ID: 905592170

View in Genome Browser
Species Human (GRCh38)
Location 1:39173604-39173626
Sequence CTCTGGGCAGGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1055
Summary {0: 1, 1: 1, 2: 7, 3: 108, 4: 938}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905592159_905592170 10 Left 905592159 1:39173571-39173593 CCTAGTGTATTTGAAAAACTGTT 0: 1
1: 0
2: 1
3: 26
4: 375
Right 905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG 0: 1
1: 1
2: 7
3: 108
4: 938

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905592170 Original CRISPR CTCTGGGCAGGGAGGGAAGA GGG Intronic
900204726 1:1427083-1427105 GGCTGAGCAGGGCGGGAAGAGGG - Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900380123 1:2379784-2379806 CTGTGGGCAGGAAGGTAAAAGGG + Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
900765852 1:4504966-4504988 CTCGGGCCAGGCGGGGAAGATGG + Intergenic
900966837 1:5964656-5964678 CACTGGCCAGGGAGTGGAGAAGG - Intronic
901032874 1:6318483-6318505 CTTTGTGCACGGAGGTAAGAAGG - Exonic
901078776 1:6571906-6571928 CTCTGAGCCAGGAGGGAAGAAGG - Intronic
901375320 1:8834194-8834216 CTCTGGGGAGGGTGGCAGGAAGG + Intergenic
901379004 1:8860529-8860551 CTCTGGGCAGGAAGGCAGAAGGG - Intergenic
901457119 1:9369414-9369436 CTCTGGGCTGGTAGGAAAGAAGG - Exonic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902263344 1:15243725-15243747 CCCAGGGCAGGGAGTGAAGGGGG - Intergenic
902375370 1:16027800-16027822 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902380334 1:16049597-16049619 CTCTGGGGAAGGAGGGCAGTGGG - Exonic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
903026172 1:20431070-20431092 GGCTGGGCAGGGAGGGAGAAGGG - Intergenic
903045668 1:20562663-20562685 CTCTGAACAGGGAAGGAGGAAGG - Intergenic
903129351 1:21268627-21268649 CTCTAGGCGGAGAGGGGAGAAGG - Intronic
903790584 1:25890278-25890300 CACTGGGCAATCAGGGAAGAGGG - Intronic
904621297 1:31776884-31776906 ATCTGGGGAGGCAGGGCAGAGGG + Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904699258 1:32348606-32348628 GGCTGGGCTGGGAGGGAAGATGG - Intergenic
904752917 1:32752279-32752301 CATTTTGCAGGGAGGGAAGAGGG + Intronic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
905150569 1:35923685-35923707 CCCTGGGCAGGGAGAGAGGCTGG + Exonic
905175292 1:36131389-36131411 CTTTGGGAAGGGAAGGTAGAAGG + Intergenic
905226054 1:36480079-36480101 CCCTTGGATGGGAGGGAAGATGG + Intronic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905408819 1:37754309-37754331 CTCTGGGCACGGTGAGCAGAGGG + Exonic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
905920433 1:41715429-41715451 GCCTGGGGAGGGTGGGAAGATGG + Intronic
905936463 1:41827923-41827945 GGCAGGGAAGGGAGGGAAGAGGG + Intronic
906567748 1:46812875-46812897 CTTTGGCCTGGGAGGAAAGAGGG - Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907159811 1:52361709-52361731 CTCTGCTGTGGGAGGGAAGAGGG - Intronic
907423666 1:54364745-54364767 GTCTGGGCAGGGAGAGAGGCAGG - Intronic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908255251 1:62297993-62298015 CTCTAGGCAGGGCAGGAGGAGGG + Intronic
908319782 1:62967874-62967896 CTAGGAGCAGGGAGGAAAGAGGG - Intergenic
908833514 1:68205523-68205545 CTCAGGGCAGTGCTGGAAGAAGG - Intronic
909218827 1:72927929-72927951 ATCTGGGCAAGGAAGGAAGTAGG - Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909732724 1:78914821-78914843 CTCTGCGCTTGGAGGGTAGAAGG + Intronic
910855621 1:91692346-91692368 CTCTGGGGAGTGAGAAAAGAAGG + Intronic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
911380101 1:97104035-97104057 CACTGGGCAGGGAGGGTAATCGG - Intronic
912155131 1:106908951-106908973 AGCTGGCTAGGGAGGGAAGAGGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
912502159 1:110129856-110129878 CTCTGGGCAGGGGTGGGAGTGGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
912977854 1:114346259-114346281 CCCTGGGCCAGGAGGGAAGGGGG - Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913186486 1:116373956-116373978 CTCAGGGCACGGAGGGCGGAGGG - Exonic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
915040145 1:152961481-152961503 CTCTGAGGAGAGAGGAAAGAGGG + Intergenic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915320447 1:155053187-155053209 CTCTGGGCAGGAAGCCGAGAAGG + Intronic
915341368 1:155178649-155178671 TGCTGGGGAGGAAGGGAAGAAGG - Intronic
915355613 1:155253922-155253944 CTCTGGACAGGGCCGGAGGAGGG + Exonic
915465580 1:156095999-156096021 CCCTGGGCAGTGTGGGAAGGTGG - Intronic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
915510705 1:156385532-156385554 CTCTGAGCAGAGAAGGAAGAGGG + Intergenic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
915673451 1:157509730-157509752 CTCTGCGTGGGAAGGGAAGAAGG - Intergenic
915731642 1:158058402-158058424 GGCAGGGCAGGGAGGGAGGAGGG - Intronic
915931234 1:160062152-160062174 CTCTGGGCAGGCTGGGGAGATGG - Intronic
915963249 1:160284404-160284426 CTCTGGGCAGGAAGTCAACAGGG + Intronic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916647181 1:166797505-166797527 GTCTGGGCAGCGAGGGGAGCCGG + Intergenic
916808275 1:168281169-168281191 CTTCAGGCAGGGAGGGAAAAAGG + Exonic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
917926692 1:179795051-179795073 CTCTTGGCAAGGTGGTAAGAAGG + Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918094357 1:181322277-181322299 ATCTGAGCAGTGGGGGAAGAGGG + Intergenic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
918742754 1:188156053-188156075 CATGGGGCAGTGAGGGAAGAAGG + Intergenic
919162795 1:193853397-193853419 CTCTCAGCAGGGAGGGGAGCAGG - Intergenic
919244607 1:194964741-194964763 CACTGGGATGGGAGGGAAGGGGG + Intergenic
919420605 1:197365492-197365514 CTCTGGGGAGGGGGGGAGAAGGG + Intronic
919674864 1:200371279-200371301 CTCTGGGAAGTGAGGACAGAAGG + Intergenic
919728038 1:200896327-200896349 TTCTGGGGAGGGTGGGAGGATGG + Intronic
919982483 1:202650962-202650984 CACTGGGCAGAGTGGGAAGAAGG + Intronic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
920525617 1:206663892-206663914 CACTGGGCACGGAGGGGAGCCGG + Intronic
920679587 1:208062416-208062438 AGCTGGGCAGTGAGGGAAGGAGG - Intronic
920694852 1:208174432-208174454 GGCTGTGGAGGGAGGGAAGAAGG + Intronic
921366981 1:214383523-214383545 CTCTGGCCATGGCGGGAGGAAGG + Exonic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922238037 1:223736217-223736239 CCCTGGGCAGGAAGGGAGGCAGG + Intronic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
922933491 1:229407673-229407695 GTCTGTGGAGGGAGGGAAGGAGG + Intergenic
923228024 1:231957279-231957301 GTTTGCGGAGGGAGGGAAGAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924258473 1:242205770-242205792 CACTGAGCAGGGATGGCAGATGG + Intronic
924424668 1:243940385-243940407 GACTGGGAAGGGAGGGAAGGAGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924467545 1:244312110-244312132 CTCTGGGCAGAAAGGGAGGCTGG + Intergenic
1062985151 10:1761531-1761553 CTCTCGGGAGGGTGGGAGGAGGG + Intergenic
1063301312 10:4851358-4851380 CTCTGGGCAGAGAGGGCTAATGG + Intergenic
1063494477 10:6494269-6494291 CTGTTGGCAGGAAGCGAAGAGGG - Intronic
1063542784 10:6950951-6950973 CTATGGGCAGGGAGGGAGCTGGG + Intergenic
1063666168 10:8061936-8061958 GTCTGGGCAGGGTGGGGAGTGGG + Intronic
1063928417 10:11004028-11004050 CTCTGGGCAGGGGGAGACGAAGG - Intergenic
1063948365 10:11199507-11199529 GTCTGGGCTGGAAAGGAAGATGG + Intronic
1064265204 10:13820385-13820407 CTCTGGGCTGGGAAGGCAGGCGG + Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1065789225 10:29244338-29244360 GCCTGGGCTGGGAGGGAGGAAGG + Intergenic
1065795593 10:29304765-29304787 CTCAGGGCTGGGAGGCAGGAGGG + Intronic
1066448072 10:35502139-35502161 CTCTGCTCAAGGAAGGAAGAGGG - Intronic
1066658215 10:37713842-37713864 GGCTGGGGAGGGAGGGAAGTGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067060121 10:43073982-43074004 CACAGGGAAGGGAGGGAGGAGGG - Intergenic
1067145416 10:43690221-43690243 CTCTGGGCTGGGCCGGCAGAGGG + Intergenic
1067270516 10:44787815-44787837 CTCTGGGCATGGAGGAAGGTAGG - Intergenic
1067346075 10:45440057-45440079 AGCAGGGCAAGGAGGGAAGAGGG + Intronic
1067429977 10:46236497-46236519 GTGTGAGCTGGGAGGGAAGATGG - Intergenic
1067443668 10:46327314-46327336 GTGTGAGCTGGGAGGGAAGATGG + Intronic
1067568696 10:47356083-47356105 CACTGGGCAGGGAAGATAGATGG - Intronic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068040595 10:51819306-51819328 CCCTGGGCAGGATGGGAAAAGGG - Intronic
