ID: 905591245

View in Genome Browser
Species Human (GRCh38)
Location 1:39166001-39166023
Sequence TTGATAGTCCCTGTCTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905591241_905591245 19 Left 905591241 1:39165959-39165981 CCTTCCTTTCATTGAGAACTTTC 0: 1
1: 0
2: 1
3: 35
4: 458
Right 905591245 1:39166001-39166023 TTGATAGTCCCTGTCTTTGAGGG 0: 1
1: 0
2: 1
3: 14
4: 186
905591242_905591245 15 Left 905591242 1:39165963-39165985 CCTTTCATTGAGAACTTTCTGAC 0: 1
1: 0
2: 0
3: 16
4: 201
Right 905591245 1:39166001-39166023 TTGATAGTCCCTGTCTTTGAGGG 0: 1
1: 0
2: 1
3: 14
4: 186
905591239_905591245 29 Left 905591239 1:39165949-39165971 CCATCTCCTTCCTTCCTTTCATT 0: 1
1: 19
2: 120
3: 849
4: 4200
Right 905591245 1:39166001-39166023 TTGATAGTCCCTGTCTTTGAGGG 0: 1
1: 0
2: 1
3: 14
4: 186
905591240_905591245 23 Left 905591240 1:39165955-39165977 CCTTCCTTCCTTTCATTGAGAAC 0: 1
1: 0
2: 1
3: 41
4: 444
Right 905591245 1:39166001-39166023 TTGATAGTCCCTGTCTTTGAGGG 0: 1
1: 0
2: 1
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905591245 Original CRISPR TTGATAGTCCCTGTCTTTGA GGG Intronic
902741866 1:18444385-18444407 TCTGTAGTCCCTGTCATTGATGG + Intergenic
905591245 1:39166001-39166023 TTGATAGTCCCTGTCTTTGAGGG + Intronic
907145182 1:52224765-52224787 TTTATAGTCCCTGTCTTACTTGG + Intronic
908626923 1:66055186-66055208 TTTCTAGACTCTGTCTTTGAAGG + Intronic
909190508 1:72543115-72543137 ATGATAGCCACTGTCCTTGATGG - Intergenic
910624248 1:89289737-89289759 TTGATGGTCTCTGTCTCTGCAGG + Intergenic
911809440 1:102255780-102255802 TTGATAATTTCTGTCTTTTAAGG - Intergenic
917679194 1:177348973-177348995 TCCATAGTCCCTGCCTTTGAGGG + Intergenic
919251672 1:195064914-195064936 CTGATATTCTCTGACTTTGAAGG + Intergenic
919755630 1:201064364-201064386 TTGTTGGTCCCTGTCCTGGAGGG - Intronic
921522374 1:216172280-216172302 TTTATAATTCCTGTCATTGATGG + Intronic
923779806 1:237012070-237012092 TAGGTAGTTCCTGTCCTTGATGG + Intergenic
923934158 1:238743037-238743059 TTGAGTGCCCCTGTCTTAGAAGG + Intergenic
1063777237 10:9277609-9277631 TGGATAGTCTCTGTGTTTAAAGG - Intergenic
1064342981 10:14503117-14503139 TTAATACTCCCTTTCTTTGAGGG + Intergenic
1068187696 10:53607678-53607700 TTGATAATTCCTAACTTTGAAGG - Intergenic
1068837966 10:61576173-61576195 GTGATAGTCCCAGTATCTGAAGG - Intergenic
1069775076 10:70922069-70922091 TTGATATTCCCTGGCTTTGGAGG + Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1071147261 10:82589648-82589670 TTGATTTTCCCTCCCTTTGAGGG + Intronic
1072419337 10:95276522-95276544 TGGATAGTTCCTGTCTTGAATGG + Intronic
