ID: 905581186

View in Genome Browser
Species Human (GRCh38)
Location 1:39083443-39083465
Sequence ACTTGAAGTAAGACAGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 0, 2: 7, 3: 44, 4: 431}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905581186_905581190 16 Left 905581186 1:39083443-39083465 CCCAGGTCTGTCTTACTTCAAGT 0: 1
1: 0
2: 7
3: 44
4: 431
Right 905581190 1:39083482-39083504 TATATCTGCTGGAGACAGAGTGG 0: 1
1: 0
2: 2
3: 11
4: 212
905581186_905581189 5 Left 905581186 1:39083443-39083465 CCCAGGTCTGTCTTACTTCAAGT 0: 1
1: 0
2: 7
3: 44
4: 431
Right 905581189 1:39083471-39083493 ACATTTTCTAATATATCTGCTGG 0: 1
1: 0
2: 9
3: 105
4: 796
905581186_905581191 17 Left 905581186 1:39083443-39083465 CCCAGGTCTGTCTTACTTCAAGT 0: 1
1: 0
2: 7
3: 44
4: 431
Right 905581191 1:39083483-39083505 ATATCTGCTGGAGACAGAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905581186 Original CRISPR ACTTGAAGTAAGACAGACCT GGG (reversed) Intronic
902225995 1:14996769-14996791 ACTTGCAGGAAGACACACCACGG + Intronic
902748549 1:18490183-18490205 ATTTGGAGTCAGGCAGACCTGGG - Intergenic
902983538 1:20141949-20141971 ATCTGGAGTCAGACAGACCTAGG - Intronic
903060602 1:20666129-20666151 TTTTGAAGTCAGACAGGCCTGGG - Intronic
903305436 1:22409612-22409634 TCTGGAAGTCAGACAGACCTGGG + Intergenic
903372153 1:22843300-22843322 ACTTAGAATTAGACAGACCTGGG - Intronic
903377240 1:22874539-22874561 CCTTACAGTCAGACAGACCTGGG + Intronic
903993636 1:27290851-27290873 CAGTGAAGTCAGACAGACCTGGG + Intronic
904455613 1:30646409-30646431 CCTTGGAGTCAGACAGACCCAGG - Intergenic
904703846 1:32375857-32375879 GCTTGGAGTCAGACAGCCCTGGG + Intronic
905269071 1:36774868-36774890 CTTTGGAGTCAGACAGACCTGGG + Intergenic
905407881 1:37748856-37748878 CTTTGAGGTCAGACAGACCTGGG + Intronic
905538694 1:38743408-38743430 ATTTGAAGTCAGACAGCTCTGGG - Intergenic
905581186 1:39083443-39083465 ACTTGAAGTAAGACAGACCTGGG - Intronic
905835142 1:41112828-41112850 CTTTGAAGTAAGATAGACATGGG - Intronic
906258775 1:44370292-44370314 CCTTGGAGTCAGACAGTCCTGGG + Intergenic
906281656 1:44558710-44558732 CTTTGGAGTAAGACACACCTAGG - Intronic
906703575 1:47877611-47877633 ACTTGAAGAAAAACACACTTTGG + Intronic
906842447 1:49154018-49154040 CTTTGAAGTTAAACAGACCTGGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907868215 1:58419210-58419232 ACTTGGAGTAAGATACATCTAGG + Intronic
908048212 1:60195860-60195882 ACTTTGAGTTAGACATACCTGGG + Intergenic
908049563 1:60213579-60213601 CCTTGGAGTCAGGCAGACCTAGG + Intergenic
908224953 1:62046535-62046557 ATTTGAAGTAAAACAGACCTAGG + Intronic
908350038 1:63277604-63277626 TTTTGAAGGCAGACAGACCTGGG + Intergenic
908564676 1:65342172-65342194 CTTTGGAGTGAGACAGACCTAGG + Intronic
908654065 1:66369295-66369317 TCTTGAATGAAGACAGAGCTAGG - Intronic
909846579 1:80401270-80401292 CCCTGAAGTCAGAAAGACCTGGG + Intergenic
909896130 1:81071545-81071567 CTTTGAAGAGAGACAGACCTAGG + Intergenic
910086506 1:83409680-83409702 CTTTGAAGTAAGACAGCCTTGGG - Intergenic
910523065 1:88145512-88145534 ACTTGAAGGAAAACAGGTCTGGG - Intergenic
912156559 1:106928203-106928225 ACTTTAAATAAGACAGATATCGG - Intergenic
912563440 1:110566664-110566686 GCTTGGAGTCACACAGACCTGGG + Intergenic
912569758 1:110612884-110612906 ACTTGAAGTCAGACAGGCCTGGG + Intronic
915039183 1:152953584-152953606 TCTTGGAGTGTGACAGACCTGGG + Intergenic
915926175 1:160021370-160021392 TTTTGGAGTCAGACAGACCTAGG + Intergenic
915978452 1:160405747-160405769 ACTTACAGTAAAGCAGACCTGGG - Intronic
916003203 1:160636008-160636030 TTTTGAAGTCAGACAGACCTAGG - Intronic
916175498 1:162034751-162034773 ACTTGCAATCACACAGACCTGGG - Intergenic
916355986 1:163908877-163908899 ACTAGAACCAAGACAAACCTGGG - Intergenic
916608690 1:166368332-166368354 ACTTGGTGTAAGACAGACCTGGG + Intergenic
917027045 1:170655910-170655932 ACTTGAAATAAGGCAGATCCGGG + Intergenic
917655466 1:177121404-177121426 CCTTGACATCAGACAGACCTGGG + Intronic
917775388 1:178328774-178328796 ATTTAAAGTCATACAGACCTGGG - Intronic
918016883 1:180643697-180643719 ATCTGAAGTAAGGCAGACCTAGG - Intronic
918249515 1:182689363-182689385 ACTGGAAGTAAGATATACCAGGG - Intergenic
918322181 1:183374854-183374876 CCTTGTAGTCAGACTGACCTTGG + Intronic
918444106 1:184599008-184599030 CTTTGGAGTCAGACAGACCTGGG - Intronic
918531750 1:185530452-185530474 ACTTGACCTAAGACTTACCTGGG + Intergenic