1069074488 10:64024072-64024094 CTCTCACCAGGGAGGCAAGACGG + Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069746805 10:70720260-70720282 AGCTTGGCAGAGAGGGAAGATGG + Intronic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070312263 10:75282348-75282370 TTCAGTCCAGGGAGGGAAGAGGG - Intergenic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1070543292 10:77432856-77432878 GAAGGGGCAGGGAGGGAAGAAGG + Intronic
1070646571 10:78205971-78205993 AGCTGGGCAGGGAGAGGAGATGG - Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071149770 10:82620392-82620414 CTCTCGGCAGAGAGGGGAGCTGG + Intronic
1071307049 10:84308848-84308870 CTCTGAGGAGGGTGGGCAGAGGG - Intergenic
1071319441 10:84438491-84438513 CTCTGGAAGGGCAGGGAAGAAGG - Exonic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071569688 10:86690228-86690250 CACTGGGAGGGGAGGGAAGGAGG - Intronic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1072189570 10:93068919-93068941 CTCTGGGCGCGGAGCGCAGAAGG - Intergenic
1072436867 10:95422004-95422026 CCCTTGGCAGCGAGTGAAGAGGG + Exonic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073404733 10:103287248-103287270 GACTGGTGAGGGAGGGAAGAAGG + Intronic
1073559704 10:104486449-104486471 CTCTGGGTAGGGAGAGACCAGGG + Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074866748 10:117548389-117548411 CTCTGGACAGCGAGGGCACAGGG + Exonic
1075623734 10:123946983-123947005 GTCTTGGGAGAGAGGGAAGAGGG + Intergenic
1076023024 10:127089678-127089700 CCCTGGGCAGGGCGTGGAGATGG + Intronic
1076460989 10:130647364-130647386 CCCTGGGCAGCGAGGGCAGAGGG - Intergenic
1076572295 10:131440807-131440829 CGGTCAGCAGGGAGGGAAGAGGG + Intergenic
1076594979 10:131619680-131619702 CTCTGAGCAGGGTGGGGAGGAGG + Intergenic
1076595202 10:131620788-131620810 CTCTGAGCAGGGTGGGGAGGAGG - Intergenic
1076714693 10:132357814-132357836 CTCTGAGCAGGGAGGGGACCAGG + Intronic
1076804711 10:132849662-132849684 CCCTGGGCTGAGAGTGAAGAAGG + Intronic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1076891858 10:133288615-133288637 CCCTGGGCAAGGAGGGGAGCTGG + Intronic
1077047297 11:552204-552226 CTCAGGGCCTGGAGGGAACATGG + Exonic
1077160208 11:1109243-1109265 CTCTGGTGAGGGAGGGCAGCAGG - Intergenic
1077259761 11:1610081-1610103 CGATGGGCAGGAAGGGAAGGCGG - Intergenic
1077337297 11:2011115-2011137 TTCTGGGCTGGGTGGGAAAAAGG - Intergenic
1077372905 11:2192025-2192047 GTCTGGGGAAGGAGGGAAGGAGG + Intergenic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077662903 11:4085038-4085060 ATCTGGGCTGGGAGGGAAAGAGG + Intronic
1078052131 11:7974957-7974979 AGCTTTGCAGGGAGGGAAGAAGG + Intronic
1078356963 11:10639649-10639671 ATCTGGGCAGGGAGGCAAGCAGG - Intronic
1078403240 11:11045826-11045848 CCCTGAGCAGGATGGGAAGAAGG - Intergenic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1079248205 11:18768865-18768887 CTCTTGGTGGGGAGGGAGGAAGG - Intronic
1079545171 11:21625379-21625401 TTCTGGGCAGGGAGAAAAGTGGG - Intergenic
1080041522 11:27764205-27764227 CTCTGGACATGGAGGGAATAAGG - Intergenic
1080042209 11:27770789-27770811 CTCTGGACAGCCAGGGAGGAAGG - Intergenic
1080240801 11:30125190-30125212 CTCTGGGCAGGTATGTCAGAGGG - Intergenic
1080384047 11:31800019-31800041 CTCTGGTCTGGGAGGAGAGATGG - Intronic
1081430408 11:42970480-42970502 CTCTTGAAAGGGAGGAAAGAAGG - Intergenic
1081534557 11:43987549-43987571 GTCTGGGAATGGAGGGAAGCAGG + Intergenic
1081571485 11:44294098-44294120 CCCTGGGCAGGGGAGGAAAAAGG + Intronic
1081651587 11:44827501-44827523 GCCAGGGCAGGTAGGGAAGATGG + Intronic
1083016302 11:59457644-59457666 CTCTGGGGAGGGGCGGAACAAGG + Exonic
1083297817 11:61724722-61724744 AGCTGGGCTGGGAGGGAATATGG - Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083403420 11:62440411-62440433 CTCGTGGCTGGGAGGGAGGAAGG - Intronic
1083418889 11:62542650-62542672 TCCTGGCCAGGGAGGGAAGAGGG - Intronic
1083426817 11:62592300-62592322 CTCAGGACAGGGAGGGACTACGG + Intergenic
1083593875 11:63909948-63909970 CTCTGGGGAGGAGGGGCAGAGGG - Exonic
1084091678 11:66882916-66882938 TTCTGGGCAGGGGGGGCAGAAGG + Intronic
1084580574 11:70020530-70020552 CACTGAGCTGGGAAGGAAGAGGG - Intergenic
1084800784 11:71542507-71542529 CTCTGTGCCGGGAGCCAAGAAGG + Intronic
1084955874 11:72691325-72691347 CCCTGGGCATGGAAGGAAGGAGG - Intronic
1084970344 11:72768126-72768148 CTGTGGGCTGTGAGGGTAGAGGG - Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085109311 11:73873624-73873646 CTCTGGCCAGGGAGGGACTGAGG - Intronic
1085214647 11:74818175-74818197 CCCTGGGAAGGAAAGGAAGAGGG + Intronic
1085512060 11:77093448-77093470 CTCTGGCCAGGAAGGGGAGAGGG + Intronic
1086124694 11:83338407-83338429 GACTGGGGAGGGAGGGAGGAAGG + Intergenic
1087271260 11:96114415-96114437 TTCTGAGTGGGGAGGGAAGAGGG - Intronic
1088671969 11:112150556-112150578 CACAGGGAAGGAAGGGAAGACGG - Intronic
1088917910 11:114241005-114241027 CTCTGGGCCAGGAGGAAACATGG - Intronic
1089134085 11:116235406-116235428 CCCTGTGCTGGGAGGGAAGGAGG + Intergenic
1089159890 11:116429274-116429296 CTCTGGCAAGGGAGGCAAGCTGG - Intergenic
1089218669 11:116852383-116852405 CTCTGGGCTGGGAGTCAGGAAGG - Intronic
1089460806 11:118652291-118652313 CTCTGGGCCAGGAAGGTAGAGGG + Intronic
1089623211 11:119734772-119734794 CTCAGGGCCAGGAGGGAACATGG - Intergenic
1090056301 11:123428022-123428044 CTATGGGCAGCTTGGGAAGAGGG - Intergenic
1090153056 11:124405296-124405318 CTTGGGGGAGGGAGAGAAGAGGG - Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090703427 11:129315977-129315999 CTCTGGGCAGGGCTGCGAGAGGG - Intergenic
1091078254 11:132641326-132641348 CTCTGGGCAAGGAGAGGAGGTGG - Intronic
1091097491 11:132837860-132837882 CCCTGAGCAGTGAGGGAGGAGGG - Intronic
1202820281 11_KI270721v1_random:66297-66319 TTCTGGGCTGGGTGGGAAAAAGG - Intergenic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1091983891 12:4891812-4891834 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1092947882 12:13473707-13473729 CTCTGGGGAGAGGAGGAAGATGG + Intergenic
1093084919 12:14856282-14856304 CAAAGGGCAGGGATGGAAGAAGG - Intronic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094210442 12:27884820-27884842 CTCTGGGGATGGAGGGCACAAGG + Intergenic
1094526115 12:31232388-31232410 CTCGGAGGAGGGAGGCAAGAGGG - Intergenic
1095982824 12:47982608-47982630 CCCTGGGGAGGGAGGTAAGAGGG + Exonic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1097765504 12:63522031-63522053 CTCTAGGCAGAAAGAGAAGAGGG + Intergenic
1098219371 12:68252448-68252470 CTCTGTGGAAGGAGGGAAGGAGG + Intronic
1100428605 12:94510174-94510196 CTCTGTGCATGGCGTGAAGAAGG + Intergenic
1100548876 12:95628226-95628248 CTCTGAGCAGGGAGTGAGGCAGG + Intergenic
1101351190 12:103930863-103930885 CTCCGGGCGGGGAGGGGGGAGGG - Intronic
1101574364 12:105983805-105983827 CTGTGGTCAGGGAGGGAATCAGG + Intergenic
1101727042 12:107396291-107396313 TTCAGTGCAGGCAGGGAAGAAGG - Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102273456 12:111560602-111560624 CACTGTACAGGGAGGGAAGAAGG + Intronic
1102579701 12:113878561-113878583 CTCAGGGCAGGGTGGTAAGGTGG - Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103054078 12:117804940-117804962 CTCTGGGCAGCAGGGAAAGATGG - Intronic
1103217948 12:119217821-119217843 GTCTGGTAAGGGAGGGAAGTAGG - Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103322844 12:120101870-120101892 GGCTGGGCAGAGCGGGAAGAAGG - Intronic
1103774168 12:123353161-123353183 TTTTGGGCAGGGAGTGAGGAAGG + Intronic
1103966244 12:124641722-124641744 CTCTGGGCAAGGAGGGAGCTAGG - Intergenic
1103979390 12:124726708-124726730 CCCTGGGCTGGAAGGGAGGAGGG - Intergenic
1104348992 12:128028661-128028683 CTGTGGGCAGGGCGGGAATGTGG + Intergenic
1104729259 12:131095993-131096015 CTCTGGGCAGGGCTGGGAGGCGG - Intronic
1104761138 12:131298291-131298313 CTCGGGGCTGGGAGGAAACAGGG + Intergenic
1104786802 12:131455468-131455490 CTCTGGACAGGGAGGGTTGGCGG + Intergenic
1104818638 12:131662501-131662523 CTCGGGGCTGGGAGGAAACAGGG - Intergenic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1104996952 12:132664220-132664242 CACTGGGCAGGAAGGAAGGAGGG - Intronic
1104996963 12:132664259-132664281 CACTGGGCAGGAAGGAAGGAGGG - Intronic
1105604717 13:21917376-21917398 CTCTGGGGAGGGAGAGAGGCTGG + Intergenic
