGCTCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 285
Right 905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 118
905580892_905580896 -9 Left 905580892 1:39082010-39082032 CCCAGGCTCGCGGGCGCGCCCCT 0: 1
1: 0
2: 0
3: 7
4: 90
Right 905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905580896 Original CRISPR CGCGCCCCTCCTCCGCCGTG GGG Intronic
900511515 1:3063141-3063163 CTCGCCCCTCCTCCACCCAGCGG + Intergenic
901026194 1:6279895-6279917 GGCGGCCCTCCTCAGCCATGTGG + Intronic
902768301 1:18631231-18631253 CCCGGCCCCCCTCCGCCGCGGGG + Exonic
904941095 1:34165242-34165264 CGCGCCTCTCCCCGGCCGGGCGG - Exonic
905580896 1:39082024-39082046 CGCGCCCCTCCTCCGCCGTGGGG + Intronic
906650394 1:47508617-47508639 CGCTCCCCGCCCCCGCCGGGGGG + Intergenic
915629252 1:157138739-157138761 CCCGCCAGTCCTGCGCCGTGAGG + Intergenic
921155012 1:212432792-212432814 CGCGCGCCTCCTGCGCCCCGGGG - Intergenic
921355503 1:214281238-214281260 CGCGCCCCGCCGCCACCATGAGG + Exonic
921947403 1:220895534-220895556 CGCGCCCCTGCTCCGGCGCCGGG + Intergenic
923603535 1:235423650-235423672 CGCGCTCCTCCTCTGCCCTTGGG - Intronic
924362381 1:243255061-243255083 CGCGCCCCGCCTCCCCCGTCCGG - Intronic
924940960 1:248812203-248812225 CTCGGCGCTCCTCCCCCGTGGGG - Exonic
1062767500 10:76596-76618 CGCCCCACGCCGCCGCCGTGCGG + Intergenic
1064934898 10:20668756-20668778 CAGGCCCCTCCTCCGACATGTGG - Intergenic
1065239857 10:23694676-23694698 CGCGCCGCTCCTCCGCGGGGTGG + Intergenic
1065844772 10:29735713-29735735 CGCGCCCCTCGGCCACCGCGCGG + Intronic
1069595366 10:69666637-69666659 CGCTACCCTCCTCCCCCTTGGGG - Intergenic
1070954274 10:80454252-80454274 CGCGCCCCGCCCCCGCCGCTCGG + Exonic
1073446576 10:103584569-103584591 CGCGCTCCTTCACCGCCCTGCGG + Exonic
1076035638 10:127196597-127196619 CCCGCCCCACCTCCGCCCCGCGG - Intronic
1076535128 10:131172257-131172279 GGTTCCCCTCCTCCCCCGTGGGG - Intronic
1076535145 10:131172296-131172318 GGTTCCCCTCCTCCCCCGTGGGG - Intronic
1080784660 11:35463661-35463683 CGGCCCCCTCCTCCGCCTTGAGG - Intronic
1083237735 11:61362313-61362335 CGGGCCCCGTCTGCGCCGTGCGG - Exonic
1083644920 11:64166414-64166436 GGCGCGCCTGCTCCGCCGCGGGG - Intergenic
1083660020 11:64247570-64247592 GCCGCCCCTCCCCCGCCCTGCGG + Intergenic
1084265619 11:68003874-68003896 CCCGCCCCGCCCCCGCCGGGGGG + Intronic
1085323781 11:75591474-75591496 AGTGCCCCACCTCCTCCGTGAGG + Intronic
1088089485 11:106021810-106021832 CGCGCCCCTGCTCCCCTGGGTGG - Exonic
1089557193 11:119321032-119321054 CGCCCCCTGCCTCCGCCGGGCGG - Intronic
1090189727 11:124760027-124760049 CGCGCCCTTCCTTCACCTTGTGG + Intronic
1096191627 12:49623603-49623625 CGAGCCCCTCCACCCCCGCGCGG - Intronic
1096981236 12:55729069-55729091 CGGTCCCCTCCCCCGCCGAGTGG + Intronic
1108555265 13:51584979-51585001 TGCGCGCCGCCTCCGCTGTGTGG + Intronic
1112402205 13:99086725-99086747 GCGGCCCCTCCTCCGCCGTCCGG - Intergenic
1112589627 13:100751319-100751341 CGCCCCCCTCCTGCTCCATGGGG + Intergenic
1117690412 14:58299384-58299406 CGCGCCCCGCCTCCGCCGCTCGG - Intronic
1128253383 15:66179459-66179481 TGCTCCCCTCCTCCCACGTGTGG - Intronic
1128582181 15:68818196-68818218 CCCGCCCCTCCTCCCCGGCGCGG - Intronic