918646062 1:186906045-186906067 ACTTCAAGTAGAACAGAACTAGG - Intronic
919396660 1:197058279-197058301 ACTTTAATTTAGACAGACGTGGG - Intronic
919493826 1:198238739-198238761 GCTTGGAGTCAAACAGACCTGGG - Intronic
919510130 1:198452337-198452359 CTTTGAAGTCAGACAAACCTGGG - Intergenic
920203261 1:204273730-204273752 ACTTGAAATCAGATCGACCTTGG - Exonic
921651088 1:217679255-217679277 CTTTGGAGTAAGACAAACCTGGG + Intronic
922073864 1:222222765-222222787 ACTTGAAGTCAAAGTGACCTTGG - Intergenic
922351325 1:224736774-224736796 ACTTGGAGTCAGAAAGACTTAGG - Intronic
922657395 1:227397758-227397780 ACTTATTGTAAGACAGGCCTTGG - Intergenic
923203520 1:231735555-231735577 TTTTGGAGTCAGACAGACCTTGG + Intronic
923394581 1:233548744-233548766 ATCTGAAGTCAGACAAACCTAGG - Intergenic
923504022 1:234590212-234590234 ACCTTAAGCAAGTCAGACCTAGG + Intergenic
924445438 1:244125747-244125769 ACTTGGAGTCAGCGAGACCTAGG - Intergenic
1063025647 10:2176467-2176489 ACTTGAAGTAACACAATCTTAGG + Intergenic
1063815693 10:9768686-9768708 ATTTGAAGTCAGCCAGGCCTGGG + Intergenic
1063873173 10:10442260-10442282 AAGTGAAGTAAGCCAGACATAGG + Intergenic
1064910809 10:20399867-20399889 CTTTGAAGTCACACAGACCTGGG - Intergenic
1065012829 10:21434649-21434671 ATTAGAAGTCAGACAGACCAGGG + Intergenic
1065113358 10:22461265-22461287 ATCTGAAGTCAGACAGACTTGGG - Intergenic
1065404745 10:25351288-25351310 TCTCCAAGTAAGACAGACTTAGG + Intronic
1065491684 10:26288677-26288699 ACTTGAAGTAAGAGAGAACTTGG - Intronic
1065634046 10:27712427-27712449 AGTTGAAGCAGGAGAGACCTGGG + Intronic
1066729830 10:38427383-38427405 AATTAAAGTAAGACAGGCATAGG + Intergenic
1067064693 10:43097173-43097195 ACTAGAGGTAGGACAGGCCTGGG - Intronic
1067434022 10:46264793-46264815 CCTTGAAGTGAGGCAGGCCTGGG - Intergenic
1068016206 10:51519107-51519129 ACTTGAAGAAACACTGAGCTGGG + Intronic
1069634248 10:69915812-69915834 AATGGAAGAAAGACAGACCGTGG + Intronic
1069795287 10:71047976-71047998 ACCTAAAGTAAGACAGACAAAGG + Intergenic
1069846031 10:71372365-71372387 TCTTGGAGTCAGGCAGACCTGGG - Intergenic
1070647081 10:78209366-78209388 ACTTGAAATAACACAGACAGAGG - Intergenic
1070652569 10:78248422-78248444 ACTTGGACTCAGGCAGACCTCGG - Intergenic
1071136359 10:82458651-82458673 CCTTGGAGTAAGATAGACCTGGG + Intronic
1071951942 10:90713202-90713224 GCATGAGGTCAGACAGACCTGGG - Intergenic
1072114179 10:92353314-92353336 ACTTAAAGTTGGATAGACCTGGG + Exonic
1072467253 10:95676960-95676982 GCTTTGAGTCAGACAGACCTAGG - Intronic
1072484301 10:95840227-95840249 ACTTGAAGTCGGGCAGAACTTGG - Intronic
1072953242 10:99867080-99867102 ATTGGAAGTAAAACAGTCCTTGG - Intergenic
1073221614 10:101879216-101879238 CTTTGTAGTCAGACAGACCTAGG + Intronic
1073720034 10:106157957-106157979 AATTTCAGTAAGCCAGACCTGGG - Intergenic
1073999732 10:109358654-109358676 ACTTGAAGTGAGACTAAACTGGG - Intergenic
1074141340 10:110675709-110675731 CTTTCAAGTCAGACAGACCTGGG + Intronic
1074293723 10:112162195-112162217 ACTTGAAGTCAGAAAAATCTGGG + Intronic
1074452474 10:113570144-113570166 ACTTGGAGTTAGGTAGACCTGGG + Intronic
1075829327 10:125392055-125392077 CTTTGAAGTCAGACAGACTTGGG - Intergenic
1076130895 10:128013196-128013218 ACTTGAAGTAATACAGTTCCAGG - Intronic
1076274642 10:129186778-129186800 ACTTGAAGAAAGAAAGAAGTGGG + Intergenic
1078665364 11:13320433-13320455 ACTTGGAGCCAGACAGACCTGGG + Intronic
1078757071 11:14221423-14221445 CCTTGAATTAAGACAGGCCTAGG - Intronic
1079144649 11:17839915-17839937 CCTTGAAGTCAGAAGGACCTAGG - Intronic
1079541723 11:21584251-21584273 TCTTGGAGCCAGACAGACCTGGG + Intergenic
1079680392 11:23289568-23289590 GCTTGAAGTCAGAGAGTCCTAGG - Intergenic
1079983520 11:27176845-27176867 TCCTGATGTTAGACAGACCTGGG + Intergenic
1080110714 11:28564324-28564346 CCTTGTGATAAGACAGACCTGGG - Intergenic
1080393128 11:31866201-31866223 ACCTGGAGTCAGAAAGACCTCGG - Intronic
1081217326 11:40417567-40417589 ACTTGAAGTCAGGCAGAGGTGGG - Intronic
1081437967 11:43048808-43048830 TTTTGGAGTCAGACAGACCTAGG - Intergenic
1081737337 11:45413129-45413151 CCTTGGAGTCACACAGACCTGGG + Intergenic
1082660166 11:55899849-55899871 ACTTGAAGTGAGACTGACATGGG - Intergenic
1083816195 11:65133824-65133846 ATTTGAAGCAAGACTGACCCAGG - Intronic
1084028849 11:66468930-66468952 ACCTAGAGTAAGAAAGACCTGGG - Intronic
1084112382 11:67022634-67022656 GTTTGAAGTCACACAGACCTGGG + Intronic
1085407483 11:76272059-76272081 TCTTGATGTCAGACAGTCCTGGG - Intergenic