1105612859 13:21984415-21984437 TTCTGGAGAGGGAGGGAAGGAGG + Intergenic
1105655002 13:22427182-22427204 GTCTGGGCAGGCAAGGATGAGGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1105945040 13:25181835-25181857 CTCTGGGCAGGGAGGCAGAGTGG + Intergenic
1106076282 13:26464065-26464087 CTCTGGCCAGGGCTGGAAGAGGG + Intergenic
1106286657 13:28323855-28323877 CTTTGGGGAAGGAGGGAACATGG + Intronic
1106559103 13:30833430-30833452 CTCTGGGAAGGAAGGAAAAAAGG - Intergenic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1107131852 13:36905020-36905042 CACTGAGCACTGAGGGAAGACGG + Intronic
1107285534 13:38786209-38786231 AGCTGGGAAGGGAGGAAAGATGG - Intronic
1107829628 13:44362848-44362870 GTTTGGGCAGGGAAGGAAAAAGG + Intergenic
1107966488 13:45602796-45602818 CTCAGAGCAGGGTGGGAAAATGG - Intronic
1108000911 13:45904913-45904935 GGCTGGTCTGGGAGGGAAGAAGG - Intergenic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1108550874 13:51542576-51542598 CTCTGGGCAGTGGAGGCAGATGG - Intergenic
1109047003 13:57425661-57425683 CTCTGGACAGGAATGGGAGATGG - Intergenic
1109136414 13:58656783-58656805 CTCTCAGCAGAGAGGGAAGCTGG + Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109883034 13:68506975-68506997 CTCTCGGCAGAGAGGGTAGCTGG - Intergenic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1110642669 13:77843523-77843545 CACTGGGCAGGGAGGTTAGTAGG - Intergenic
1110949378 13:81465182-81465204 CTCTGGGCGAGGAGCCAAGATGG - Intergenic
1110964920 13:81681577-81681599 TTCTGAGCAGGTAGGGAATAGGG + Intergenic
1112232794 13:97606498-97606520 TCCTGGAAAGGGAGGGAAGAAGG - Intergenic
1112761364 13:102696920-102696942 GGCAGGGCAGGGAGGGAACAGGG + Intergenic
1113233956 13:108248403-108248425 CTCTGTGGAGGGAGGGAGGGAGG + Intergenic
1113264416 13:108601684-108601706 CTCAGGGCAGGGTTGGAAGTTGG - Intronic
1113585669 13:111462510-111462532 CTCTAGGCTGGCAGAGAAGACGG - Intergenic
1113698327 13:112364588-112364610 ATCTGGGAAGGGAGGGAACAGGG + Intergenic
1113888126 13:113671667-113671689 CCCTCGGCTGGGAGGGATGAGGG + Intronic
1113952088 13:114077655-114077677 CGTTGGGCAGGGAGGGAGGGAGG - Intronic
1114523509 14:23352997-23353019 CCCAGGGGAGGGAGGGAAGGGGG + Intergenic
1114550722 14:23531431-23531453 AGCTGGGCAGGGAGGGCAGCAGG - Intronic
1115013408 14:28578782-28578804 CACTGGGGAGGGTGGGAAAAGGG - Intergenic
1116355586 14:43924727-43924749 CTCTCGGCAGTGAGGGAATGCGG - Intergenic
1116982943 14:51190537-51190559 ATCTGGGCAGGGAGGAATGAGGG - Intergenic
1117035450 14:51723309-51723331 CTTTGGGAAGGGAGGTATGAGGG + Intronic
1117066248 14:52015274-52015296 CTCTGAGCAGATGGGGAAGAGGG + Exonic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117736966 14:58777528-58777550 CCCTGGGCAGGGGTGGAAGCGGG - Intergenic
1117953928 14:61108296-61108318 GCCTAGGCAGGGAGGGAAGGTGG + Intergenic
1118324340 14:64771213-64771235 CCCTGGGCAGGGAGGCCAGGAGG - Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118361792 14:65063123-65063145 CTCTTGGAGGGGAGAGAAGATGG + Intronic
1118718923 14:68580092-68580114 CTCAGGGCAGGCAGGTAGGATGG - Intronic
1118771509 14:68945757-68945779 GTCTGGGCAGGCAGGGAGTATGG - Intronic
1118839792 14:69501713-69501735 TCCTGGGGAGGGAGGGCAGATGG - Exonic
1118845224 14:69543071-69543093 CTCAGGACAGGGAGGAAAGCTGG + Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1119506338 14:75176316-75176338 CGTGGGGCCGGGAGGGAAGACGG - Intronic
1119764978 14:77182294-77182316 CTCTGGGCTGGGACGGGAGGGGG + Intronic
1120077319 14:80173296-80173318 CTCTTGGCAGGGAAGGAAGCAGG + Intergenic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120723125 14:87908599-87908621 CTCTGGGCGTGGAGTTAAGAGGG + Intronic
1121145602 14:91579477-91579499 CTCTCGGCAGGAAGGGGAGTTGG - Intergenic
1121455896 14:94038727-94038749 CTACGGTCCGGGAGGGAAGATGG - Intronic
1121565116 14:94903596-94903618 CACTGGGCAGTGCAGGAAGAGGG + Intergenic
1121599739 14:95194455-95194477 CTCTGGGCTGGGGAGGAGGAAGG + Intronic
1121817500 14:96939874-96939896 CTCGGGCCAGAGAGAGAAGAAGG - Intergenic
1121933072 14:97990971-97990993 CACTGAACAGGAAGGGAAGATGG + Intergenic
1122029336 14:98901210-98901232 ATAAGGGCTGGGAGGGAAGAGGG - Intergenic
1122316776 14:100830111-100830133 CTCTGGGCCAGAGGGGAAGAAGG - Intergenic
1122652493 14:103233068-103233090 CTCTGGGCAGGCTGGGCACAGGG - Intergenic
1122874884 14:104659450-104659472 CTCTGGGCTGGGAAGGAGGGAGG - Intergenic
1122993620 14:105250543-105250565 CTTTGGGCAGGAGGGGATGACGG + Exonic
1123173958 14:106400307-106400329 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1123182167 14:106481241-106481263 ACCTGGGCAGGAAGGGAAGAGGG - Intergenic
1202944736 14_KI270726v1_random:15489-15511 ACCTGGGCAGGAAGGGAAGAGGG + Intergenic
1124607174 15:31178316-31178338 CTCCAGGCAGGAAAGGAAGACGG - Intergenic
1124955781 15:34359505-34359527 CACTGGGCTGGGAGGGAACAAGG - Intronic
1125200072 15:37095431-37095453 CTCTAGGGAGAGAGGGAGGAAGG - Intronic
1125242045 15:37586965-37586987 CTCTGGGGAGGGGTGGCAGAAGG - Intergenic
1125677258 15:41509081-41509103 CTCTGGGCTGATGGGGAAGATGG - Exonic
1126405818 15:48321475-48321497 TACTTGGCAGGGAGGGAATAGGG - Intergenic
1126457923 15:48884816-48884838 CTCTGGGAAGGGAAAGATGAGGG - Intronic
1127259789 15:57319533-57319555 CCCTGCGGAGGGAGGGAAGGAGG - Intergenic
1127353183 15:58172888-58172910 ATCTGAGCAGGGAGAGAAGGAGG - Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127646901 15:60967902-60967924 CTCTGTGGAGGCAGGGGAGATGG - Intronic
1127776890 15:62270645-62270667 CACAGGGCAGGGAGGGAGGTGGG + Intergenic
1127832769 15:62765392-62765414 CTGTGGGCCGGGAGGGATGCGGG - Intronic
1128218108 15:65948131-65948153 CCCTGGGCAGGGAGGGATGGTGG - Intronic
1128234177 15:66056240-66056262 TTCTGGGCCTGGAGAGAAGAGGG + Intronic
1128247050 15:66140253-66140275 CCCTGGGCAGGAAAGGAAAAGGG + Intronic
1128637088 15:69309586-69309608 CTCTGAGGAGGGAGGGGACAGGG - Intronic
1128689767 15:69714562-69714584 CTCTCGGAGGGCAGGGAAGAGGG + Intergenic
1129055118 15:72813849-72813871 CTCTGGGGAGCTAGGGAAGGAGG - Intergenic
1129460552 15:75698208-75698230 GTCTGGGCAGGCAGGGGTGAGGG + Intronic
1129724309 15:77893828-77893850 GTCTGGGCAGGCAGGGGTGAGGG - Intergenic
1129737626 15:77974941-77974963 CTCTAGCCAGGCAGGGGAGATGG - Intergenic
1129906484 15:79191169-79191191 CACTGGCCAGGTAGGGAGGACGG + Intergenic
1130253474 15:82315269-82315291 CTCTAGCCAGGCAGGGGAGATGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130796417 15:87214521-87214543 CTCTTGGGAGGGAGGGAGGGAGG + Intergenic
1130906045 15:88241530-88241552 CTCTGGGCTGGAAAGGAGGAGGG + Intronic
1131687992 15:94792042-94792064 AGCTGGGCAGAGAGGGAAGTTGG + Intergenic
1132066096 15:98732498-98732520 GTCTGGGGAAGGAGGGAAGCTGG + Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132583685 16:696668-696690 CTTTGGGGTGGGAGGAAAGAAGG - Intronic
1133294848 16:4746670-4746692 GTCCCTGCAGGGAGGGAAGAGGG + Intronic
1134000237 16:10777161-10777183 CTCAGGGCAGGGGAGGAAAAGGG + Intronic
1134073275 16:11273614-11273636 CTCTGGGCAAGGAGGTGAGGCGG + Intronic
1134189666 16:12111475-12111497 TCCTGCGCAGGGAGGGAAGGAGG - Intronic
1134231131 16:12431229-12431251 GTCTGGGCAAAGGGGGAAGAGGG + Intronic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1135752885 16:25070922-25070944 CTCAGGGCAGGGAGAAGAGAGGG - Intergenic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1135943086 16:26839856-26839878 CTCTGGGAAGTTAGGGCAGAGGG + Intergenic
1136143608 16:28302452-28302474 CTCTGGGCAGGGTGTGAAGGGGG + Intronic
1136184219 16:28576245-28576267 CACTGGGCGGGGAGGGTAGGAGG + Intronic
1136284592 16:29233570-29233592 CTCAGAGCAGGAAGGGCAGAGGG + Intergenic
1136500061 16:30665541-30665563 CACTGGGCAGGGAGGGATCATGG - Intronic
1137055132 16:35742051-35742073 CTCTGCCCAGGAAGGAAAGAAGG + Intergenic
1137236615 16:46623427-46623449 AACTGGGCTGGGAGAGAAGATGG - Intergenic
1137515637 16:49141083-49141105 CACTGGGGTGGGAGGGAGGACGG - Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1138139147 16:54552167-54552189 CTCTGGGGAGGGAAACAAGATGG - Intergenic
1138351258 16:56347471-56347493 CTCTGGGCAGGGTGGGGTCAGGG - Exonic
1138416428 16:56874152-56874174 CTCTGAGCTGGGAGGGAATAGGG - Intronic
1138825682 16:60316488-60316510 CTCTGAGAAGGAAGGGAGGAAGG - Intergenic
1139293979 16:65883983-65884005 CTCTAGGCAAGGAGAGAGGAAGG + Intergenic
1139477922 16:67212133-67212155 CTCTGGGGAGAGGGAGAAGAGGG + Intronic
