ID: 905583201

View in Genome Browser
Species Human (GRCh38)
Location 1:39097836-39097858
Sequence GCATTGGCCACCACTCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905583197_905583201 24 Left 905583197 1:39097789-39097811 CCCTGATGCTGGTGAACTGCTTC 0: 1
1: 0
2: 3
3: 17
4: 168
Right 905583201 1:39097836-39097858 GCATTGGCCACCACTCTCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 117
905583198_905583201 23 Left 905583198 1:39097790-39097812 CCTGATGCTGGTGAACTGCTTCA 0: 1
1: 0
2: 1
3: 17
4: 193
Right 905583201 1:39097836-39097858 GCATTGGCCACCACTCTCAAGGG 0: 1
1: 0
2: 2
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905583201 Original CRISPR GCATTGGCCACCACTCTCAA GGG Intronic
903778519 1:25808030-25808052 TGATTGGCCACCACCCTCATCGG + Intronic
905252985 1:36661673-36661695 GCATGAGCCACCACCCTCAGCGG + Intergenic
905583201 1:39097836-39097858 GCATTGGCCACCACTCTCAAGGG + Intronic
905888166 1:41502830-41502852 GCAGTGGCCACCACCCTCTGAGG + Intergenic
908481672 1:64546612-64546634 GCATGAGCCACCACTCCCAGTGG + Intronic
908708812 1:66992005-66992027 TCATTAGCCAGCACTCTCTAGGG - Intergenic
917839453 1:178965694-178965716 CCATTGGCAAACACTCTTAAAGG + Intergenic
921546574 1:216481556-216481578 CCATTGGCCACCTCCCTAAATGG - Intergenic
922120324 1:222660210-222660232 GCATTCTCCACCACTCACAGGGG - Exonic
922462682 1:225825308-225825330 GCACTGGCCCCCACTCCCCACGG - Intronic
1064679908 10:17800087-17800109 GCATGCACCACCACTTTCAATGG - Exonic
1066064158 10:31750269-31750291 GCACTGGCTCCCACTCTCAGAGG + Intergenic
1068875396 10:61990558-61990580 ACATTTGTCAGCACTCTCAAAGG + Intronic
1073683016 10:105725252-105725274 GCATTGGCCACCACTCTCTGTGG - Intergenic
1074944761 10:118270710-118270732 ACATTTGCCACCCCTCTCAAAGG + Intergenic
1077739603 11:4830811-4830833 GCACTGGTCACCAATCTGAAGGG + Intronic
1077890622 11:6415625-6415647 CCATTGGCCACCCGTCTCAGAGG + Intronic
1079554672 11:21744131-21744153 GCACTGGACACCACTATCCATGG - Intergenic
1081429620 11:42962157-42962179 GCTTGGGCCACCACTCTGAAAGG - Intergenic
1082627701 11:55503884-55503906 GCATTGCCCACCACAGTTAAAGG + Intergenic
1084584158 11:70046567-70046589 GAATTGGCCACTTCTCTCAGTGG - Intergenic
1085009256 11:73125894-73125916 GCATTAGCCAGCTCTCTCCATGG - Intronic
1087159258 11:94933203-94933225 GCAATTGCCATCACTTTCAATGG + Intergenic
1088597529 11:111451194-111451216 GCATCAGCCACCACTCCCAAAGG + Intronic
1090023077 11:123144648-123144670 GCATGAGCCACCACTCCCAGCGG + Intronic
1090149414 11:124366697-124366719 GCACTGGCCTTCACTCTCTAGGG - Intergenic
1090277983 11:125432821-125432843 GCATTGGCCACCTCCTTCAGTGG + Exonic
1090728732 11:129551412-129551434 GCTTAGGCCACCACTCTGGAGGG + Intergenic
1090991823 11:131824398-131824420 GTAATAGCCCCCACTCTCAAGGG + Intronic
1091331789 11:134736472-134736494 GCATTTGTCCCCACCCTCAAGGG - Intergenic
1092090715 12:5801689-5801711 GCATTTACCACCACTCGCAATGG + Intronic
1096969555 12:55654893-55654915 GCCTTGGCCACCATGCTCATAGG + Intergenic
1099939236 12:89165190-89165212 GGATTGGCAAACACCCTCAAAGG + Intergenic
1102168893 12:110827185-110827207 CGAGTGGCCACCACACTCAAGGG - Intergenic
1107862866 13:44677351-44677373 TCATTGGCCAAAACTATCAAAGG - Intergenic
1111836486 13:93394982-93395004 GTATTGGCCTCCACTGTCACAGG + Intronic
1112354761 13:98664734-98664756 GCATTGGACACTACTCTAGATGG + Intergenic