1132559985 16:589259-589281 TGCGCCCCGCCGCCGCCGGGCGG + Intergenic
1132672388 16:1107137-1107159 CGCCCCCCCCCGCCACCGTGTGG - Intergenic
1134089401 16:11383641-11383663 CTGGCCCCTCCTCCACAGTGTGG - Exonic
1136245812 16:28975169-28975191 CGCGCCCTTCCTCAGCCAGGCGG + Exonic
1136429514 16:30188414-30188436 CCAGCCACTCCTCAGCCGTGAGG - Exonic
1136462182 16:30418371-30418393 CGCGCCCCTCCGCAGCCCTGCGG - Exonic
1138178700 16:54928765-54928787 CTCACCTCTCCTCCGCCGCGCGG + Intergenic
1138651600 16:58464149-58464171 CGCGCCCTTCCTCCGCCTCCTGG + Exonic
1139402812 16:66696201-66696223 CGCGCCCCCTCTCCCTCGTGGGG - Intronic
1141702907 16:85650598-85650620 CGCGCCCCTGCTCTGCTCTGGGG - Intronic
1143513497 17:7408145-7408167 CCCGCCCCTCCTCCCTCCTGGGG + Intronic
1147315477 17:39618146-39618168 CCCGCCCCGCCCCCGCCGCGTGG - Intergenic
1147710374 17:42459107-42459129 GGCACCCCTCCTCTGCCCTGAGG + Intronic
1148909143 17:50931211-50931233 CCCGCCCTCCCTCCGCCGTCCGG + Intergenic
1150438635 17:65173582-65173604 AGCTCCCCTCCTCCACCCTGAGG - Intronic
1152396284 17:80035703-80035725 CCCGCCCCAGCTCCGCCGAGGGG + Intronic
1152758614 17:82097425-82097447 CGCGCCGCCCCTCGGCAGTGCGG + Intronic
1157613787 18:48975512-48975534 TCGGCCCCTCCGCCGCCGTGCGG - Intergenic
1160719085 19:589812-589834 CCCGCCCCTCCCCCGCCGCGAGG + Intergenic
1160884050 19:1336579-1336601 CCCGCCATTCCTCCGCCGTGGGG - Intergenic
1162027871 19:7904462-7904484 CGCCCCCCTCCCCCGGCCTGGGG + Intronic
1162396442 19:10420411-10420433 CGCCCCCCTCCTCCTCCGTCCGG - Intronic
1162744573 19:12791373-12791395 CGCCCCCCTCCTCGAGCGTGGGG - Intronic
1162959679 19:14118280-14118302 CGCGCCCCTCCCCCGCTGGCAGG - Intergenic
1165285564 19:34838937-34838959 CGCGCCCCTCGTCCCCCATCTGG - Intergenic
1166732162 19:45065025-45065047 CGCGCCCCTCCCCCTCCGCAAGG - Intronic
1167552190 19:50169009-50169031 CGGGCCCCGCCTCTGCCTTGGGG - Intergenic
1167609973 19:50502269-50502291 GGCGTCCCTCCTCCGCTGTGGGG + Intergenic
1168292994 19:55366100-55366122 CGCCCCCCTCCTCAGCCTGGGGG - Exonic
1168719002 19:58544716-58544738 CGCGCCCCTCCTCCCCCCCTGGG + Exonic
925836419 2:7951198-7951220 CGGGCCCAGCCCCCGCCGTGTGG + Intergenic
926090000 2:10043536-10043558 CCCGCCCCTCCCGCGCCGCGAGG + Exonic
930177568 2:48315429-48315451 CTCGCCCCTCCACCGCCTCGAGG + Intronic
931671615 2:64653498-64653520 CCGGCCCCTCCTCCGCCCTCCGG + Intronic
933858490 2:86441619-86441641 CTCGCCCACCCTCCCCCGTGGGG + Intronic
938103119 2:128511895-128511917 CAGGCCCCACCTCCACCGTGGGG + Intergenic
942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG + Intergenic
944371072 2:198984752-198984774 CAGGCCCCTCCTGCGACGTGTGG + Intergenic
944620341 2:201507984-201508006 CAAGCCCCTCCCCCGACGTGGGG + Intronic
945673708 2:212831892-212831914 CGCGCCTCCCCTCCGCCAGGTGG + Intergenic
947651078 2:231786638-231786660 CCCGCCCCGCCCCCGCCTTGGGG + Intronic
948662265 2:239514948-239514970 CGCCCCCCTCCCCCGCCCCGTGG + Intergenic
948874495 2:240819684-240819706 CCCTCCCCTCCCCCGCCGTCTGG + Intronic
1173865239 20:46308668-46308690 CGCGCCCCTCCTACACCAGGAGG + Intergenic
1175267274 20:57710194-57710216 AGCGCCCCTCCTCCGTTGCGCGG - Intronic