1139521741 16:67486704-67486726 CTCTGTGCAGGGAGGAGAAAGGG + Intergenic
1139546851 16:67653536-67653558 CCCGGGGGAGGGAGGGAGGACGG - Intronic
1139558614 16:67728107-67728129 GTCTGTGCAGGCTGGGAAGAGGG - Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1139782604 16:69364298-69364320 CTCAGGGAAGGGAGGGAGGGAGG - Intronic
1139958096 16:70702759-70702781 AGCTGGGGAGGGAGGAAAGAGGG + Intronic
1140557453 16:75938082-75938104 CTAGAGGAAGGGAGGGAAGAGGG - Intergenic
1140985684 16:80156287-80156309 CACTGGGCAAAGAAGGAAGAAGG + Intergenic
1141094883 16:81156078-81156100 ACCTGGGAAGGGAGGGAAGGAGG - Intergenic
1141464713 16:84197844-84197866 CTCTGGATGGGGAGAGAAGATGG + Intergenic
1141501473 16:84447416-84447438 TGGTGGGGAGGGAGGGAAGAAGG - Intronic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1141744318 16:85915357-85915379 CTCTGGGCAGGGGAGGAAATGGG + Intronic
1141766695 16:86063786-86063808 GCCTGAGCAGGGAGGGTAGAGGG + Intergenic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1142024451 16:87804971-87804993 CTCTGGGGAAGGAAGGATGACGG - Intergenic
1142089624 16:88203083-88203105 CTCAGAGCAGGAAGGGCAGAAGG + Intergenic
1142175602 16:88643617-88643639 CTCCGGGGAGGGAGGGAGGGAGG - Intronic
1142623371 17:1178792-1178814 CTCAGGGAAGGGTGGGGAGAAGG + Intronic
1142671280 17:1488389-1488411 CCCCGGGCGGGGAGGGAAGCGGG + Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1142864466 17:2782236-2782258 TTCTGGGCAGGGCCTGAAGAGGG + Intronic
1142865788 17:2790785-2790807 CTCGGGGCAGGACGGGAGGAAGG - Intronic
1142890450 17:2939681-2939703 CTCAGGGCAGGGATGGAGGGGGG + Intronic
1142959306 17:3542743-3542765 CTCTGGGCTGGGAGGGCCAAGGG - Intronic
1142964238 17:3571066-3571088 ATCTGGGCAGGTGGAGAAGAGGG - Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143084543 17:4405947-4405969 CGCTGGGCAGGGAGTACAGAAGG - Intergenic
1143327104 17:6106593-6106615 CTCTGGGGAGGGAAGGAGGATGG + Intronic
1143364380 17:6396310-6396332 GACTGGGCAGAGAAGGAAGAAGG + Intronic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144770733 17:17758019-17758041 CTCTGGAAAGGGAGAGATGAGGG - Intronic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1145279674 17:21458173-21458195 CTCAGGGCAGGGAAGAAGGAGGG + Intergenic
1145983105 17:29025926-29025948 GGCTGGGCAGGGGAGGAAGAGGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146465856 17:33086124-33086146 TTCTGGGCTGGGTGGGAAGTCGG - Intronic
1146526768 17:33573425-33573447 CTCTGAGGAGGGAAGGTAGATGG - Intronic
1146838042 17:36127869-36127891 GTATGTGCAGGGTGGGAAGATGG + Intergenic
1146936537 17:36815701-36815723 CTCTGGGCTGGGAGTCAAGGTGG + Intergenic
1147155401 17:38542207-38542229 CTCTGGGGAGGGAGGGACTAGGG + Intronic
1147163189 17:38579437-38579459 CTCTGGGGAGGGAAGGGAAAAGG - Intronic
1147323143 17:39657947-39657969 CCCAGGGGAGGGAGGGAGGAAGG - Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147362931 17:39942964-39942986 CCTTGGGGAGTGAGGGAAGATGG + Intronic
1147425893 17:40345707-40345729 CTCTGGGGAGGGAGGTTAGCAGG + Intronic
1147556767 17:41484618-41484640 CTTTGGGCAGGGGGGGCAGTTGG - Intergenic
1147717244 17:42516649-42516671 CCCTGGGCAGGGCGGGAGCAAGG + Intronic
1147996170 17:44361600-44361622 CTCTGGCCTGGGAGGGGAGGTGG - Intronic
1148071762 17:44912626-44912648 CTGTGGACAGGAAGAGAAGAAGG - Intronic
1148103366 17:45106210-45106232 CTTTGAGAAGGAAGGGAAGATGG + Exonic
1148226340 17:45900328-45900350 ATCTGGGCAGGCAGGGAACCTGG - Intronic
1148232050 17:45942415-45942437 CTCCGGCCAGGCAGGGCAGATGG - Intronic
1148465575 17:47863123-47863145 CTCTGGGCAGGAAAGGAGGATGG + Intergenic
1148468289 17:47877892-47877914 GTCTTAGGAGGGAGGGAAGAGGG - Intergenic
1148742032 17:49898405-49898427 AGCAGGGCTGGGAGGGAAGAGGG - Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148822456 17:50367499-50367521 ACCTGGACAGGCAGGGAAGAGGG + Intergenic
1148862660 17:50612726-50612748 TTCGGGGCAGGGAGGGAGGAAGG - Intronic
1148878762 17:50708789-50708811 CCCTGGGGAGGAAGGGAGGAAGG + Intergenic
1149028381 17:52056274-52056296 TTCTGTTCAGTGAGGGAAGAAGG + Intronic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1149866972 17:60156539-60156561 CACTGAGCAGGGAGAGAAGGTGG - Exonic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1150059989 17:62059363-62059385 TTCTTGGTAGTGAGGGAAGAGGG - Intronic
1150177061 17:63068967-63068989 ATTTGGGGAGGGATGGAAGAAGG + Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150292685 17:63990685-63990707 CTCTGGGCTGCCAGGAAAGATGG - Intergenic
1150295038 17:64002924-64002946 CTCTGGGGAGGGAGGGGGCAAGG + Exonic
1150836007 17:68564883-68564905 CTCCAGACAGGGAGGGGAGACGG + Intronic
1151155946 17:72123104-72123126 CTCTGGGTAGAGAGGGGAGCGGG - Intronic
1151337788 17:73450261-73450283 CTCTGTGCAGGGGTGGAAGCAGG + Intronic
1151582967 17:74990594-74990616 CCCAGGAGAGGGAGGGAAGAAGG + Intronic
1151660581 17:75516176-75516198 GGCTGGGCAAGGAGGGCAGAAGG - Intronic
1151671028 17:75571789-75571811 TGCTGGGCAGGGAGAGCAGAGGG + Intronic
1151680146 17:75618893-75618915 CTCTGGGCAGTGAGTGAAAAGGG + Intergenic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152094160 17:78263488-78263510 CCCTCGGCAGGGAGGACAGAGGG + Intergenic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152189008 17:78876857-78876879 CTCCAGGCAGAGAGGGGAGATGG - Intronic
1152271002 17:79324834-79324856 CTCTGGGCAGGCAGAGAAGCAGG + Intronic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152524456 17:80879510-80879532 TCCAGGGCAGTGAGGGAAGAAGG - Intronic
1152525809 17:80887653-80887675 CTCTGGGGTGGGAGAGAGGAGGG + Intronic
1152755813 17:82086557-82086579 CCCTGGGGAGGGAGGGAGGCAGG + Exonic
1152814590 17:82399904-82399926 CTCTGGGGAGGGAAGGGGGATGG + Intronic
1152898493 17:82926918-82926940 CTCTAGTCAGGGTGGGAAGTGGG + Intronic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1155680850 18:28483691-28483713 CTCTGAGCAGGGAAAGAAGTGGG + Intergenic
1156295367 18:35784527-35784549 CTCTTGGCAGGAAGGGGAAAGGG + Intergenic
1156370393 18:36467472-36467494 CTCTGCCCTGGAAGGGAAGAAGG - Intronic
1156395107 18:36692099-36692121 CTTTGGGCTGGCAGGGAAAAGGG + Intronic
1156398938 18:36723560-36723582 CTTTTGGCAGGGAGCGAGGAGGG + Intronic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157310169 18:46546803-46546825 CACAGGGGAGGGAAGGAAGATGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157386221 18:47261492-47261514 CACTGGGCATGGAGGGGTGAAGG - Intergenic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1158799580 18:60890519-60890541 AGCAGGGCAGGGAGGGATGATGG - Intergenic
1158818410 18:61130393-61130415 CTCTGTGCAGGGACAGAACAGGG + Intergenic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1159841901 18:73407738-73407760 CTCTAGAAAGGGAGGGAAGGAGG - Intergenic
1160112032 18:76042142-76042164 CTATCGGAAGGGAGGGAGGAAGG + Intergenic
1160622111 18:80178897-80178919 TTCTGGGGAGGGAGTGAGGAAGG + Intronic
1160671781 19:368468-368490 CTCTGGGGAGGGAGGGAGGGAGG + Intronic
1160866985 19:1260424-1260446 CGCTGGGCGGGGTGGGAAGGAGG + Intronic
1161218172 19:3105075-3105097 CTCGTGGCAGGGAGGGAGGGTGG + Intronic
1161581622 19:5083800-5083822 CTCTGCACTGGGAGGGACGATGG - Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1162646663 19:12054985-12055007 CTCAGGGCAGGAGGGGAACAAGG + Intergenic
1162791738 19:13066535-13066557 CTGTGAGCAGGGAGGGAATGAGG + Intronic
1163318075 19:16555115-16555137 GGCTGGGCAGGGAAGGAAGCCGG - Intronic
1163350361 19:16773062-16773084 CAATTGGCAGGGAGGGTAGAGGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163633293 19:18427653-18427675 ATCTGGGCAGGGAGGGAGTGGGG - Intronic
1163738586 19:18996914-18996936 CTCTTGAGAGGGAGGGAGGAAGG + Intronic
1164591424 19:29509663-29509685 TGCTGTGCAGGGAAGGAAGATGG + Intergenic
1164828650 19:31303233-31303255 CTCTGGGAAGAGACTGAAGATGG + Intronic
1165103920 19:33457438-33457460 CTGTGGGCTGGCAGGGATGAGGG + Intronic
1165335314 19:35165811-35165833 CACTGGGAAGGGAGTGAAGGAGG + Intronic
1165473754 19:36017812-36017834 CTCTGGGCCGGGAGGCAGGCAGG - Intronic
1165729444 19:38135361-38135383 CTCCGGGCAGGGTAGGAAGGTGG - Intronic
1165773349 19:38390514-38390536 ACCTGGGGAGGGAGGGGAGAGGG + Intronic
1165797134 19:38525930-38525952 GTCTTGGCAGGGAGGGAAGGAGG - Intronic
1165828479 19:38718996-38719018 CTCTGGGAAGGGATGGGAGGTGG - Intronic