1074577952 10:114688596-114688618 ATGATGGTCCCTGTCCTAGAGGG - Intergenic
1074797847 10:116966940-116966962 TTGATATTACCTGTCTTTGGAGG - Intronic
1076145064 10:128112207-128112229 CTGATAGACACTCTCTTTGAAGG + Exonic
1077946207 11:6902898-6902920 TAAATAGAACCTGTCTTTGATGG + Intergenic
1080935380 11:36857811-36857833 TTGGTAAACCCTGTCTTGGAAGG - Intergenic
1081761425 11:45578926-45578948 TTGATAGTCTCTGTTTAAGAAGG - Intergenic
1083620961 11:64049188-64049210 TTCATAGTCCCACTCTTGGAAGG + Intronic
1086752846 11:90519618-90519640 TTGATAGTGGCTGTTTCTGAAGG + Intergenic
1088187002 11:107181567-107181589 TTGATAGACAATGTCTTTAAGGG - Intergenic
1090450926 11:126805784-126805806 TTGATAGTCTCTGTCTTTCACGG + Intronic
1090477229 11:127034439-127034461 ATGATAGTACCTGTCTTATAGGG - Intergenic
1093530995 12:20163530-20163552 TTGTTACTCCCTGTATTAGAAGG - Intergenic
1093710230 12:22321388-22321410 TTCATAGTCCCTTTCTCTGTTGG - Intronic
1094138740 12:27158335-27158357 TTTATATTCACTGACTTTGATGG - Intergenic
1095048993 12:37540917-37540939 TTGATTTTCCTTGTCATTGATGG + Intergenic
1095869889 12:47015079-47015101 ATGATAATCCCTGTCCTTCAGGG + Intergenic
1095880140 12:47126722-47126744 TTCATAGTCTGTGTCTTTCAAGG + Intronic
1096963491 12:55604245-55604267 TTGATTCTTCCTGTCTGTGAGGG - Intergenic
1099295847 12:80826885-80826907 ATGATAGGCACTGTCCTTGAGGG + Intronic
1100365866 12:93919859-93919881 CTGCTACTCCCTCTCTTTGAGGG - Intergenic
1104231773 12:126891963-126891985 TTCATAGTCCCTCTCCTTCATGG + Intergenic
1109106141 13:58253131-58253153 TTCATAGACCCTGTAGTTGAGGG - Intergenic
1109176372 13:59161874-59161896 TTGATAGTTTATGTCTTTCAAGG - Intergenic
1113182739 13:107650211-107650233 TCGATAGTGCCTGTCTAGGAAGG + Intronic
1116469470 14:45270122-45270144 TTGATTGTTCCTGTTTGTGAAGG - Intergenic
1116970147 14:51055461-51055483 TTGATAGTCTCTGTGTTTACTGG - Intronic
1117354835 14:54913796-54913818 AGGATAGTACCTATCTTTGAGGG + Intergenic
1119563892 14:75612510-75612532 TAGATTGTCTTTGTCTTTGAAGG + Intronic
1121514838 14:94542704-94542726 TTGGTAGTCCCTGACCTTCAGGG - Intergenic
1121990867 14:98555999-98556021 TTGATTGTCACAGTGTTTGAGGG - Intergenic
1202854124 14_GL000225v1_random:39489-39511 TTTATAGTCTCTGTCTATGGAGG - Intergenic
1130411185 15:83650091-83650113 TTGATATTCCTTGTCTCTAAGGG + Intergenic
1134339948 16:13335719-13335741 TTGATGCTCTGTGTCTTTGAGGG + Intergenic
1135603656 16:23804338-23804360 TTGAAAGTCCTAGTCTCTGAGGG - Intergenic
1137792521 16:51186912-51186934 TGGTGAGTCCCTGTTTTTGAAGG + Intergenic