1118055831 14:62078637-62078659 GAATTGGCCACCACTCAGTATGG + Intronic
1119636263 14:76275971-76275993 GAATTGGCCAACTCTCTCAGAGG + Intergenic
1121269164 14:92626490-92626512 GCCTGGGACACCTCTCTCAAAGG + Intronic
1122551277 14:102551406-102551428 GCATGAGCCACCACACCCAAAGG - Intergenic
1124139550 15:27065115-27065137 ACGTTGGCTGCCACTCTCAATGG + Intronic
1124168327 15:27349534-27349556 TCCTTGGCTTCCACTCTCAATGG + Intronic
1125261672 15:37832926-37832948 GCCAAGGCCACCACTCTGAAGGG + Intergenic
1125749702 15:42020095-42020117 GCATTGGCCACCACCCACCACGG + Intronic
1126245920 15:46505527-46505549 GCAGTGGCCACCACTCTACTAGG - Intergenic
1128230768 15:66033467-66033489 GCTTTGGCCATCACTCTGGAGGG + Intronic
1130145658 15:81271973-81271995 GCAGTGGCCATCACTTTAAAGGG + Intronic
1130201282 15:81829463-81829485 GCATTGTCCTCACCTCTCAATGG + Intergenic
1136398549 16:30005709-30005731 GCAATGGCCACCTCTTTAAAAGG + Exonic
1140819945 16:78653801-78653823 GTTTTGGCCATCACTTTCAATGG - Intronic
1148747949 17:49928869-49928891 GGATTCGCCACCTATCTCAAAGG - Intergenic
1150567645 17:66356177-66356199 GCATTAGCCACCACGCCCATCGG + Intronic
1151415611 17:73960736-73960758 GCTCTGGCCACCACTCTAGAGGG + Intergenic
1153048283 18:876888-876910 GCCTAGGCCACCACTCTCACAGG - Intergenic
1159560270 18:69985728-69985750 GCTTGGGCCACCACTCTGGAGGG - Intergenic
1167145709 19:47680056-47680078 GCTGTGGCCACCACGCTCAATGG + Exonic
1167949913 19:53018078-53018100 GCATGAGCCACCACACCCAACGG + Intergenic
926597445 2:14806721-14806743 GCAAAGGCCAACACTCTAAAGGG + Intergenic
927218028 2:20680772-20680794 ACGTTGGGCACCACCCTCAATGG - Intergenic
931912286 2:66913673-66913695 GCATTGCCCACTACTCTTAATGG + Intergenic
938764663 2:134452486-134452508 GCACTGGGCTCCACTCCCAAAGG - Exonic
943647243 2:190419357-190419379 TTATTGGCCAACATTCTCAATGG - Intronic
945288196 2:208103274-208103296 GCATGAGCCACCACACTCAGCGG - Intergenic
945495726 2:210505270-210505292 GTTTTGGCCACTACTTTCAATGG - Intronic
947734585 2:232448087-232448109 TCCTTGGCCAACACTCTGAATGG + Intergenic
948028865 2:234800371-234800393 ACATTGGCCACCAATTCCAAAGG + Intergenic
1174447063 20:50597530-50597552 CCAGTGGCCACCACTCCCACCGG - Intronic
1175647850 20:60690887-60690909 GCAGTGGGCACCACCCTGAATGG - Intergenic
1178739599 21:35185965-35185987 GCATTGGCCTGCAGTCACAAAGG - Intronic
1179486012 21:41711182-41711204 ACAGTGGCCTCCACTGTCAACGG - Intergenic
1180693540 22:17737768-17737790 GCCTTTGCCACCCCTCTGAATGG + Intronic
1183744232 22:39684212-39684234 GCATTGAGCACCAATCTCACTGG - Intronic
1184781256 22:46650780-46650802 GCACCAGCCACCACTCTCCAAGG - Intronic
1185140764 22:49099931-49099953 GCCTTGGCCACAGCTCTAAACGG + Intergenic
1185374490 22:50475695-50475717 ACAGTGCCCACCCCTCTCAAGGG + Intergenic
949636286 3:5984894-5984916 ACATTGGCCATCACTGTAAAAGG + Intergenic
951237284 3:20250761-20250783 GCTCTGGCCACCACTCCAAAGGG - Intergenic
951287953 3:20838196-20838218 GCATTGGCCTGCAGTCTCAGAGG + Intergenic
954295298 3:49671233-49671255 TGAGTGGCCACCACTCTCCAGGG - Exonic
958477511 3:94603750-94603772 CCATTAGCCCCCACTCTAAAAGG + Intergenic
960996567 3:123344082-123344104 GCAGGGGCCACCACTGTCCATGG - Intronic
962083479 3:132165669-132165691 TCATTGGCCATAACTCTGAAAGG + Intronic
962811691 3:138963857-138963879 GCATTGGCCCCGCCTCTCAATGG - Intergenic