1166012284 19:39951359-39951381 CTAAGGGCAGGGTGGGAAGCAGG - Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
1166371504 19:42303822-42303844 CTCTGGGGAGGAAGAGGAGAAGG + Intronic
1166547318 19:43640969-43640991 GTCTGGGCGGGGAGGGGGGAGGG - Intergenic
1167152722 19:47719162-47719184 GTCTGGGCAGGCAGGAAGGATGG + Intronic
1167153227 19:47722267-47722289 CATGGGGCGGGGAGGGAAGAAGG - Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167292268 19:48630759-48630781 CACAGGGCAGGAAGGGAACAGGG + Exonic
1167477869 19:49711475-49711497 ATCTGGGCAGAGAGGGTACAGGG - Intronic
1167776305 19:51559909-51559931 CTCTGGACATGGTGAGAAGATGG - Intergenic
1168184752 19:54692570-54692592 GGCTGGGAAGGGTGGGAAGAGGG + Intronic
1168607223 19:57769818-57769840 CTCTGGGCGGGGGGGGAACGCGG - Exonic
1168705628 19:58468769-58468791 GTCTGGTCAGGGAGGGCAGAGGG + Intronic
925140108 2:1544264-1544286 CTCTGGGCAGTGAAGGGAGGTGG + Intergenic
925149902 2:1607721-1607743 GTCTGGGCAGGCAGAGAGGAAGG + Intergenic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925878261 2:8329966-8329988 TTCTGGGCACAGAAGGAAGATGG + Intergenic
926217635 2:10915183-10915205 CTCTGTGCTGGGAGGGAGGTGGG + Intergenic
927025782 2:19067681-19067703 TTCTGAGCCTGGAGGGAAGAGGG + Intergenic
927202273 2:20585143-20585165 CTCTGGACAGAGTGGGAGGAGGG - Intronic
927207508 2:20619407-20619429 CTCTGGGCAGGATGGGTGGAGGG - Intronic
927209148 2:20628008-20628030 GGAGGGGCAGGGAGGGAAGAGGG + Intronic
927655625 2:24943070-24943092 CTGTGACCAGGGAGGAAAGATGG + Intergenic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927884999 2:26712925-26712947 CTCTGGGCTGGCAGGGAATTTGG - Intronic
927968561 2:27288306-27288328 CTCTGGATAGCCAGGGAAGAGGG + Intronic
928398343 2:30960255-30960277 CTCTAATCAGGGAGGGAAGCAGG + Intronic
928606461 2:32947964-32947986 CTCTGGGCGCCGCGGGAAGAGGG + Intronic
928997452 2:37308528-37308550 CTCTGGGTGGGGAGGGAGGTGGG - Intronic
929044062 2:37773550-37773572 CTCTGGGCAGGGAGGGGCCAAGG - Intergenic
929133702 2:38602890-38602912 CTCCGGGCAGGGAGCGGAGACGG - Exonic
929335495 2:40739232-40739254 CCCTGGGCAGTGAGAAAAGATGG + Intergenic
929436499 2:41932527-41932549 CGCTGGGGAGGGAGGGAGGGAGG + Intergenic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929552991 2:42906091-42906113 CTCTAGGCAGAGGGGAAAGAAGG + Intergenic
929779570 2:44949191-44949213 CTAGGGGCAGGGACGGAAGAGGG - Intergenic
929888371 2:45898778-45898800 CTCTGAGGAGGGAGTGGAGAAGG + Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
930053644 2:47235915-47235937 GGCTGGGCAGGGAGTGAAGGAGG + Intergenic
930065521 2:47324653-47324675 CCCTGGGCAGTGAGGGGAGGAGG - Intergenic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930799297 2:55425940-55425962 CCCTGGGCAGGGAGGGGGCATGG + Intergenic
931232100 2:60383607-60383629 CGTTGGGGAGGGAGGGAACACGG - Intergenic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932702441 2:74001120-74001142 CACAGGGCAGGGAGGGAGGCAGG - Intronic
932795504 2:74692018-74692040 CACTGGGCCAGGAGGGAAGCTGG + Intergenic
933420961 2:82044144-82044166 CTCTAGGCATTGTGGGAAGAGGG - Intergenic
933654003 2:84872533-84872555 CTAGAGGGAGGGAGGGAAGAAGG + Intronic
933721602 2:85400801-85400823 CTCTGGGGAGGCAGCCAAGATGG - Intronic
934118525 2:88818187-88818209 TTCTGGGCAGGGAGGGATCCTGG - Intergenic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
935701092 2:105812568-105812590 CCTTGGTCAGGGAGGGAGGAGGG + Intronic
935756073 2:106276937-106276959 CCATGGGCAGGTTGGGAAGAGGG - Intergenic
936018836 2:108979636-108979658 CCCTGGGTAGGGAGGCAGGAGGG - Intronic
936098226 2:109550702-109550724 TTCTAGGCAGGCAGGGCAGAAGG - Intronic
936162075 2:110091516-110091538 TTCTGGGCAGGGAGGGATCCTGG - Intronic
936182587 2:110279838-110279860 TTCTGGGCAGGGAGGGATCCTGG + Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937364208 2:121249086-121249108 CTCTGGGGAGGGAGGCCAGCAGG + Exonic
938202677 2:129388232-129388254 CTCTGCTCAAGGTGGGAAGAGGG + Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
938732815 2:134159735-134159757 CTCTGGGGCGGGAGTGGAGAGGG - Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
939501839 2:142996530-142996552 GTCTGGGCAGTGAAAGAAGAGGG + Intronic
939857466 2:147377478-147377500 CTATGGGGAGGAAGAGAAGAGGG - Intergenic
941235922 2:162973807-162973829 CACTGGGAAGGAAGGAAAGAAGG + Intergenic
941993042 2:171575722-171575744 CTCTGGGGAGGGAAGAGAGAAGG + Intergenic
942331359 2:174828048-174828070 CCCTGAGTTGGGAGGGAAGAGGG + Intronic
942335431 2:174879912-174879934 CACAGGGCATGAAGGGAAGATGG + Intronic
942402157 2:175614440-175614462 CTCTGGGCAGAGAGAGATGCAGG - Intergenic
942520029 2:176793919-176793941 CTCTGGGTAGGGAATAAAGAGGG - Intergenic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
945033515 2:205685675-205685697 CCCGGGGCAGGGAGGGAGGCAGG - Intronic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
945432892 2:209785479-209785501 CTCGGGGCTGAGAGGGAAGGAGG + Intronic
946121906 2:217523490-217523512 GCCTGGGAAGGGAGGGAAGCTGG + Intronic
946141921 2:217698665-217698687 TTCTGGAGAGGGAGGGAAGCGGG + Intronic
946372973 2:219291629-219291651 CCCGGGGCAGAGAGGGAAGATGG + Intronic
946415668 2:219538553-219538575 CTCTTGGCAGGGGGAGAGGATGG + Exonic
946680547 2:222210540-222210562 CTAGGAGCAGGGAGGGGAGAGGG - Intronic
946943726 2:224797727-224797749 TTCTCAGTAGGGAGGGAAGAAGG - Intronic
947565411 2:231190221-231190243 CGCTGGGCAGGGCTGGAAGTAGG - Intergenic
947885442 2:233566148-233566170 CACTGGGGAGGGAGGGGGGAAGG + Intronic
948049293 2:234967480-234967502 CTCCAAGCAGGCAGGGAAGATGG - Intronic
948119937 2:235522520-235522542 AGCTGGGGAGGGAAGGAAGACGG + Intronic
948155147 2:235775610-235775632 CTCGGGGCGGGGTGGGAGGAAGG - Intronic
948384776 2:237574705-237574727 CTCTGGACAGAGAGGAAGGAAGG - Exonic
948389403 2:237601261-237601283 CTCTGTGCAGGGTGAGAGGATGG - Intronic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948843514 2:240672101-240672123 CCCTGAGCAGGGAGGGGAGGTGG + Intergenic
948863697 2:240764883-240764905 CTCGGGGCAGGGTGGGAACTTGG - Intronic
948863827 2:240765570-240765592 CGCTGGGCAGGTAGGGGAGGGGG - Intronic
948864030 2:240766402-240766424 CACTGGGCAGGCAGGGGAAACGG + Intronic
948875358 2:240824076-240824098 CTCTGGGGAGGGAGGCAGCAAGG - Intergenic
1169214502 20:3785518-3785540 CACGGTGCCGGGAGGGAAGAAGG + Exonic
1169494385 20:6100431-6100453 CTCAGGGCTGGGAGGGTAGGAGG + Intronic
1170119053 20:12892697-12892719 CTCTGGGAAGGAAGGGACCATGG - Intergenic
1170698970 20:18686008-18686030 CACTGGGAAGGGAAGTAAGAAGG - Intronic
1171010135 20:21505167-21505189 GTCTGAGGAGGGAGGGGAGAAGG + Intergenic
1171187568 20:23133718-23133740 CACTGGTTAGGGAGGGAGGAAGG + Intergenic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171324903 20:24282719-24282741 ATATTGGCAGGGAGGGCAGAGGG + Intergenic
1171412944 20:24958736-24958758 CACGGGGCAGGGAGGGGAGTGGG + Intronic
1171908565 20:30921258-30921280 CTTTGGGAAGCGAGGGAAGGTGG - Intergenic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172299999 20:33842710-33842732 TACAGGGCTGGGAGGGAAGAGGG - Intronic
1172773335 20:37393874-37393896 CTCTGAGCAGGGACAGAAGGAGG - Exonic
1172786025 20:37469484-37469506 CTCTGGGAAGCAAGGGAGGAGGG - Intergenic
1172838167 20:37886318-37886340 CTCTGGGCTGGGAGGCGGGATGG + Intergenic
1173460992 20:43243281-43243303 CACTGGGCAGCGAGGGCAGATGG + Intergenic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173586654 20:44187517-44187539 ATCGGGGAAGGGAGGGGAGAGGG + Exonic
1173614661 20:44394903-44394925 CTAAGGACAGGGAGGGAGGAAGG + Intronic
1173686119 20:44924430-44924452 GTCTGGGCTGGAGGGGAAGAGGG + Intronic
1173854486 20:46241256-46241278 ATCTGGGTAGGCAGAGAAGAAGG + Exonic
1173904177 20:46613793-46613815 CTCAGGGCAGAGGGGGAAGGAGG + Intronic
1173934837 20:46852194-46852216 CTCTGGGCTGGGAGAGGACATGG + Intergenic
1174327369 20:49790035-49790057 CTCTGGTCGGGGAGGGAAGTAGG - Intergenic
1174339430 20:49886731-49886753 CCCTGAGCAGGGAGGAAAGGCGG - Exonic
1174362488 20:50037736-50037758 CTCAGGGCTCGGAGGGAAGGGGG - Intergenic
1174456917 20:50655353-50655375 CGCTGGGCAGGGGGACAAGAAGG - Intronic
1174461248 20:50684502-50684524 CTCTGGGCAAGGTGGGACCAGGG + Intronic
1174875238 20:54220801-54220823 CCCTGGTCAGGGAGTGAAGTGGG - Intronic
1175427885 20:58881475-58881497 GTCTGGAGAGGGAAGGAAGAAGG - Intronic