1138771221 16:59666080-59666102 CTCAGAGTCCCTGTGTTTGAGGG + Intergenic
1140910045 16:79442981-79443003 GTGTATGTCCCTGTCTTTGAAGG + Intergenic
1143101570 17:4507297-4507319 TTGCTAGGCCCTGTCTTTCCAGG + Intronic
1143500366 17:7335296-7335318 TTGAGACTCACTGTCTTTGGAGG - Intergenic
1143754827 17:9059006-9059028 ATGATAGTACCTGTCTCAGAGGG + Intronic
1146035240 17:29400492-29400514 TTTACCATCCCTGTCTTTGAAGG + Intronic
1146950747 17:36904110-36904132 TTGATAGACTCTGTCTTGGTGGG - Intergenic
1149144405 17:53472785-53472807 TTGATAGTACCTCTCATTGGTGG + Intergenic
1151042265 17:70876153-70876175 TTGATAGTCCTTGTCTCACAGGG + Intergenic
1151894516 17:76970956-76970978 ATGCTAGTCCCTATCTTTAAGGG + Intergenic
1153179746 18:2419752-2419774 CTAATAGTTTCTGTCTTTGAGGG - Intergenic
1153404656 18:4723429-4723451 TTGAAAGTGGTTGTCTTTGAAGG + Intergenic
1153851306 18:9097914-9097936 TTGATAGTGCCTATGTGTGATGG + Intergenic
1153987225 18:10363309-10363331 TTAATAGTCCCTATCTATTAAGG + Intergenic
1155095674 18:22553468-22553490 TTTTTGGTCTCTGTCTTTGAGGG + Intergenic
1155576523 18:27253950-27253972 TTTATAGTCCTTCTCTTAGAGGG - Intergenic
1156427482 18:37029933-37029955 TTGGTAGTTTCTGTCTTTCAAGG + Intronic
1159429083 18:68327758-68327780 TTTATACTCCATGTCTTTGAAGG + Intergenic
1160081711 18:75733971-75733993 TTGATAGTTTGTGTCTCTGAAGG - Intergenic
1162590349 19:11587293-11587315 TTGATAGGCCCTGTTCTTCAGGG - Intronic
1164465281 19:28482467-28482489 TGGAGAGCCCCTGTCTTTGCTGG + Intergenic
1164698845 19:30267683-30267705 GTGATACTCCCTGTGTCTGAAGG - Intronic
1164909023 19:31990525-31990547 TTTCTAGTCCCTGTGTTAGAGGG - Intergenic
926425678 2:12736633-12736655 AGGACAGTCCCTGTCATTGATGG + Intronic
926612955 2:14965441-14965463 TTGATAGTGCGTGTCTTTCAAGG - Intergenic
929497458 2:42458522-42458544 TGGATAGCCCCTGTCTTAGCAGG - Intronic
931314505 2:61115262-61115284 TTGATAATTTCTGTCTTTCAAGG + Intronic
931577462 2:63733602-63733624 TTGCTAGTCACTGTGTTTTATGG - Intronic
933529634 2:83490524-83490546 TTGTTAGTTCTTATCTTTGAAGG - Intergenic
934033632 2:88069506-88069528 TTGACAGTCCCTGTGTTTCTGGG - Intronic
934977464 2:98813920-98813942 TTGATAGTTTGTGTCTTTCAAGG + Intronic
937068639 2:119043094-119043116 TTGATAGTAGCTGTCTTTACGGG + Intergenic
942077824 2:172373098-172373120 TTGATAATCCCTGCCTTCTAGGG + Intergenic
943034967 2:182731972-182731994 TTGCTTCTCCCTGTCTTTGTAGG + Intronic
946124294 2:217547558-217547580 TTGATAGTTTTTGTCTTTCAGGG - Intronic
946448950 2:219763511-219763533 TTGATACCCACTGTCTCTGAAGG + Intergenic
1169023161 20:2345402-2345424 TTGATAGTTTGTGTCTTTCAAGG - Intergenic