1177312103 21:19411635-19411657 CGGGCCCCTCCTCCAACATGTGG - Intergenic
1180747088 22:18097128-18097150 CAGGTCCCTCCTCCGACGTGGGG + Exonic
1182335557 22:29581124-29581146 CGCGCCCCGCCTCCGCCACCAGG - Exonic
1183664025 22:39237110-39237132 CTCGCTCCCCCTCCGCCGTCAGG - Intronic
1183744768 22:39686045-39686067 CGCGGCCCTCCTCGTCCGAGGGG - Exonic
1184285916 22:43471449-43471471 CGTCCCCCTCCACAGCCGTGGGG + Intronic
1184937802 22:47737793-47737815 CACGTTCCTCCTCCTCCGTGTGG + Intergenic
950110718 3:10417058-10417080 CGCCCCCCCCCGCCGCCGTCTGG - Intronic
951613978 3:24521894-24521916 CCCGCCCTTCCTCCGCCGCCGGG - Intergenic
953657040 3:44862169-44862191 AGCGCCCCTCCTCCGCCCAGCGG - Intronic
953912179 3:46898788-46898810 CGCGCAGCTCCTCCTCGGTGAGG - Exonic
954110316 3:48429634-48429656 CGCCCCCGCCCTCCCCCGTGCGG - Intronic
958026899 3:88059316-88059338 CGCTCTCTTCCTCCGCCATGAGG - Exonic
968008877 3:195260271-195260293 CTGGCCCCTCCTCCGCGGCGCGG - Intronic
970394724 4:15654934-15654956 AGCGCCCCTCCTCAGCCGCCAGG + Intronic
979545251 4:121932912-121932934 AGCGCTCCTCCTCGGCGGTGAGG + Exonic
981073566 4:140569171-140569193 TGCGCCCTCCCTCCGACGTGCGG - Intergenic
982068262 4:151673247-151673269 CGCGGCCCCCCCCCGCCATGTGG - Intronic
984932572 4:184860068-184860090 CACGCCCCACCTCCTCTGTGCGG - Intergenic
989638047 5:43556955-43556977 CGCCGCCCTCCTCCTCCATGAGG - Exonic
991690122 5:69217697-69217719 CTGGGCTCTCCTCCGCCGTGGGG - Intergenic
992648801 5:78837045-78837067 CGGGCCCCTCCTCCAGCATGGGG + Intronic
994083322 5:95731544-95731566 CGCGCGCCTCCACCGCGGCGGGG - Exonic
995388303 5:111612238-111612260 CCCGCCCCTCCTCCACCCCGTGG - Intergenic
1002043308 5:176529380-176529402 CGCGCCCCTCCACAGGTGTGTGG - Exonic
1006932771 6:37697655-37697677 CGCGCTCCTCTCCCGCCGTCTGG + Exonic
1009320773 6:62286035-62286057 CGCGCTGCTCCTCCTCCGCGCGG + Exonic
1012147538 6:95704221-95704243 CACGCCCCTCCTCTGACATGCGG + Intergenic
1013812381 6:114059526-114059548 CAAGCCCCTCCTCCGACATGTGG - Intronic
1019306007 7:336055-336077 CGGGCCCCTCCACCACCATGGGG + Intergenic
1019483091 7:1275220-1275242 CGCCCGCCTCCCCCACCGTGGGG + Intergenic
1023848578 7:44138191-44138213 TGAGCCCCTCATGCGCCGTGAGG - Intergenic
1026765021 7:73154974-73154996 CGCGCCGCTGCTCCGCCGCTCGG + Intergenic
1027041493 7:74964729-74964751 CGCGCCGCTGCTCCGCCGCTCGG + Intergenic
1027082149 7:75237640-75237662 CGCGCCGCTGCTCCGCCGCTCGG - Intergenic
1034219302 7:149431750-149431772 CGCGCCCCGCCGCCGCCGCCCGG - Exonic
1038319352 8:26513692-26513714 CCCGGCCCACCTCCGCCATGCGG + Intronic
1040076976 8:43246689-43246711 CGCCCCGCTCCTCCGCCGCAGGG - Intergenic
1040610552 8:48977945-48977967 CGAGCCCCTCCCCGGCCGCGCGG - Intergenic
1042926969 8:73976458-73976480 CGCGCGCCTTCTCCGGCGTCCGG + Exonic
1049755163 8:144308198-144308220 GGCCCCCCTTCCCCGCCGTGTGG + Intronic
1050151420 9:2622283-2622305 CGCGCCCCTCCGCCGGCGGGCGG + Intronic
1054716307 9:68560462-68560484 CGCCCCCCTCCCCCGCCGCAAGG - Intergenic
1062620326 9:137417639-137417661 CGCGCGCCTCCTCCTCCGCTCGG - Intronic
1195668260 X:107449592-107449614 CCCTCCCCTCCTCGGCCGTCCGG + Intergenic