1085431000 11:76447968-76447990 TCTTGAATTTAGACAGACCTGGG + Intronic
1086282444 11:85206366-85206388 ATTTGAAGCCAGATAGACCTGGG + Intronic
1086408595 11:86520990-86521012 ACTCGGAGCTAGACAGACCTGGG + Intronic
1087049570 11:93871816-93871838 CTTTGAAGTCAGACAGACCCAGG - Intergenic
1087136789 11:94729194-94729216 CTTTGAAGTCAGACAGACCTGGG + Intronic
1087426249 11:97990662-97990684 ACCAGAAGTAACACAGCCCTGGG - Intergenic
1087992675 11:104765230-104765252 CTTTGAAGTAATAGAGACCTAGG - Intergenic
1090615264 11:128508441-128508463 TTTTGAGGTAAGACAGCCCTGGG - Intronic
1090733789 11:129593744-129593766 CTTTAAAGTTAGACAGACCTGGG + Intergenic
1090791762 11:130096198-130096220 CCTTGAGGTGAGACAGACCCTGG + Intronic
1091785478 12:3240659-3240681 ATTTGAAGCCAGACAGCCCTGGG - Intronic
1094135522 12:27121217-27121239 AGTGGAAGTCAGACAGACCCAGG + Intergenic
1094185014 12:27632613-27632635 AGTGGAAGTTAGACAGACCTAGG + Intronic
1095529203 12:43165121-43165143 CTTTGAAATAAGAAAGACCTGGG - Intergenic
1096473716 12:51895513-51895535 CTTTGGAGTCAGACAGACCTGGG + Intergenic
1096807033 12:54147125-54147147 GATTGAAGTGAGACAGACTTGGG - Intergenic
1096834937 12:54344117-54344139 ACTTTAAGTCAGACAGATATGGG - Intronic
1097064391 12:56310081-56310103 ACATAAAGTAAGACAGGGCTTGG - Intronic
1097894605 12:64811957-64811979 CTTTCAAGTGAGACAGACCTGGG + Intronic
1098290999 12:68956534-68956556 TTTTGGAGTCAGACAGACCTAGG - Intronic
1099427020 12:82535910-82535932 CTTTGAAGTTAGACAGACCAGGG + Intergenic
1100242629 12:92725146-92725168 ACTAGGAGTTAGACAGACTTGGG + Intronic
1100568541 12:95823193-95823215 CTCTGAAGTCAGACAGACCTGGG + Exonic
1100647020 12:96542285-96542307 AGCTGAAGTAGGACAGAGCTTGG - Intronic
1100910194 12:99351499-99351521 TTTTAAAATAAGACAGACCTGGG + Intronic
1100943699 12:99754590-99754612 ATTTAAAGTAAAACACACCTTGG + Intronic
1101049449 12:100845962-100845984 CTTTGGAGTAACACAGACCTGGG + Intronic
1101559168 12:105839362-105839384 TTTTGGAGTCAGACAGACCTGGG + Intergenic
1101744746 12:107531013-107531035 CCTTAGAGTCAGACAGACCTAGG + Intronic
1101813060 12:108124141-108124163 AAATGAAGGAAGCCAGACCTGGG - Intergenic
1101825481 12:108217196-108217218 GCTTTAAGTCAGACAGACCTGGG - Intronic
1101984580 12:109435810-109435832 CCTTGAAGCCAGACAGACCCAGG - Intronic
1102631996 12:114288999-114289021 TTTTGAAATCAGACAGACCTGGG - Intergenic
1102934789 12:116887358-116887380 ACTTGGAGCCAGAGAGACCTGGG + Intergenic
1103727357 12:123004752-123004774 ACGTGGGGTAAGACAGGCCTGGG + Intronic
1103750289 12:123153948-123153970 ACTTGGAGCCAGAGAGACCTGGG - Intronic
1105669921 13:22601793-22601815 ACTTGGAGTTGGAGAGACCTGGG - Intergenic
1106303685 13:28492626-28492648 ACCTGAAGGAAGGCAGACCCAGG + Intronic
1106407569 13:29487298-29487320 CTTTGGAGTCAGACAGACCTGGG + Intronic
1107278171 13:38701415-38701437 ACTTATAATAATACAGACCTGGG + Intronic
1107638632 13:42418538-42418560 CTCTGAAGTCAGACAGACCTGGG + Intergenic
1108665074 13:52621473-52621495 ACTTGCAGTCAGTCAGATCTGGG + Intergenic
1109220285 13:59634523-59634545 GTTTGGAGTCAGACAGACCTGGG + Intergenic
1109662206 13:65476293-65476315 ACTTCAAGGAATAAAGACCTAGG - Intergenic
1110646972 13:77898286-77898308 ATTTGAAGAAAAACAGTCCTTGG - Exonic
1111359794 13:87161234-87161256 AATTGAAATAAGTGAGACCTGGG + Intergenic
1111482827 13:88854291-88854313 TCTTGAACTAAGACAGAAATTGG + Intergenic
1112852908 13:103728723-103728745 ACTTAAAATAAAACATACCTGGG - Intergenic
1114538901 14:23440441-23440463 CCTTTGAGCAAGACAGACCTGGG - Intergenic
1115173357 14:30533466-30533488 ACCTCAAGAAAGACACACCTAGG + Intergenic
1115449419 14:33528988-33529010 ATTTGAAGTCAGACAGCTCTGGG - Intronic
1115528433 14:34304030-34304052 CTTTGGAGTAAGACAGAGCTGGG - Intronic
1115786659 14:36834350-36834372 CTTTGGAGTCAGACAGACCTGGG + Intronic
1117479720 14:56130366-56130388 ACTTGGAGTCAGAAAGACCTAGG - Intronic
1117656210 14:57959423-57959445 ACTTGAAGTAACACAGCCTGAGG + Intronic
1118296075 14:64570970-64570992 CCTTGGAGTTAAACAGACCTGGG - Intronic
1118798906 14:69171316-69171338 AATTGAAGTCAGAGAGGCCTGGG + Intergenic
1118894438 14:69934133-69934155 ACTTTCAGTGAGACACACCTGGG - Intronic
1120591669 14:86381552-86381574 CCCAGGAGTAAGACAGACCTGGG - Intergenic
1120806696 14:88759241-88759263 CTTTGAAGTTAGACAGACATGGG + Intronic
1120877376 14:89387530-89387552 AGTTGGAGTCAGAGAGACCTAGG - Intronic