1169274369 20:4223584-4223606 TAGACAGTCCCTGACTTTGATGG + Intronic
1169736854 20:8846956-8846978 TTGAGAGTCCTTGTCTCAGAAGG - Intronic
1170707097 20:18754180-18754202 TTGGAAGTCAGTGTCTTTGAGGG + Intronic
1175363361 20:58432621-58432643 TTGACAGTCCCTGTCCAGGAAGG + Intronic
1176341311 21:5698192-5698214 TCGATTGTCCCCGTGTTTGAGGG - Intergenic
1176473565 21:7130345-7130367 TCGATTGTCCCCGTGTTTGAGGG - Intergenic
1176503516 21:7626264-7626286 TCGATTGTCCCCGTGTTTGAGGG + Intergenic
1177511835 21:22097173-22097195 TTGATATTCCTTCTCTTTTAGGG - Intergenic
1178895917 21:36556745-36556767 TTGATGGTCCCTGATTTTGGTGG + Intronic
1180111670 21:45658883-45658905 TTGATAGTTTCTGTCTTTCTAGG + Intronic
1181267769 22:21641060-21641082 TTGGTAGTCCCTGCACTTGAGGG - Intergenic
1181816598 22:25442147-25442169 TTTATAGTTTCTGCCTTTGAAGG - Intergenic
1181976595 22:26735285-26735307 GTGATAGTCCCTGTCTGCTAAGG - Intergenic
1182117911 22:27767919-27767941 ATAACAGTCCCTGCCTTTGAAGG - Intronic
1182656846 22:31897521-31897543 TTGTTAGTCCCAGTTTTGGAGGG + Exonic
1203240574 22_KI270733v1_random:12656-12678 TCGATTGTCCCCGTGTTTGAGGG - Intergenic
949364026 3:3261346-3261368 TTGATAGCCTCTTCCTTTGAAGG + Intergenic
950805443 3:15599210-15599232 ATGATAGTTCCTGGCTTTAAGGG - Intronic
951460112 3:22942201-22942223 GTGATAGGCATTGTCTTTGAGGG - Intergenic
951484165 3:23193588-23193610 TAGATAGTCCCTGTCACTGGAGG + Intergenic
952432948 3:33243056-33243078 TTGGTAGTCTATGTCTTTCAAGG - Intergenic
952722911 3:36551980-36552002 TTGCTTGTCCTTGTCTTTGACGG - Intergenic
953486382 3:43301016-43301038 TTAATAATTCCTGTCTTTGAGGG + Intronic
955945588 3:64190708-64190730 TTGTTAGTACCTGTCTGTAATGG - Intronic
956745378 3:72307034-72307056 TGGATAGTCCCTGTCTTCCTGGG + Intergenic
958522420 3:95206531-95206553 TTGATAATCCTTTTCTTTGTGGG + Intergenic
959655236 3:108796761-108796783 TTGTTAGTCCATATCCTTGAGGG - Intergenic
960315998 3:116178049-116178071 GTAATAATACCTGTCTTTGAGGG + Intronic
960329997 3:116347448-116347470 TTGATAGTAACTGTGGTTGAAGG + Intronic
963789140 3:149565599-149565621 TTTATAGTTCCTTTCTTTTACGG - Intronic
965771334 3:172184539-172184561 TTGATAGGTCCTGGATTTGAGGG - Intronic
966107449 3:176353830-176353852 TTGATGGCTCCTGACTTTGAGGG + Intergenic
966109964 3:176388786-176388808 TTGAATGGCCCTGTCTTGGAAGG + Intergenic
969352942 4:6608653-6608675 TTAACAGTCCCTGCCTTTGGGGG + Intronic
971383961 4:26126232-26126254 TTGGTAGTCCCTGCCTCTTATGG + Intergenic
971710808 4:30109181-30109203 TTGATAGACTGTGTCTTTCAAGG + Intergenic