1175813330 20:61870477-61870499 CCCTGACCAGTGAGGGAAGAAGG - Intronic
1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1176668279 21:9707674-9707696 TTCTGTGCATGGAGGGAAAAAGG + Intergenic
1176835995 21:13793864-13793886 CTCTGGGGACGGAGAGCAGAGGG + Intergenic
1177905919 21:26970846-26970868 AGCTGGGGAAGGAGGGAAGAAGG - Intergenic
1180099687 21:45578841-45578863 GTCAGGGCAGGGAGGGACCAGGG - Intergenic
1180120965 21:45747819-45747841 CTCAGAGGAGGGAGGAAAGAAGG - Intronic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180836154 22:18930510-18930532 CCCTGGGCAGTGAGTGTAGAGGG + Intronic
1180994611 22:19959441-19959463 CACTGGGCCGGGAGGGACGCGGG - Intronic
1181086460 22:20441779-20441801 ATCTAGGCAGGGAGGAGAGAAGG + Exonic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181803285 22:25360741-25360763 ATCTGGGCAGTGAGTAAAGAGGG - Exonic
1181897177 22:26120528-26120550 CTATGGGCAAGGGGGAAAGAAGG + Intergenic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1182411351 22:30189636-30189658 CTCAGGGCAAGGAGGGAGCAAGG - Intergenic
1182595978 22:31420776-31420798 CTCTGGGCAGGAATGGAAGAGGG + Intronic
1183136023 22:35888625-35888647 CTCATGGCAGAAAGGGAAGAGGG + Intronic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183700715 22:39449459-39449481 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1183706258 22:39476493-39476515 CTCTGGCCATCCAGGGAAGATGG + Intronic
1183728145 22:39600778-39600800 CCCTGGGCTGGGAGGAATGATGG + Intronic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1184067397 22:42128496-42128518 CTCTGGGCAAGGAGAGAGGGTGG - Intronic
1184147300 22:42619190-42619212 CTCTGGCTAGAGTGGGAAGAGGG - Exonic
1184262804 22:43329090-43329112 CACTGGCATGGGAGGGAAGAAGG - Intronic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1184366435 22:44054571-44054593 GGCTGGGCAGGGAGGGGACAGGG + Intronic
1185031582 22:48446289-48446311 CACTTGGCAGGGAGGAGAGAAGG - Intergenic
1185098316 22:48823572-48823594 CTCTGAGCTAGGAGAGAAGAGGG - Intronic
1185192348 22:49446904-49446926 CTCTGGGCGGAGAGGGGAAAGGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185336495 22:50272922-50272944 CACTGGGCAGTCAGGAAAGAAGG - Intergenic
1203286246 22_KI270734v1_random:155809-155831 CCCTGGGCAGTGAGTGTAGAGGG + Intergenic
949382216 3:3459003-3459025 CTCTGGGCACTGGAGGAAGATGG + Intergenic
949775328 3:7626185-7626207 TTCTGGGAGGGGAGGGACGAGGG - Intronic
949880837 3:8659442-8659464 CTCTGGGCAGGGGGAGATCAGGG - Intronic
949987431 3:9552261-9552283 CTCTTGGCAGGTAGGGGAGGGGG - Exonic
950423503 3:12912267-12912289 GGCTGGGCTGGGAGGGGAGAGGG + Intronic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
950640272 3:14344091-14344113 CCAGGGGCAGGGAGGGAGGAAGG + Intergenic
950654059 3:14425709-14425731 CTCGGGGCAGGGAGGGTGGAAGG + Intronic
950750373 3:15123558-15123580 ATGTGGGCAGGCAGGGCAGATGG + Intergenic
951706085 3:25545711-25545733 TGCTGGGCAGGGAGGAGAGAGGG - Intronic
952094949 3:29939672-29939694 ATCTGTGCAGGAAGAGAAGAAGG - Intronic
952548768 3:34451106-34451128 GTCTGGGGAGGGAGCCAAGATGG - Intergenic
952947323 3:38487062-38487084 CACCTGGCAGTGAGGGAAGATGG + Exonic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953545295 3:43859912-43859934 CCCAGGGCAGGGAGGGAGAAGGG + Intergenic
953636618 3:44670161-44670183 CTGAGGGCAGGTGGGGAAGAGGG + Intergenic
954462988 3:50638264-50638286 CCCGGTGCAGGGAGGGAGGATGG + Intronic
954519747 3:51214261-51214283 CTTGGGGCTGGGAAGGAAGATGG + Intronic
954881087 3:53836402-53836424 CCCTGGGGAGGAAGGGAAGGTGG - Intronic
955527447 3:59836013-59836035 CTATGGGGAGTGAGGGAAAATGG - Intronic
955694032 3:61617639-61617661 CTCTGGCAAGGAAGGCAAGAGGG - Intronic
955695584 3:61632805-61632827 CCATGGGCAGGGAGGGGAGGGGG - Intronic
955913126 3:63878842-63878864 CCCAGAGCAGGGAGGGAACAAGG + Intronic
955945219 3:64187394-64187416 AGTTGGGAAGGGAGGGAAGAAGG - Intronic
956556411 3:70528227-70528249 ATCTGGGTAGGGGGTGAAGAAGG - Intergenic
956786408 3:72646285-72646307 CTCAGGGAAGGGAGATAAGAAGG + Intergenic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959672918 3:108999337-108999359 ATGGGGGCAGGGAGGGAATATGG + Intronic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
961088377 3:124089731-124089753 GTCAGGGCAGTGAGGGAGGATGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961415284 3:126752460-126752482 CCTTGGGCAGGGTGGGGAGAAGG + Intronic
961666804 3:128497821-128497843 CTCTGGGGAGATAGGGAAAATGG - Intergenic
961749735 3:129088125-129088147 AACTGGGCTGGGAGAGAAGACGG - Exonic
961787776 3:129357917-129357939 CCCAGGGCAGGGAGGGGACAGGG + Intergenic
962715665 3:138124161-138124183 CTCTTGGCGGGGTGGGCAGAGGG - Exonic
963066106 3:141265873-141265895 CTCAGAGCAGGAAGGGAAGTGGG + Intronic
963378828 3:144503834-144503856 CTCTCAGCAGAGAGGGGAGATGG + Intergenic
963550097 3:146709380-146709402 GTATGGGAAGGGAGGGAGGAAGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963851124 3:150211368-150211390 AGGTGGGCAGGCAGGGAAGAAGG + Intergenic
964239061 3:154570107-154570129 CTTTGGGCAGGGATGGCAGGGGG + Intergenic
964421671 3:156510438-156510460 CTCGGGGCTGGGAAGGAAGAGGG - Intronic
964923313 3:161925239-161925261 CTCTTGACAGGGTGGCAAGAGGG - Intergenic
965731542 3:171777442-171777464 CTCTGGGCAATTAGGAAAGAAGG - Intronic
965853644 3:173062285-173062307 CACAAGGCAAGGAGGGAAGAAGG - Intronic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
966946610 3:184781244-184781266 GTCTGGGCAGGAAGTGAAGGGGG + Intergenic
967130807 3:186469195-186469217 CTTGCAGCAGGGAGGGAAGATGG - Intergenic
968702954 4:2065331-2065353 CCTTGGGCTGGGTGGGAAGAGGG + Exonic
968815352 4:2818755-2818777 CTCTGGGCAGGGAGGGGTCAGGG - Intronic
969222774 4:5772316-5772338 CTCTTTGCAGGGAGGTAAGATGG - Intronic
969237298 4:5874600-5874622 TGCTGGGCAGGAGGGGAAGAGGG + Intronic
969643453 4:8412798-8412820 CGCAGGGCAGCGAGGGAGGATGG - Intronic
969858958 4:10020968-10020990 CCCTGGGGAGGGTGAGAAGAGGG + Intronic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
970581512 4:17477908-17477930 CTCTGGTTAGGGAGGCATGACGG - Intronic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
971614066 4:28764638-28764660 GCCTGGGCATGGAGTGAAGAGGG - Intergenic
972805689 4:42527919-42527941 CTCTGGGGAAGGATGGGAGAAGG - Intronic
973334127 4:48938666-48938688 GCCTGGGCAGGCAGGGTAGACGG + Intergenic
973619442 4:52712442-52712464 CGCGGGGCGGGGAGGGAAGCAGG - Intergenic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
975219607 4:71799264-71799286 CGCTGAGCTGGGAGGCAAGAAGG - Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976576347 4:86676851-86676873 GACTGGGCAGAGAGGGTAGAGGG + Intronic
978415683 4:108473603-108473625 CTCTGGGTAGGAAGGCAAGGGGG + Intergenic
978879505 4:113684649-113684671 TTCTGGGCAGAAAGGCAAGATGG - Intronic
978919186 4:114161992-114162014 CCCCAGGCAGAGAGGGAAGAAGG + Intergenic
979913836 4:126405174-126405196 CTCTGGGCATGGAGTGGGGATGG - Intergenic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
981117928 4:141013972-141013994 CTCAGGGGAGGGAGGGAATGGGG - Intronic
981495743 4:145390494-145390516 CCCTGGGAAGGAAGGAAAGAAGG + Intergenic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
983649004 4:170020285-170020307 CTCAGGGCAGGGAAGGAAAGGGG - Intronic
983981497 4:174002532-174002554 TACTGAGCAGGGAGGGAAGAGGG - Intergenic
984150472 4:176123818-176123840 CAATGTCCAGGGAGGGAAGAGGG - Intronic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
985406502 4:189643817-189643839 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
985627661 5:998228-998250 GACGGGGGAGGGAGGGAAGAGGG + Intergenic
985731322 5:1550579-1550601 CCCTGTGCAGGCAGGGACGAGGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986462808 5:7990493-7990515 CTCAGGGCTGGCAGGGAGGAAGG - Intergenic
986995762 5:13605383-13605405 CTTTGGGCAGCCAGGGCAGATGG - Intergenic
987373956 5:17217563-17217585 CACTGGGCAGGAAGGGGAGGGGG + Exonic
988219359 5:28322218-28322240 GTTTTGTCAGGGAGGGAAGAAGG + Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
990683863 5:58278009-58278031 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
992338562 5:75798758-75798780 CACTGTGCAGGGAGCCAAGATGG - Intergenic
993167972 5:84382615-84382637 CTCTTAGCAGGAAGGGAAGGGGG - Intronic
994188316 5:96839667-96839689 CTCTGAGCAGGGAGTGAAGGAGG - Intronic