1120916877 14:89718245-89718267 ACTTGGAGTCACACAGCCCTGGG - Intergenic
1121903724 14:97720241-97720263 AAATGAAATAAGACAGACATTGG - Intergenic
1122019195 14:98822153-98822175 ACTGGGAGGAAGACAGAGCTGGG + Intergenic
1125612475 15:40980965-40980987 CCTTGAAGTGACACAGGCCTTGG - Intronic
1126670836 15:51113722-51113744 ACTTGCAGAAAGCCAGTCCTGGG - Intergenic
1126794989 15:52253407-52253429 ACATGAAGGAAGATATACCTTGG - Exonic
1126969717 15:54096776-54096798 GCTTGAAGTAAGAGAGATCTAGG + Intronic
1127076012 15:55326327-55326349 AATTAAAGTCAGGCAGACCTGGG + Intronic
1127474360 15:59318874-59318896 ACAGGAAGTCAGATAGACCTGGG - Intronic
1128376055 15:67076816-67076838 CCCTCAAGTAAAACAGACCTGGG - Intronic
1128452616 15:67814718-67814740 GCTTGGAGTTACACAGACCTGGG + Intergenic
1128631902 15:69276662-69276684 ATTTGGAGTCAGACATACCTGGG - Intergenic
1129618963 15:77125674-77125696 CTTTTAAGTCAGACAGACCTGGG - Intronic
1130024248 15:80257586-80257608 ACTTGGAGTCAGACAGGTCTGGG + Intergenic
1130687578 15:86052589-86052611 ACTTGGAGTTGGACAGACCTAGG - Intergenic
1130895208 15:88164688-88164710 ACTGGAAGTAAGACAGAGATGGG - Intronic
1131334531 15:91535237-91535259 ACTTGGAGGAAAACAGAACTAGG - Intergenic
1133252991 16:4496761-4496783 ACTATAAGTCTGACAGACCTGGG - Intronic
1135664355 16:24323567-24323589 ACATGAAGTCAAACCGACCTGGG - Intronic
1135933585 16:26760335-26760357 AGGTGAAGTGAGAGAGACCTTGG - Intergenic
1136093540 16:27937619-27937641 TCTCCAAGTAAGACAGACCAGGG + Intronic
1136304169 16:29358281-29358303 ACATGAAGTCAGAGAGAGCTTGG + Intergenic
1137777703 16:51070329-51070351 AGTGGAAGTAAGAGAGAACTTGG + Intergenic
1137957078 16:52842526-52842548 ACTTGACGTTTGACAGCCCTGGG - Intergenic
1138605693 16:58086746-58086768 CCCTGAAGTGAGGCAGACCTGGG + Intergenic
1139589988 16:67928215-67928237 CCATGAAGGAAGACAGATCTTGG - Exonic
1141222641 16:82085493-82085515 ACTTGGAGTAAAACAGATCCCGG - Intronic
1143305375 17:5942220-5942242 ACTGGAAATAGGAAAGACCTTGG - Intronic
1144357651 17:14461379-14461401 GTTTGAAGGAAGACAGAGCTTGG + Intergenic
1146372178 17:32271962-32271984 ATTTGGAGTCAGATAGACCTGGG + Intronic
1146653564 17:34621994-34622016 CCTTGAAGGAAGACAGATGTGGG - Intronic
1146978593 17:37138361-37138383 TCTAGAAGGAAGACAGAGCTGGG - Intronic
1147647301 17:42041285-42041307 CCTTGAGGTTAGACAGACTTAGG + Intronic
1147925633 17:43943765-43943787 GCTTAGAGTCAGACAGACCTGGG + Intergenic
1148978727 17:51552227-51552249 AGTTGGAGTCAGACAGACATGGG + Intergenic
1149027837 17:52050650-52050672 CCTTGAAGTGAGAAAGAGCTTGG - Intronic
1149927134 17:60712548-60712570 ATTTGAATTCAGACAGAACTAGG - Intronic
1151989444 17:77564803-77564825 CCCTGGAGAAAGACAGACCTGGG - Intergenic
1153017299 18:595830-595852 CCTCCTAGTAAGACAGACCTGGG + Intergenic
1155142116 18:23053235-23053257 CCTTCATGGAAGACAGACCTGGG - Intergenic
1156671261 18:39472896-39472918 CTTTGAAGTTAGACACACCTAGG - Intergenic
1161808151 19:6457029-6457051 AATTGAAGCCAGACAGATCTGGG - Intronic
1165045125 19:33098539-33098561 ATTTGGAGTCAGTCAGACCTGGG + Intronic
1165225745 19:34353265-34353287 ACTTGAAGAAACACAGCTCTTGG + Exonic
1165721899 19:38085033-38085055 ACTTGGAGTCAGACAGCCCTCGG + Intronic
1167932688 19:52879846-52879868 ACTTAAAGTAAGAAATACTTAGG + Exonic
1167935672 19:52904979-52905001 ACTTAAAGTAAGAAATACTTAGG + Intergenic
1168006475 19:53493529-53493551 ACTTAAAGTAAGAAATACTTAGG - Exonic
925025986 2:607596-607618 GCTTGAGGAAACACAGACCTTGG - Intergenic
926209062 2:10855607-10855629 ATTTGAAGCCAGACAGACCCAGG + Intergenic
926495130 2:13576805-13576827 CCCTGTAGTAAGACAGAGCTAGG - Intergenic
926780232 2:16463903-16463925 ACTTTGAGTCAGACAGACCTAGG + Intergenic
927292519 2:21419250-21419272 ACTTGGGGTCAGGCAGACCTGGG - Intergenic
927780630 2:25936914-25936936 TTTTGGAGTAAGGCAGACCTGGG + Intronic
928657437 2:33466886-33466908 GTTTGAAGTCAGACAGACCTGGG + Intronic
928812353 2:35244450-35244472 ATTTGAAGTCAGACATAACTGGG + Intergenic
928994641 2:37274502-37274524 ACTTGATGTAGCACAGAGCTGGG - Exonic
929584852 2:43107154-43107176 CCTTGAAGTCAGACAGCCCCAGG + Intergenic
930143939 2:47981927-47981949 ATTTGAAGTAGGCCTGACCTAGG - Intergenic
930388100 2:50723379-50723401 TTTTGAAGAAAAACAGACCTGGG - Intronic
930736752 2:54787400-54787422 AATTGTAGTCATACAGACCTAGG + Intronic
931194770 2:60041065-60041087 ACTTTAGATCAGACAGACCTGGG - Intergenic
931508069 2:62954164-62954186 ATGTGGAGTCAGACAGACCTGGG - Intronic