971772446 4:30914710-30914732 TTTATAGTATATGTCTTTGAGGG + Intronic
975545268 4:75554494-75554516 AACATGGTCCCTGTCTTTGAAGG - Intergenic
975773846 4:77761083-77761105 TTGGTAGTTTCTGTCTTTCAAGG - Intronic
976087825 4:81424348-81424370 CTGATTGTCTTTGTCTTTGAAGG - Intergenic
976183252 4:82419387-82419409 TTCATAGGCCATGTCTTTCATGG + Intergenic
976204322 4:82610059-82610081 TTGAGAATCCCTCTCTTAGAGGG + Intergenic
976244298 4:82992183-82992205 TTGATAGTTTGTGTCTTTGAAGG + Intronic
978085846 4:104652877-104652899 TTGATAGTTTGTGTCTTTCAAGG - Intergenic
978377361 4:108089102-108089124 GTGAGAGTCCCTGTCTTTCCAGG - Intronic
979580240 4:122350026-122350048 TTGCTAGTCATTGTCTTTGGCGG - Exonic
982775824 4:159440358-159440380 TTGATAGCAGCTGTCTTTGCTGG + Intergenic
983322251 4:166210507-166210529 TAGATAGTCCCTGACTTACAAGG - Intergenic
993849390 5:92987664-92987686 TTGATAGTTTGTGTCTTTCAAGG - Intergenic
993981412 5:94546717-94546739 TTGTTTGTGCCTGTCTTTGTTGG - Intronic
996531421 5:124531106-124531128 ATCATAGTCCCTGTCCTGGAAGG - Intergenic
996649724 5:125860394-125860416 TTATTATTCCCCGTCTTTGAAGG + Intergenic
997958648 5:138301364-138301386 TTGGTAGTTTGTGTCTTTGAAGG - Intronic
998560524 5:143167120-143167142 TTGATATATTCTGTCTTTGAAGG + Intronic
1000211869 5:159114815-159114837 TCCACAGTCCCTGTCTTTAAAGG - Intergenic
1000880929 5:166696394-166696416 TTGATAGTTAATGTCTTTCAGGG + Intergenic
1001622950 5:173104368-173104390 TTGATAGTCTCTGTATTGAAAGG + Intronic
1004121600 6:12828600-12828622 TTGACTGTAGCTGTCTTTGAAGG + Intronic
1004513209 6:16299271-16299293 TTTATGGTCCCTTTCTTTGATGG - Exonic
1005507401 6:26481659-26481681 TTAAGAATCCCTGTCTTTGGTGG - Intergenic
1007540431 6:42638222-42638244 TTGGTAGTCTGTGTCTTTCAGGG + Intronic
1010016770 6:71113762-71113784 TTGATAATGCCTGTCTTAGACGG + Intergenic
1010560338 6:77341249-77341271 TTCATAGTTCCTGTCCTTCAAGG + Intergenic
1011286126 6:85725109-85725131 CTGATAGTCCCTGGCCTAGAGGG + Intergenic
1012586083 6:100924228-100924250 TTGGTGGTCTGTGTCTTTGAAGG - Intergenic
1013278737 6:108613454-108613476 TTGGTAGTCTGTGTCTTTTAAGG + Intronic
1014616698 6:123610518-123610540 TTCATAGTCGCTGTCTTTACTGG + Intronic
1015320386 6:131866382-131866404 GTCATGGTCCCTGTTTTTGAGGG + Intronic
1015466676 6:133555868-133555890 TGGATAGTACTAGTCTTTGAAGG + Intergenic
1015973074 6:138762286-138762308 TTGCTATTCTCTGTCTTTGGAGG - Intronic
1016981368 6:149857680-149857702 TTTATAGACCCTGTCCTCGATGG + Intronic
1020517839 7:9146427-9146449 TTTATAGTTTCTGTCTTTAATGG + Intergenic
1021972907 7:25982959-25982981 TTGGTTGTCAGTGTCTTTGAAGG + Intergenic