969874559 4:10126274-10126296 CCGTAGGCCACCACTCACAATGG - Intergenic
970957065 4:21825200-21825222 GCATTGGTCACATCTCTCAGTGG - Intronic
974090944 4:57310917-57310939 TCATTAGCCAGCCCTCTCAATGG + Intergenic
974331371 4:60483261-60483283 GCATTGGCCACCTCTCTGAAAGG + Intergenic
975435888 4:74350688-74350710 CAATTGGCCTCCACTCTCAGAGG - Intergenic
977381536 4:96280224-96280246 TCATTGGCCTTCACTCTCTAAGG + Intergenic
978366753 4:107990327-107990349 GCATTCACCGCCACTCTCCATGG - Intronic
980571004 4:134619847-134619869 CAATTGACCACAACTCTCAAAGG + Intergenic
985721794 5:1493357-1493379 GCTGTGGCCACCACCCTCAGTGG + Intronic
989783208 5:45295168-45295190 CCATTCACCATCACTCTCAATGG + Intronic
996219048 5:120906571-120906593 GAATTTGTCACCATTCTCAAAGG - Intergenic
996978792 5:129463986-129464008 GCATTCCCCACCTCTCCCAAGGG - Intronic
997688719 5:135810840-135810862 CCATTTGCCAGCACTCGCAAGGG + Intergenic
1001620634 5:173081972-173081994 GAATGGGCAACCACTCTAAAAGG - Intronic
1004819621 6:19353170-19353192 GCCTGGGCCAGCACTCTAAATGG - Intergenic
1005112346 6:22296511-22296533 CAATTTGCCACAACTCTCAAAGG - Intronic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1007456817 6:41984626-41984648 GCATGAGCCACCACTCTCGGCGG + Intronic
1009440399 6:63671381-63671403 GCTTTGGCCATTACTCTCAATGG + Intronic
1019688422 7:2395549-2395571 GCATTGGTCAGCATTCTCCAGGG + Intergenic
1019910812 7:4099695-4099717 GCATTAGCCACCACTTCCACTGG - Intronic
1020767160 7:12337235-12337257 GCAGTGGCCACCATTCTTACAGG + Exonic
1026080845 7:67218631-67218653 GCATGAGCCACCACTCACTATGG + Intronic
1026696240 7:72595401-72595423 GCATGAGCCACCACTCACTATGG - Intronic
1028142210 7:87286978-87287000 GTATTGGCCTCCACTCTCTTTGG + Intergenic
1031886304 7:127249534-127249556 GCATTGCCCACCACTGAGAAAGG + Intronic
1032192005 7:129770790-129770812 GCTGTGGTCACCACTCCCAAGGG + Intergenic
1037503352 8:19506217-19506239 GCATTTGCCATAACTCTCACAGG - Intronic
1038913023 8:31988450-31988472 GGATTGGCCAAAACTCTAAAAGG + Intronic
1048945873 8:139446575-139446597 CCGTTTGCCACCACTCTCTAAGG - Intergenic
1049460525 8:142725593-142725615 GCAATGGCCAACAGGCTCAACGG + Intergenic
1049863246 8:144915685-144915707 GCATGAGCCACCACACTCAGTGG - Intergenic
1050741048 9:8821538-8821560 GGATTGGCCTCCACTCTTAGGGG - Intronic
1056752693 9:89363589-89363611 CCACTGGCCACCTTTCTCAATGG + Intronic
1058327854 9:103720623-103720645 GTTTTGGCCATCACTTTCAATGG - Intergenic
1186189660 X:7056243-7056265 TCCCTGGCCACCACCCTCAAAGG - Intronic
1188210671 X:27419682-27419704 CCCTTGGCCACCACTATCACAGG - Intergenic
1188303331 X:28531903-28531925 GCTTTGGCCATTACTTTCAATGG - Intergenic
1192167606 X:68835496-68835518 GCTTTGGCCTTCACTCTCACTGG + Intronic
1196123776 X:112078602-112078624 GCATTGGCCACCACCATCCAAGG + Intronic
1196346689 X:114669547-114669569 GCACGTGCCACCACTCTTAATGG - Intronic
1197808122 X:130416539-130416561 GCATTGGCCATCGCTTTCACTGG + Intergenic
1197843482 X:130775581-130775603 ACACAGGCCATCACTCTCAAGGG + Intronic
1198770532 X:140125868-140125890 CCAGTGGCCACCACTATCATTGG + Intergenic
1199924007 X:152443337-152443359 GCAATGGCCAGCACTGTCATGGG + Intronic
1200160020 X:154002256-154002278 GCACTGGCCACCTTGCTCAATGG + Intergenic
1202103529 Y:21336643-21336665 GCACCAGCCACCACTCCCAAAGG + Intergenic