933028053 2:77287491-77287513 ACCTGAGGTAACACAAACCTTGG - Intronic
934580232 2:95431942-95431964 ACTCAAAGTCAGAGAGACCTGGG - Intergenic
934599214 2:95644772-95644794 ACTCAAAGTCAGAGAGACCTGGG + Intergenic
935197157 2:100823933-100823955 TTTTGAAGTCAGACAGACCTGGG + Intronic
936396838 2:112138126-112138148 CTTTGAAGTAGGACAGACCTGGG + Intergenic
936532566 2:113286770-113286792 ACTCAAAGTCAGAGAGACCTGGG + Intergenic
936852124 2:116912911-116912933 ACTGGAAGAAAGGCAGATCTAGG + Intergenic
937844772 2:126567241-126567263 TTCTGAAGTGAGACAGACCTAGG - Intergenic
939789533 2:146554763-146554785 CCATAAAGTAAGACACACCTGGG - Intergenic
939887403 2:147696066-147696088 TTTGGAAGTCAGACAGACCTAGG - Intergenic
940311411 2:152282811-152282833 ACTTGACCTAAGTCAGACATGGG - Intergenic
942793867 2:179793212-179793234 ATTTGGAGTTAGACAGATCTGGG - Intronic
943107436 2:183563228-183563250 AGTGGAAATTAGACAGACCTAGG + Intergenic
943335377 2:186607043-186607065 CCTTGTAGTTAGACAGACATGGG + Intronic
943382347 2:187167103-187167125 CTTTGAAGTCAGACAGACCTTGG - Intergenic
943733243 2:191325639-191325661 ACTTGAGGTGAAACAAACCTAGG + Intronic
943837099 2:192527219-192527241 ACTGGAAGTAAAACACTCCTCGG + Intergenic
944992641 2:205255204-205255226 ACTTGAAGTTAAACAATCCTGGG - Intronic
947499456 2:230661428-230661450 AAGAGAAGTAAGACAGCCCTAGG - Intergenic
947863066 2:233376323-233376345 AGTTGAAATCAGACAGATCTGGG + Intronic
1168788782 20:562179-562201 CCTTGAAGTCAGGCAGACATGGG - Intergenic
1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG + Intergenic
1169582582 20:7040945-7040967 ACTTAAAATATGAAAGACCTTGG + Intergenic
1170243141 20:14192485-14192507 ACTTTAAGTAAGATAGATGTGGG + Intronic
1170536439 20:17345704-17345726 ATTTCAAGTAAGAAAGAACTGGG - Intronic
1172043435 20:32062295-32062317 ATTTGAAGTCAGATAGAGCTGGG - Intronic
1172632826 20:36390659-36390681 TCTTGCAGTAACACAGACCCAGG - Intronic
1173552775 20:43944897-43944919 CTTTGAAATAAGACAGAGCTGGG - Intronic
1174191628 20:48744659-48744681 ACTTGGCATCAGACAGACCTGGG - Intronic
1174804047 20:53592093-53592115 ACCTGAACTAAATCAGACCTAGG + Intronic
1174940138 20:54918028-54918050 ACTTGAAGTAAGACATCCCTGGG + Intergenic
1177609322 21:23424457-23424479 ACCTGAAGTAAGACCAGCCTGGG + Intergenic
1177636390 21:23792504-23792526 ATTTGAAGTCTGATAGACCTGGG + Intergenic
1178576183 21:33793793-33793815 ACTTGAAGAAAAATAGACCCTGG + Intronic
1180559981 22:16608531-16608553 ACCTGAACTAAATCAGACCTAGG + Intergenic
1182031214 22:27160880-27160902 CTTTGGAGTCAGACAGACCTGGG - Intergenic
1182340654 22:29617850-29617872 CTTTGAAAGAAGACAGACCTGGG + Intronic
1182508096 22:30799987-30800009 CCTACCAGTAAGACAGACCTGGG + Intronic
1182793248 22:32970916-32970938 CCTTGGAGTTAGCCAGACCTGGG + Intronic
1183033049 22:35119819-35119841 TCTTGGAGTCAGACAGCCCTGGG + Intergenic
1183950236 22:41348650-41348672 GCCTGCAGTCAGACAGACCTGGG + Intronic
1184013123 22:41764416-41764438 TTTTCAAGTAAGACACACCTGGG - Intronic
1184190121 22:42888852-42888874 ACTAGAAGTCACACAGACCATGG + Intronic
1184252853 22:43270736-43270758 TCTTCAAGTCAGACAGACCCAGG - Intronic
949211433 3:1507626-1507648 CTTTGAAGTCAGACAGCCCTAGG + Intergenic
950638388 3:14332396-14332418 CTTAGGAGTAAGACAGACCTGGG - Intergenic
950743617 3:15069165-15069187 TTTTGCAGTCAGACAGACCTAGG + Intergenic
951225902 3:20120780-20120802 ACTTGACGTCAGACAAATCTTGG + Intronic
951337077 3:21436305-21436327 TGTTGAAGTCAGACAGATCTGGG + Intronic
951529747 3:23687195-23687217 CTTTGGAGCAAGACAGACCTGGG - Intergenic
952499334 3:33945314-33945336 CTTTGAAGTCAGACAGACCTGGG - Intergenic
952574094 3:34753769-34753791 ACCAGAAGGAAGACAGACCCTGG + Intergenic
952660795 3:35844393-35844415 ACATGAATTCAGACAGACTTAGG - Intergenic
952746738 3:36788571-36788593 ATTTGGAGTCAGACAGGCCTGGG + Intergenic
959066624 3:101663587-101663609 ACTTGAGTAAAGAAAGACCTTGG + Intronic
959259709 3:104061276-104061298 CCATGAAGTAAGAAAAACCTTGG - Intergenic
959555207 3:107709258-107709280 TTTTGAAGTAAGGAAGACCTAGG + Intronic
959754473 3:109881443-109881465 ACTTCAAGTCAGAAAGACCATGG - Intergenic
960367373 3:116789065-116789087 ACTTGTAGTAAGAGAGCCATAGG - Intronic
961622784 3:128238010-128238032 TTTTGAAGTCAGACAGCCCTTGG + Intronic
961836530 3:129665726-129665748 ATTTGAAGTCAGACAAAACTGGG + Intronic
962345620 3:134617117-134617139 ATTTGAAGCTAGAAAGACCTGGG - Intronic