1024535589 7:50428570-50428592 TTGACAGTCCCTCTCTTGAATGG - Intergenic
1028061582 7:86324719-86324741 TTGATAGACTCTGTCTTGGTTGG - Intergenic
1028446602 7:90931545-90931567 CTGACAGTCCCTGTCATTGCTGG + Intronic
1031582305 7:123491601-123491623 TTGATAGTTATTGTCTTTAAAGG - Intronic
1031897342 7:127366229-127366251 TCGATAGTGTCTGTCATTGAAGG + Intronic
1031965708 7:128026823-128026845 GTGTTAGTCCCTGGCTTTGTTGG - Intronic
1033223930 7:139546060-139546082 TTGAACCTCACTGTCTTTGAGGG - Intergenic
1039363207 8:36902572-36902594 TTGGTAGTGACTGTCTTTCAGGG - Intronic
1039889770 8:41677064-41677086 TTGATAGTTTGTGTCTTTCAAGG + Intronic
1042053803 8:64740768-64740790 TTGGTAGTTCATGTCTTTTAAGG - Intronic
1042583014 8:70303350-70303372 TTTATAGTACTTGTCTTTGCTGG - Intronic
1044843398 8:96357071-96357093 TTGATTGTCCCAGTGGTTGAAGG + Intergenic
1046253275 8:111662534-111662556 TTCATAGTCTCTGATTTTGATGG + Intergenic
1050560006 9:6825523-6825545 TTGAGAATCACTGTCTCTGAAGG - Intronic
1051146999 9:14037430-14037452 TTGAAAGTCCCTGTCTCCCATGG + Intergenic
1054954276 9:70889795-70889817 TTAATGGTTCCTGTCTTTCATGG - Intronic
1055065882 9:72117783-72117805 GTGATAGTTACTTTCTTTGAGGG + Intronic
1056226820 9:84503997-84504019 TTGTTAGTCCCTATCTTCCAAGG - Intergenic
1056303408 9:85265903-85265925 TTGATAGTCTCTGGCTATTAGGG + Intergenic
1056844839 9:90028697-90028719 TTGATAGTTCCTTTCTTTTTAGG - Intergenic
1058694433 9:107547478-107547500 TTGATAGTTCCTTTCTTAGAAGG - Intergenic
1059023743 9:110602888-110602910 TTAATTTACCCTGTCTTTGAAGG + Intergenic
1060664525 9:125424784-125424806 TTTAAAGGCCCTGTCTTTGCCGG - Intergenic
1185950549 X:4427730-4427752 TTGATAGTTCATGTGTTTCAAGG - Intergenic
1186115259 X:6298630-6298652 TTAATAGTAACTGTCTTTGAGGG - Intergenic
1193677989 X:84481053-84481075 TTGATAGTTTGTGTCTTTCAAGG + Intronic
1194671770 X:96742238-96742260 TTGAAAGTGCCTTACTTTGAAGG - Intronic
1196153331 X:112399032-112399054 TTGATAGTTTGTGTCTTTCAAGG + Intergenic
1196374400 X:115017289-115017311 TTGATATTGCCTCTCTATGAAGG + Exonic
1197125107 X:122935650-122935672 TTGATAGTTTGTGTCTTTCAAGG - Intergenic
1197458372 X:126706888-126706910 TAGATACTCCATGTTTTTGATGG - Intergenic
1197641410 X:128972223-128972245 TTGAAAATCGCTGTCTTTTATGG - Intergenic
1197724971 X:129770117-129770139 TTAGTAGTACCTGTCTTTGTGGG - Intergenic
1199151499 X:144492135-144492157 TTGATAGCCCCTGTCATGTAGGG - Intergenic
1199932719 X:152540665-152540687 TTGCTAGTGCCTGTCCTTTAGGG - Intergenic
1201652383 Y:16304029-16304051 AACATAGTCCCTGTCTGTGAGGG - Intergenic