995903145 5:117093446-117093468 GTCTGGGAAAGGTGGGAAGAGGG - Intergenic
996858958 5:128042926-128042948 GCCAGGGCAGGGAGGAAAGAAGG + Intergenic
996959077 5:129222461-129222483 CTCAGGGCAGGGCGGGGAGGGGG - Intergenic
997719920 5:136070100-136070122 CTCTGGGCTGGGAGGAAAGGGGG + Intergenic
999323798 5:150630717-150630739 GGCTGGGCAGGGATGGAGGAGGG - Intronic
999333262 5:150692865-150692887 CTCTGGGCTAAGAAGGAAGATGG + Intronic
999768323 5:154756562-154756584 CGCCGGGCGGGGTGGGAAGAGGG - Intronic
999973869 5:156891714-156891736 CTCTGTGCAGAGAGGAAATATGG + Intergenic
1000026197 5:157361323-157361345 CTCTGGGCCTGCAGGTAAGAGGG + Intronic
1000770504 5:165347440-165347462 TTCTTGACAGAGAGGGAAGAGGG - Intergenic
1001092120 5:168749414-168749436 CCCTGGGAAGGCAAGGAAGATGG - Intronic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001281442 5:170389156-170389178 CACGGGGCAGGGAGGGAGGCAGG - Intronic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1001566312 5:172701635-172701657 TTCTGGGGAGGGTGGGCAGAAGG + Intergenic
1001840323 5:174870691-174870713 AACTGGGCAGGGAGAGAAGTAGG - Intergenic
1001919151 5:175586998-175587020 GTCTTGACAGGGAGGAAAGATGG + Intergenic
1001951451 5:175819562-175819584 CTCTGGACAGGGAGGGTCAAGGG + Intronic
1002027005 5:176402576-176402598 CTCATGGCAGGGAGGGAAGGGGG - Intronic
1002679649 5:180950683-180950705 CCCTGAGCTGGGAGGGAAGAAGG + Exonic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003460380 6:6323029-6323051 GACTGGGCAGGGAAGAAAGATGG - Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1003981995 6:11398480-11398502 CTCTGTGCAGGAGGTGAAGAAGG + Intergenic
1004116384 6:12771832-12771854 CTCTGGGGAGGGATAGAAGTTGG + Intronic
1004462235 6:15848404-15848426 TTCTGAGCAGGGAAGGAACAGGG - Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005419599 6:25635251-25635273 CTATGGGCTGGGAAGAAAGATGG - Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1005940767 6:30557563-30557585 CGCTGGGGAGGGATGGAAGTGGG + Intronic
1005997990 6:30943087-30943109 GCCAGGGCAGGAAGGGAAGAGGG + Intronic
1006067508 6:31472686-31472708 CTCTGCACTAGGAGGGAAGATGG - Intergenic
1006074907 6:31525984-31526006 CTCTGCATTGGGAGGGAAGATGG - Intergenic
1006098491 6:31671020-31671042 CCAGGGGCAGGGAGGGAGGAAGG + Intronic
1006554972 6:34858391-34858413 CTCTGGGGAGGGAGGGTATTAGG - Exonic
1006582820 6:35086636-35086658 CACTGGGCAGGAAGGGGATATGG - Intronic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1006679686 6:35788045-35788067 CTCTGGGTAGGGAGGAGAGCAGG - Exonic
1006745591 6:36339667-36339689 CCATGTGCTGGGAGGGAAGATGG + Intergenic
1007026255 6:38578138-38578160 CCCTGGCCAGGGAAGGTAGAGGG - Intronic
1007169434 6:39852330-39852352 CCCTGGACAGGGAGAGGAGAAGG - Intronic
1007178665 6:39913113-39913135 CTCTTGGAAGGGAGGGACGGGGG + Intronic
1007387208 6:41528096-41528118 AACTGGGCGGGGAGGGAAGTGGG - Intergenic
1007397387 6:41585544-41585566 CTCTGGGCAGGGGGTGAGGGCGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007610795 6:43147533-43147555 CTCAGGGCAGGGTAGGCAGAAGG + Intronic
1007726993 6:43922530-43922552 CCCTAGCCAGGGAGGCAAGAAGG - Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008043423 6:46827380-46827402 CTCTGGAGAGAAAGGGAAGATGG - Intronic
1008579877 6:52897416-52897438 CTCTGGCCAGGGTGGGCAGCAGG - Intronic
1008585973 6:52949685-52949707 CTCTGAGAAGGGAGAGAGGAAGG + Intergenic
1010732365 6:79404593-79404615 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1011899531 6:92275085-92275107 CTCTCAGCAGGAAGGGAAGCTGG + Intergenic
1012201491 6:96411701-96411723 CACAGATCAGGGAGGGAAGAAGG - Intergenic
1012579223 6:100844751-100844773 CTCAAGGTAGGGAGGGAAAAGGG + Intronic
1012815255 6:104016074-104016096 CTCTGTGCATGAAGGGAATATGG - Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1013190697 6:107802565-107802587 CTCGAGGGAGGGAGGGAGGAAGG + Intronic
1013510362 6:110839263-110839285 CTCTAGGCAAGGAGTGAAAAGGG + Intronic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1014206609 6:118662802-118662824 CTCTGTAGAGGGAGGGAGGAAGG + Intronic
1015354034 6:132255906-132255928 CTCTGGGCAGGGCGTGGAGAGGG - Intergenic
1015823208 6:137284445-137284467 GGCTGGGAAAGGAGGGAAGATGG + Intergenic
1015842987 6:137493274-137493296 TGCCGGGCCGGGAGGGAAGAGGG - Exonic
1016344789 6:143101498-143101520 CTCTGAGCAGGTAGAGATGAAGG + Intronic
1017056777 6:150443757-150443779 CTATGGGCAAGGCGGTAAGAAGG - Intergenic
1017720619 6:157240909-157240931 CCCTGGGGAGGGAGGGAGGGAGG + Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018033860 6:159865619-159865641 CACTGGGCAAGGAGGGGAAAGGG + Intergenic
1018181405 6:161226599-161226621 CTCTGAGAAGTGAGAGAAGATGG - Intronic
1018331123 6:162728032-162728054 CTAGGGGCGGGGCGGGAAGAGGG - Intronic
1018733863 6:166673021-166673043 CTCTGGGGAGGGCTGGGAGAGGG - Intronic
1019070931 6:169344297-169344319 CTCTGGGCAGGGCAGGAGGCAGG + Intergenic
1019301551 7:306754-306776 CTCCAGGCAGAGAGGGAACAAGG - Intergenic
1019302272 7:311846-311868 CTCCAGGCAGAGAGGGAACAAGG + Intergenic
1019323127 7:424605-424627 CTCGGGGCTGGGAGGGGAGAAGG + Intergenic
1019353876 7:568955-568977 CTCTGGGAGGGGAGGGTTGAGGG + Intronic
1019384456 7:746684-746706 CCCTGGGCAGGGTGGGCAGGGGG - Intronic
1019411425 7:908427-908449 CTCCGGGCAGTGAGGGGAGCAGG - Intronic
1019442221 7:1053153-1053175 CTCTGGGCACAGAGGCAAGCGGG + Intronic
1019519709 7:1455134-1455156 GTCTGGGCTGGGAGGGAGCAGGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020089736 7:5332538-5332560 CCCTAGGCTGGGAGGGGAGAGGG + Intronic
1020138000 7:5597127-5597149 CTTCGGCCAAGGAGGGAAGATGG + Intronic
1020883293 7:13791364-13791386 CTGTAGGCAGGCAGGAAAGAGGG - Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021929126 7:25562149-25562171 CTCTGGGCTGGCAGGGACGGGGG - Intergenic
1024004553 7:45215970-45215992 ACATGGGCGGGGAGGGAAGAGGG + Intergenic
1024119288 7:46220857-46220879 CCCTGAGGTGGGAGGGAAGAGGG + Intergenic
1024300650 7:47885088-47885110 CTCTGGGAAAGGAGGGCTGAGGG - Intronic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025081551 7:55987796-55987818 AGCTGGGCAGAGAGGGAATACGG + Intronic
1025175366 7:56798178-56798200 CTTTGGGAAGGCAGGGTAGAAGG - Intergenic
1025225403 7:57155906-57155928 CTCTTGGCAGGGAAAAAAGAAGG - Intergenic
1025696434 7:63778235-63778257 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1025913214 7:65844545-65844567 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1026011231 7:66638232-66638254 CTCTAAGCAGGAAGGAAAGAGGG - Exonic
1027519671 7:79189782-79189804 GTCAGGGGTGGGAGGGAAGAAGG - Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028431215 7:90749292-90749314 GACTGGGCATGGAGTGAAGAAGG - Intronic
1028584352 7:92438188-92438210 TTCTAGGCAGGGAGGGGAGTGGG + Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029379691 7:100204944-100204966 CTCAGGCCTGGGAGGGAAGTGGG + Intronic
1029507060 7:100968944-100968966 CTCTGGGCAGGGATGGGCCATGG + Intergenic
1029730406 7:102434494-102434516 CTCAGGGCAGTGAGGGCTGAGGG - Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1030209992 7:106986657-106986679 CTCTTTGCAGGCAGGGAAGATGG + Intergenic
1031838930 7:126713439-126713461 CTGTTGGCAGGTAGGGAACAAGG + Intronic
1031976247 7:128095410-128095432 CTGTGAGCAGGTGGGGAAGAAGG + Intergenic
1032201366 7:129825328-129825350 CGGGGGGCAGGGTGGGAAGAGGG - Intergenic
1032676027 7:134130281-134130303 CTCTGGGGGGGGGGGGAAGCTGG - Intronic
1033273627 7:139955252-139955274 CTCTGAGCAGTGACGGCAGAGGG - Intronic
1034062754 7:148108089-148108111 CTCTGGGGAGGGAGGAGACAGGG + Intronic
1034278110 7:149832923-149832945 GTCTGGGCAGGGAGGGGACGGGG + Intergenic
1034295891 7:149972161-149972183 CTCAGGGAAGGGCGGGAGGATGG - Intergenic
1034350392 7:150411348-150411370 CTCTGGGCAGGGTGAGAGGTCGG + Intronic
1034410906 7:150941689-150941711 CACATGGCAGGGAGGGGAGAGGG + Intergenic
1034801476 7:154058748-154058770 CTCAGAGCCGGGGGGGAAGAGGG - Intronic
1034802430 7:154062286-154062308 CTCAGAGCCGGGGGGGAAGAGGG - Intronic
1034810162 7:154124741-154124763 CTCAGGGAAGGGCGGGAGGATGG + Intronic
1034875831 7:154724221-154724243 CTCTGGGGAGGAGGGGGAGATGG - Intronic
1034968367 7:155404876-155404898 CACTGGGCAGGGGAGGAAGCAGG + Intergenic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035692098 8:1566979-1567001 CTCTGTGGAGGGAGAGGAGATGG - Intronic