964019180 3:151986482-151986504 TTCTGAAGTAAGACAGACTTAGG - Intergenic
964313535 3:155419349-155419371 ATTTGCAGTCAGAAAGACCTGGG - Intronic
964734522 3:159903040-159903062 AGTGGGAGTAAGACAGACATGGG + Intergenic
968294941 3:197569129-197569151 ATTTGGAGTAGGACAGACTTGGG - Intronic
969084909 4:4649052-4649074 CTTTGGAGTCAGACAGACCTGGG - Intergenic
969858007 4:10015338-10015360 TCTTGGATTCAGACAGACCTGGG + Intronic
970366710 4:15366471-15366493 ACTGCAAGTAACACAGACTTGGG - Intronic
970410013 4:15796335-15796357 AAATGAAGAAAGCCAGACCTGGG - Intronic
970521480 4:16888899-16888921 ACTTATAGTAAGACAGATTTGGG - Intronic
970556910 4:17243111-17243133 ACTTGGAGTTAGGCAGATCTGGG - Intergenic
971990706 4:33889409-33889431 CCTTGAAGAAAGAAAGACCAGGG - Intergenic
972316988 4:37935869-37935891 TCTAGAAGTAAGACAGAACATGG - Intronic
973080658 4:45988493-45988515 TCTTTAAGAAAGACACACCTTGG - Intergenic
973239649 4:47944027-47944049 TTCTGAAGTCAGACAGACCTAGG + Intronic
974390236 4:61258004-61258026 AGCTAAAGGAAGACAGACCTTGG - Intronic
974646072 4:64694346-64694368 GCTTCAAGTATGACAGACCTGGG - Intergenic
975468041 4:74732396-74732418 GTTTGGAGTCAGACAGACCTGGG - Intergenic
975576285 4:75865860-75865882 CCTTGAGGTAAGACAGACCTTGG + Intronic
975637775 4:76467444-76467466 ACTTAAAGTCAGACAGGACTGGG - Intronic
975954056 4:79814919-79814941 TTTTGAAGTTAGACAGATCTGGG - Intergenic
976161796 4:82209438-82209460 CTTTGAAGTGAAACAGACCTAGG + Intergenic
976320189 4:83705304-83705326 CCCTGAAGTAAGACAGAATTGGG - Intergenic
976400263 4:84598764-84598786 AGTTGAAGTAAAAAAGAGCTGGG - Intronic
976683087 4:87779066-87779088 ACTTGGAGCCAGACATACCTAGG - Intergenic
977206206 4:94167543-94167565 ACTTGTAGCAAGAAAGCCCTTGG - Intergenic
977852264 4:101844593-101844615 GTTTGGAGTCAGACAGACCTGGG + Intronic
977916454 4:102599641-102599663 CTTTGGAGTAAGACAGGCCTGGG + Intronic
979415596 4:120434469-120434491 TGTTGAAGTCAGAGAGACCTGGG + Intergenic
980583464 4:134784579-134784601 ATTGGAAGTAAAACACACCTTGG - Intergenic
981802314 4:148672649-148672671 ACTTGAAAAAAGACTGACATAGG + Intergenic
982256797 4:153458726-153458748 ACTTGAAGTTAGAAAGACTGGGG + Intergenic
982842127 4:160202690-160202712 GTTTGAAATAAAACAGACCTAGG + Intergenic
982848509 4:160280326-160280348 ACTAGAAGTAAAACACTCCTCGG + Intergenic
983265503 4:165503908-165503930 ACTAGAAGTAAGGCAGACGTAGG - Intergenic
983280859 4:165679381-165679403 CTTTGGAGTCAGACAGACCTGGG + Intergenic
984002453 4:174266653-174266675 TTTTGAAGTCAGACAGACCTGGG + Intronic
984896594 4:184546990-184547012 CTTTGAAGTCAGTCAGACCTGGG + Intergenic
985288202 4:188358918-188358940 ACTCGAAATAAGAGAGACCAAGG - Intergenic
987972805 5:24971638-24971660 AGTTGAAGTAAGACAGAAGAAGG - Intergenic
988334362 5:29886844-29886866 AATTGAAGTATTACAGACTTAGG + Intergenic
988406659 5:30832695-30832717 CCCTGAAGTCAGACAGACCTTGG + Intergenic
988834274 5:35015970-35015992 CCTGGGAGTCAGACAGACCTGGG + Intronic
988834280 5:35016010-35016032 TCTGGGAGTCAGACAGACCTGGG + Intronic
988988218 5:36642509-36642531 ACTTGAAATAAGATAAACCTAGG - Intronic
989225501 5:39023003-39023025 ACATGAAGAAAACCAGACCTAGG + Intronic
990205198 5:53421371-53421393 CTTTGAAGTCAGACAAACCTGGG - Intergenic
990580676 5:57164677-57164699 CTTTGGAGTTAGACAGACCTAGG - Intergenic
990789586 5:59462353-59462375 ACTTGAGCCAAGACACACCTGGG - Intronic
991237471 5:64416402-64416424 ACTAGAACCAAGACAAACCTGGG + Intergenic
992407450 5:76473093-76473115 CTTTGAAGTCAGAAAGACCTAGG - Intronic
994154096 5:96482894-96482916 ATTTGAGGTCAGACAGACATGGG + Intergenic
994583722 5:101679679-101679701 TTCTAAAGTAAGACAGACCTGGG + Intergenic
994662214 5:102667643-102667665 TTTTGAAGTAAGACAGACCTCGG - Intergenic
995478105 5:112568329-112568351 GGCTGAAGGAAGACAGACCTAGG + Intergenic
995611281 5:113913086-113913108 TCCTGAGGTAAGACAGAGCTGGG - Intergenic
997447459 5:133951994-133952016 TCTTCTAGGAAGACAGACCTAGG - Intergenic
997897243 5:137730195-137730217 CCTTGGAGTCAGATAGACCTGGG - Intronic
998005882 5:138656798-138656820 ATTTGAATTTAGACAGATCTGGG - Intronic
998194348 5:140054607-140054629 ACAGGAAGGAAGACAGACCATGG + Intergenic
998212662 5:140212172-140212194 ATTTGAAACTAGACAGACCTGGG - Intronic
998369986 5:141654664-141654686 TTTTGGAGTTAGACAGACCTGGG - Intronic
999339909 5:150761541-150761563 ACTGGAAGTTAGTCAGACTTTGG + Intergenic
1000759953 5:165210437-165210459 ACCTGCAGAAAGACAGTCCTAGG - Intergenic
1000808594 5:165831118-165831140 ACTTGAAGTAATAGAGAATTTGG - Intergenic
1001427465 5:171632888-171632910 GCTTGAGGTCAGAGAGACCTTGG + Intergenic
1001465279 5:171959021-171959043 GCTTGAAATCAGAGAGACCTGGG + Intronic
1001489247 5:172144206-172144228 TCTTGGAGTCAGACTGACCTTGG - Intronic
1001524525 5:172419167-172419189 GCTTTCAGTCAGACAGACCTGGG - Intronic
1001892747 5:175352850-175352872 GTTTGAAGTCAGATAGACCTGGG - Intergenic
1003437544 6:6105903-6105925 ACTGGGAGTAACACAGAGCTAGG - Intergenic
1003657792 6:8029768-8029790 ACTAGAACTAAGGCAGACTTGGG + Intronic
1004294052 6:14394364-14394386 ACTTGGAGGAAAACAGAGCTTGG + Intergenic
1004618421 6:17312450-17312472 ACTTGGAGGCAGACTGACCTGGG + Intergenic
1004813541 6:19287321-19287343 ACTGGGAGTAAGAGAGTCCTGGG - Intergenic
1006408558 6:33858839-33858861 ATTTGGAGTCAGACAAACCTGGG + Intergenic
1006678300 6:35779241-35779263 GCCTGGAGTAAGACAGACCTGGG - Intronic
1006727313 6:36209031-36209053 CCTTGGACTAAGTCAGACCTGGG + Intronic
1007319195 6:41014575-41014597 ACTTGGAGTCAGACAGACCCAGG + Intergenic
1007325523 6:41056549-41056571 ATTTGGAGTCAGACAGTCCTGGG - Intronic
1008165855 6:48137388-48137410 AGTTGAAGTAAAGCAGACCTGGG - Intergenic
1008363897 6:50653209-50653231 ACTTGAAGAAAAACAGACAAAGG - Intergenic
1009451218 6:63803192-63803214 TTTTGAAACAAGACAGACCTAGG + Intronic
1009944459 6:70326498-70326520 CTTTGAAGTCAGACAGAACTAGG - Intergenic
1010002325 6:70959583-70959605 TCTTGGAGTCAGGCAGACCTGGG + Intergenic
1010539699 6:77076108-77076130 ACTAGAACTGAGACAAACCTAGG + Intergenic
1010633003 6:78221926-78221948 ATGTGAAGTAAGACAGAGTTGGG - Intergenic
1012417855 6:99029005-99029027 CCTTGGAGTCAGACAGAACTGGG - Intergenic
1012868987 6:104651714-104651736 CTTTGGAGTCAGACAGACCTAGG - Intergenic
1013660144 6:112287332-112287354 ATTTGGAGTCAGACAGACTTAGG + Intergenic
1013671237 6:112405728-112405750 ATTTGGAGTCAGATAGACCTGGG + Intergenic
1015065989 6:129028769-129028791 ACTTAAACTTAGACATACCTAGG - Intronic
1015371600 6:132460367-132460389 AATTGAAGTAACACACATCTAGG + Exonic
1015607159 6:134970073-134970095 CCCTGAAGTCAGACAGACCTGGG + Intronic
1016051064 6:139530623-139530645 CTTTGAAGTCAGACAGACCCAGG + Intergenic
1016132929 6:140499626-140499648 ACTTTAAGTAAAACAGATTTGGG + Intergenic
1016890048 6:148996697-148996719 ACTTGAGGAAAGATAGATCTGGG + Intronic
1018310655 6:162504870-162504892 AATTGAGGAAAGACAGAACTAGG + Intronic
1018337625 6:162811235-162811257 ACTTCTAGTAAGACAGACAAAGG + Intronic
1019850270 7:3548385-3548407 TTTTGGAGTAAGACAGACCCAGG - Intronic
1020143557 7:5625478-5625500 ACTGGAAGGAAGACAATCCTTGG + Intronic
1020670928 7:11110826-11110848 ACTTGAAGAAAGAGAGAAATCGG + Intronic
1020890755 7:13875405-13875427 ACTTGAAGTCAGGTAGACCTGGG - Intergenic
1021152305 7:17166661-17166683 ACTAAAACTAAGGCAGACCTAGG - Intergenic
1021939260 7:25663589-25663611 ATTTGAAGTTACACAGACCTGGG + Intergenic
1021951096 7:25775912-25775934 TCTTGATATCAGACAGACCTTGG - Intergenic
1022259858 7:28693631-28693653 TTTTGGAGTCAGACAGACCTGGG + Intronic
1023045808 7:36209205-36209227 CCTTGAAGTTAAACAGACATGGG - Intronic
1023455211 7:40331394-40331416 CTTTGGAGTCAGACAGACCTTGG + Intronic
1023742703 7:43294719-43294741 TTTTGAAGTCAGACTGACCTGGG - Intronic
1023749222 7:43354052-43354074 ACTAGAAGTGAGGCAAACCTGGG + Intronic
1024242882 7:47448864-47448886 ATCTGAAATCAGACAGACCTGGG + Intronic
1024400389 7:48917917-48917939 ACTGGAAGTCAGACAGATGTGGG + Intergenic
1026435223 7:70390887-70390909 CCTTGAAGTAGGAAAGAGCTTGG - Intronic
1027303388 7:76866167-76866189 CTTTGAAGTAAGACAGCCTTGGG - Intergenic
1028720869 7:94029699-94029721 ACTTGAAGTATCAATGACCTGGG + Intergenic
1030293576 7:107896496-107896518 ATCTGAAGTAAAACAGACCTGGG - Intronic
1031038966 7:116818610-116818632 ACTTGAACTAAGAAGGATCTGGG + Intronic
1031569400 7:123340766-123340788 ACTAGAACCAAGGCAGACCTGGG - Intergenic
1031995712 7:128229347-128229369 CCTTGGAGAAAGACATACCTGGG - Intergenic
1033662713 7:143413500-143413522 ACTGGGAGTCAGACAGAACTAGG - Intergenic
1033741693 7:144281099-144281121 ATTTTAAGTAAGCCAGACCTAGG - Intergenic
1033752208 7:144368515-144368537 ATTTTAAGTAAGCCAGACCTAGG + Intronic
1034074229 7:148216413-148216435 TCTTGAAGTTAGAGAGAACTGGG - Intronic
1034076264 7:148234229-148234251 CTTTGAAGTATGACGGACCTGGG - Intronic