1035705534 8:1671694-1671716 AGCTGGGCAGGGAAGGAGGACGG - Intronic
1035793178 8:2326215-2326237 CACTGGGCAGGGAGAGGAGGTGG + Intergenic
1035799626 8:2395490-2395512 CACTGGGCAGGGAGAGGAGGTGG - Intergenic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036579513 8:10061027-10061049 CTCTGGGCAGGATGCAAAGAGGG - Intronic
1036588860 8:10149449-10149471 GCCTGGGCAGGGAGGGCAGCAGG - Intronic
1036612629 8:10363263-10363285 AACTGGCCAGGGAGGGAATATGG + Intronic
1036656588 8:10681159-10681181 CTTGGCGCAGGGAGGGAAGGTGG + Intronic
1036988193 8:13560764-13560786 CTGTGGGGGGGGAGGGAAAAAGG + Intergenic
1037829695 8:22180165-22180187 CACTGGGCTGGGAGGTAGGATGG + Intronic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1038411259 8:27361559-27361581 GACTGGGCAGGGTGGGAAAATGG + Intronic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039096005 8:33886136-33886158 CTACAGGGAGGGAGGGAAGAGGG + Intergenic
1039415879 8:37393726-37393748 CTTTGGGAAGGGTGGGAAGCTGG - Intergenic
1039559741 8:38503658-38503680 GTGTGGGCTGGGAGGGAAAAGGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040506956 8:48057640-48057662 TTCTGGGGAGGGAGGGAAAGGGG + Intronic
1040547043 8:48406855-48406877 CTGAGGTCAGCGAGGGAAGATGG + Intergenic
1040551908 8:48444255-48444277 CTTTGGGCAGGGAGGGGCTATGG + Intergenic
1040737755 8:50531502-50531524 ATCTGGATCGGGAGGGAAGAAGG - Intronic
1041516135 8:58700699-58700721 CCCTGGGAAGGAAGGAAAGAAGG + Intergenic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042119876 8:65475133-65475155 AACTGGGAAGGGAGGGAGGAAGG + Intergenic
1042191796 8:66194551-66194573 CTCTGGTCGGGGAAGGAGGAAGG + Intergenic
1043148917 8:76688386-76688408 GGCTGGGAAGGGAGAGAAGAGGG + Intronic
1043537956 8:81226749-81226771 CTCCAGGCAAGGAAGGAAGATGG - Intergenic
1043614762 8:82112310-82112332 CTAGGGACAGGGAGGGAAGGAGG - Intergenic
1044613302 8:94115423-94115445 TCCTGGGCAGGGAGGCAGGAAGG - Intergenic
1044773215 8:95659526-95659548 ATCTGGGAACGGAGGCAAGAAGG + Intergenic
1045078955 8:98603749-98603771 GCCTGGGAAGGAAGGGAAGAAGG + Intronic
1045377592 8:101590615-101590637 CTCGGGGCTTGGTGGGAAGAGGG + Intronic
1045388255 8:101691102-101691124 CTCTCGGCAGGGAGGGGTGCAGG + Intronic
1046747650 8:117893513-117893535 ATTTGGGCAGTGAGGCAAGAAGG + Intronic
1047522309 8:125604442-125604464 CACTGGGGAGGCAGGGATGAAGG - Intergenic
1047744483 8:127834034-127834056 CTATGGGCAGGGAGGAACAATGG - Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048210401 8:132449939-132449961 CTCTGGACACAGTGGGAAGAGGG - Intronic
1048334052 8:133490094-133490116 CTTTGGGCAGAGAAGGAAGTTGG + Intronic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049172383 8:141169604-141169626 CTCTGGGGAGGGAGGGAGAGAGG - Intronic
1049437554 8:142594744-142594766 CTCCTGGCAGGGCGGCAAGATGG - Intergenic
1049470825 8:142774353-142774375 TTCTGGGCAGGGAGGGAAAGGGG - Intronic
1049543488 8:143218889-143218911 GTCTGGGCAGGGAGGGGGCAGGG + Intergenic
1049592037 8:143466961-143466983 CTAAGGCCAAGGAGGGAAGAAGG + Intronic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1049773013 8:144392424-144392446 GTCTGGGGAGGGAGGGAGGGAGG - Exonic
1049795106 8:144493633-144493655 TCCTGGGCAGGGAGGCCAGAGGG + Intronic
1051298961 9:15628034-15628056 CACTGGGGAGGGAGCCAAGATGG + Intronic
1051467660 9:17398915-17398937 TTTTTGGCAGAGAGGGAAGAAGG - Intronic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052067033 9:24034660-24034682 CTATGTCCAGGGAGGGAGGAAGG + Intergenic
1052974816 9:34402614-34402636 GCCTGAGGAGGGAGGGAAGAGGG + Intronic
1053165522 9:35841383-35841405 CTCTGTGCTGGGAGGGAGGGAGG - Intronic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053303312 9:36966819-36966841 CTCTGGTCAGGGAGGGAGTTGGG - Intronic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1053489697 9:38489232-38489254 CTCTGGGCAGGGAGTGCTGGGGG + Intergenic
1053583887 9:39436187-39436209 CTCTGAGCAGGAAGGGGAGCTGG + Intergenic
1054105468 9:60994931-60994953 CTCTGAGCAGGAAGGGGAGCTGG + Intergenic
1055757835 9:79573415-79573437 CTTTGGCCGGGGAGGGGAGACGG + Intronic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056601934 9:88053389-88053411 CTCTGCGCAAGGAGGGGAGGAGG - Intergenic
1056803740 9:89712444-89712466 CTCTGGCCGCGGAGGGAGGAGGG - Intergenic
1057191118 9:93088184-93088206 CACTGGGCAGGGGGGCCAGAGGG + Intergenic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057312475 9:93951002-93951024 CTCTGGGCAGTGAGGGCACCTGG - Intergenic
1057644073 9:96856460-96856482 CTCTGGGGAGGGCGGGAGAAAGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057841242 9:98487014-98487036 CTCAAGGAAGGGAGCGAAGAGGG + Intronic
1057971385 9:99561608-99561630 CCCTGGGGAGGGTGGGAGGATGG - Intergenic
1058824350 9:108761464-108761486 CTCTGGACTGGAAGGGAACATGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059541498 9:115134872-115134894 CCCTGAGCATGGAGGGAGGAAGG - Intergenic
1059898622 9:118896403-118896425 CTCTGGGCAGAGGGAGGAGATGG + Intergenic
1060474504 9:123976661-123976683 CACTGGACTGGGAGGAAAGAAGG - Intergenic
1060476859 9:123993462-123993484 CACTGGACTGGGAGGAAAGAAGG + Intergenic
1060656166 9:125374188-125374210 CTCTGGAGAGGGAGGGATGGGGG - Intergenic
1060745457 9:126127982-126128004 CTCTGGGCACTGAAAGAAGAGGG + Intergenic
1060784462 9:126439241-126439263 CTCTGGGCAGGGAGCTCACAGGG + Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1061152714 9:128837923-128837945 CTCTAAGCTGGGAGGGCAGAGGG - Intronic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1061889150 9:133608716-133608738 CTCCTGGCAGGGAGAGAAGGCGG + Intergenic
1061939394 9:133875963-133875985 CGCTGGGCAGTGAGTGAATAAGG - Intronic
1061943346 9:133894566-133894588 CTCTGTCCAGGGAGGCATGAGGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062181866 9:135195242-135195264 GTCTGAGCAGGGCGGGAGGAGGG + Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062254556 9:135614866-135614888 CCCTGGTCAGGGAGGGCAGAGGG - Intergenic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062694895 9:137868786-137868808 CTCTGGGCAGGTGGGGAAGGGGG + Intronic
1203771939 EBV:53932-53954 CTTTGGGCGGGGAGGGAAGCAGG + Intergenic
1203657587 Un_KI270753v1:13281-13303 TTCTGTGCATGGAGGGAAAAAGG - Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186239001 X:7546463-7546485 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1187018019 X:15349989-15350011 CTCGGGGCAGGGAAGGAGGCAGG - Intronic
1187146195 X:16639602-16639624 CACTGGGCAGTGGGGGAAGAGGG - Intronic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1188483077 X:30653726-30653748 CGCTGGGCAAGGAGGGAGGCCGG + Intronic
1189609000 X:42711473-42711495 CGCTGGAAAGGAAGGGAAGAAGG + Intergenic
1190032096 X:46983642-46983664 ATCTTTGCTGGGAGGGAAGATGG + Intronic
1190061153 X:47212526-47212548 CTCAGGACAGGGAAGGAGGATGG + Intronic
1190119754 X:47650395-47650417 CTCTGGGCCTGGAGGGTGGAGGG - Intronic
1190748218 X:53339246-53339268 ATCTGGTCAGGGTGGGAGGATGG + Intergenic
1190798894 X:53770454-53770476 ATCTGGTCAGGGTGGGAGGATGG + Intergenic
1191670626 X:63745267-63745289 CTCTGGGCCCTGAGGGTAGATGG + Intronic
1191729091 X:64314676-64314698 TGCTGGCCAGGCAGGGAAGAAGG + Intronic
1191953519 X:66619729-66619751 CTCTGGGCAAGTTGGGAAGTTGG - Intronic
1191955278 X:66637321-66637343 CTAGGGGCAGAGAGGGAACAAGG - Intronic
1192560908 X:72127370-72127392 ATCTGGGAAAGGAAGGAAGAGGG + Intronic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1193527515 X:82611903-82611925 CTCTGGGGAGGAATGGAAGGTGG + Intergenic
1194756034 X:97741193-97741215 CTCCAGAGAGGGAGGGAAGAGGG - Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195724420 X:107899459-107899481 CTTTGGGCTGGGAGGTAATAGGG + Intronic
1195933905 X:110107082-110107104 CCAGGGGCAGGGAAGGAAGAAGG + Intronic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197703849 X:129619549-129619571 CTTTGGCCAGGAAGGAAAGAAGG - Intergenic
1197926061 X:131647696-131647718 CACTGTGCAGAGAGGGAAAAGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198657921 X:138934983-138935005 CTGAGGGCAGGGGGAGAAGAGGG - Intronic
1198903502 X:141536182-141536204 CTCTGGGCAGGCAGTGAACCGGG - Intergenic
1200070071 X:153524856-153524878 ATCTTGGCGGGGAGGGAGGAAGG - Intronic
1200365449 X:155657649-155657671 CACTGGGCAGGGGAGGAGGATGG + Intronic
1202192993 Y:22263072-22263094 TTCTGGGCAGGGTGGGAACTTGG - Intergenic