1035284571 7:157797934-157797956 AAATGTAGGAAGACAGACCTGGG - Intronic
1038127099 8:24686557-24686579 ACTTATAGTAACAAAGACCTAGG - Intergenic
1038547793 8:28439291-28439313 CTTTGCAGTCAGACAGACCTGGG - Intronic
1038577726 8:28719211-28719233 ATTTGGAGTGATACAGACCTGGG + Intronic
1039085274 8:33773681-33773703 TTTTGGAGTCAGACAGACCTAGG + Intergenic
1039336491 8:36596420-36596442 AGTGGAAGTAAGACAGCCCAGGG - Intergenic
1039464491 8:37774313-37774335 CTTTGAAATCAGACAGACCTTGG + Intronic
1039914937 8:41852763-41852785 CCTTGAGGTCAGACAGACCTGGG - Intronic
1040903779 8:52443725-52443747 ACTTAAAGTAAGAAATACTTAGG - Intronic
1042004567 8:64166957-64166979 AACTAAAGTGAGACAGACCTGGG + Intergenic
1044121895 8:88407797-88407819 ACTTTAAGAACCACAGACCTAGG - Intergenic
1044226519 8:89725156-89725178 CTTTGAAGTCAGGCAGACCTGGG - Intergenic
1044965095 8:97566833-97566855 ACAGGAAGTGGGACAGACCTTGG + Intergenic
1046098035 8:109583330-109583352 ATTTGGAGTCAGACAGACCTGGG - Intronic
1046423057 8:114009513-114009535 CTTTGGAGTCAGACAGACCTCGG - Intergenic
1047034912 8:120927107-120927129 GCTTGAAGTTAGACAGATCTGGG + Intergenic
1047679048 8:127235267-127235289 ATTAGAAGTTAGACAGACATGGG - Intergenic
1047881425 8:129198320-129198342 ACTAAAAGTGAGAAAGACCTTGG - Intergenic
1048178383 8:132172892-132172914 CCTTGAAGTCAGGAAGACCTGGG + Intronic
1048622034 8:136144312-136144334 ACTTACAGGAAGACAGACCAAGG + Intergenic
1050744690 9:8861635-8861657 ATTTGAAGTCAAACAGATCTAGG - Intronic
1051793036 9:20830063-20830085 AACTGTATTAAGACAGACCTAGG - Intronic
1052164840 9:25312704-25312726 ACTTGATTTCAGAAAGACCTGGG + Intergenic
1055258474 9:74402653-74402675 CCTGGAAGTCAGAAAGACCTTGG - Intergenic
1056177569 9:84050219-84050241 ACTTGGAGTCAGAGAGATCTGGG + Intergenic
1056417306 9:86389128-86389150 CGTTGAAGTCAGAAAGACCTTGG - Intergenic
1056455587 9:86756540-86756562 ACTTGAATAAAACCAGACCTGGG + Intergenic
1057702610 9:97374730-97374752 CTCTGAAGTCAGACAGACCTGGG + Intronic
1057815211 9:98289378-98289400 CCTGGGAGTCAGACAGACCTGGG - Exonic
1058000559 9:99861098-99861120 CCCTGGAGTTAGACAGACCTAGG - Intronic
1058533900 9:105934774-105934796 ATTTGATCTAAGAGAGACCTGGG - Intergenic
1058699703 9:107589951-107589973 ACTTGAAGTTGGAAAGACCGGGG + Intergenic
1058717879 9:107738708-107738730 CTTTGAAGCAAGGCAGACCTAGG + Intergenic
1058836773 9:108864347-108864369 AACTGAAGTAAGACTGATCTTGG + Intergenic
1059204164 9:112447982-112448004 CTTTGGAGTAAGACAGATCTGGG + Intronic
1059467510 9:114478425-114478447 ACTTGAGGGAAGACAGAGCCTGG + Intronic
1060288960 9:122282523-122282545 ACTTGGAGTTGGTCAGACCTGGG + Intronic
1060403551 9:123361841-123361863 CTTTGAAGTGAAACAGACCTGGG - Intronic
1186586460 X:10879015-10879037 GTTTGGAGTCAGACAGACCTGGG - Intergenic
1186994087 X:15101361-15101383 AATTGTGGTAAGACAGAGCTAGG - Intergenic
1189968024 X:46394044-46394066 ACTTGATGTGAGACATACCTGGG - Intergenic
1190490115 X:50973517-50973539 CTTTGAAGTAAGTCAAACCTAGG + Intergenic
1191171423 X:57451241-57451263 ATTTGGAGTCAGACAGACCTGGG - Intronic
1192192050 X:68996844-68996866 CCTTGGAGTAGGACAGACCTGGG - Intergenic
1192246302 X:69374626-69374648 ATTTAGAGTTAGACAGACCTGGG + Intergenic
1192341167 X:70264461-70264483 GCTTGGAGTCAGACAGACCTAGG + Intergenic
1192847578 X:74922274-74922296 ACTTGAAGTAAAACAGAAAGTGG + Intronic
1193792752 X:85835896-85835918 ATTTGAAGTCAGACAGACTTAGG - Intergenic
1194866268 X:99072057-99072079 ACTTTAAGTAAGACAAAGGTGGG + Intergenic
1194915462 X:99701833-99701855 ATTTGGAGTTCGACAGACCTGGG + Intergenic
1194979422 X:100425181-100425203 ATTTGGAGTCAGACAGACTTGGG - Intergenic
1195717835 X:107834824-107834846 CCCTGGAGTCAGACAGACCTGGG + Intronic
1195938012 X:110143647-110143669 CCTTGGCATAAGACAGACCTGGG + Intronic
1196376774 X:115041475-115041497 TTTTGAAGTAAGGAAGACCTGGG + Intergenic
1197223575 X:123935398-123935420 GCTTGAAATCAAACAGACCTGGG + Intergenic
1197309669 X:124888949-124888971 CCACGATGTAAGACAGACCTAGG - Intronic
1197523741 X:127534248-127534270 ATTTGAGGTCAGACAGAACTGGG - Intergenic
1197840467 X:130740837-130740859 CTTTGGAGTCAGACAGACCTGGG + Intronic
1198322268 X:135529972-135529994 ACTAGAATAGAGACAGACCTAGG - Intronic
1198492201 X:137153077-137153099 CTTTGAAGTCAGACAGATCTGGG - Intergenic
1199151174 X:144488899-144488921 TCTTGAAGTGAGGCAGTCCTGGG + Intergenic
1199824791 X:151488351-151488373 CTTTGCAGTCAGACAGACCTTGG + Intergenic