ID: 905593654

View in Genome Browser
Species Human (GRCh38)
Location 1:39186903-39186925
Sequence AAGAAACAGAAATGTGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 555}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905593654 Original CRISPR AAGAAACAGAAATGTGGCCC AGG (reversed) Intronic
900680382 1:3913124-3913146 CAGGAACAGAAATGTCGACCAGG - Intergenic
901374205 1:8825951-8825973 AAGAGACAGAAGTGAGGCCACGG + Intergenic
901459809 1:9384701-9384723 AACAAGGAGAGATGTGGCCCTGG - Intergenic
901596862 1:10392188-10392210 AAGAAACAAAAATCTGGGCTGGG + Intergenic
901801409 1:11710194-11710216 AAAAAAAAGAAATGTGGGGCGGG + Intronic
901839014 1:11942374-11942396 AGGAAATAAAGATGTGGCCCTGG + Intronic
902369810 1:15998894-15998916 AAGAAAAAAAAATGTGGGCCAGG + Intergenic
903392893 1:22977190-22977212 AAGAAAGAAGAATGTGGGCCGGG + Intergenic
903686968 1:25139019-25139041 TTGAAACAGAAATGTTGTCCAGG + Intergenic
903696899 1:25214419-25214441 AAGAAAAAAAAATTTGGGCCGGG + Intergenic
903798338 1:25947309-25947331 AAGAAATAGAGATGTAGGCCAGG + Intergenic
904234252 1:29103960-29103982 AATAAAAAGCAATGTGGGCCGGG - Intronic
904517549 1:31067998-31068020 AAGAAACATAAAAGTAGCCTGGG + Intergenic
904653161 1:32021945-32021967 AAAAAAAAGAAATGTGCCGCTGG - Intronic
904817464 1:33216304-33216326 AAGAAACAGAAAAAAGGGCCGGG + Intergenic
905063651 1:35161373-35161395 AAAAAACAGAAATAGGGGCCAGG + Intergenic
905476550 1:38232715-38232737 AAGGAACAGAGATGAGGCTCTGG + Intergenic
905542487 1:38771523-38771545 AAAAGACAGAAATGTGGACTGGG + Intergenic
905593654 1:39186903-39186925 AAGAAACAGAAATGTGGCCCAGG - Intronic
905598648 1:39231093-39231115 GAGAAACAGAGATGTGGGCAGGG + Intronic
906223921 1:44105488-44105510 CAGAAACAGCAGTGTGGCCTGGG + Intergenic
906577410 1:46903293-46903315 AAGAAACAGGAACTTGGCCTGGG - Intergenic
906601655 1:47134903-47134925 AAGAAACAGAACAGAGGCCTCGG - Intergenic
906872038 1:49493655-49493677 AGGAAACTGAAATGTGGGCTGGG + Intronic
907911506 1:58831084-58831106 AAGAAACACCCATGTGCCCCAGG - Intergenic
907934871 1:59033083-59033105 AGGAAACAGAAATGAGTGCCGGG + Intergenic
908708049 1:66981927-66981949 AAGAAAGAGAAATGTTTCTCTGG - Intronic
908885374 1:68782249-68782271 AGGAGACAGAAATGTGGGTCAGG - Intergenic
909556682 1:76961583-76961605 GAGAAACTGAAATGAGGCCAGGG - Intronic
910813388 1:91261668-91261690 AAGAAACAGAAATCTGTAACTGG - Intronic
911208092 1:95113014-95113036 AAGAAAAAGAAATGTAGCTAAGG - Intergenic
911509833 1:98798040-98798062 AAGAAACAGAAAGGGAGCTCAGG - Intergenic
912335008 1:108853945-108853967 AAAAAAAAGAAATGTGACCAAGG + Intronic
912823283 1:112884226-112884248 AAGAAAAAGAAAAGCGGGCCAGG + Intergenic
913348766 1:117834529-117834551 AATAGACAGAAATGGGGCCGGGG - Intergenic
915329448 1:155100993-155101015 AATAAAAAGAAATATGGGCCGGG - Intergenic
915381683 1:155446897-155446919 TAGAAACTGAAATGTAGCGCCGG - Intronic
915837910 1:159192633-159192655 CAGCATCAGCAATGTGGCCCTGG + Exonic
916679755 1:167093596-167093618 AAGAAAAAGAAATGTAATCCTGG + Intergenic
916777017 1:167977197-167977219 AAAAAAAAAAACTGTGGCCCAGG - Intronic
917402812 1:174669807-174669829 AAGAAACAGAATAGAGGGCCTGG - Intronic
917477142 1:175378694-175378716 AAGAAGCAGACTTGTGGGCCTGG + Intronic
917547852 1:175991752-175991774 AAGAAACAGAAAGTTAGCCTAGG + Intronic
918086371 1:181248652-181248674 AAGAAACAGGAGCTTGGCCCAGG - Intergenic
918535791 1:185573037-185573059 ATGTAACAGAAATGTGGCCTTGG + Intergenic
919261062 1:195194693-195194715 AAAAAATATATATGTGGCCCGGG + Intergenic
919646650 1:200101726-200101748 AAGAAACAGAAAAGTCTACCAGG + Intronic
919750937 1:201037801-201037823 GAGAAATAGAAATGTGGACAAGG + Intergenic
920360462 1:205411873-205411895 AAGAAACACCCAGGTGGCCCAGG + Intronic
920577039 1:207069038-207069060 AAGAAAAAGAAATGTCGGCCGGG - Intronic
920746214 1:208631366-208631388 AAGAAACAAAAGTGAGTCCCTGG - Intergenic
921258388 1:213363151-213363173 AGGAAACAGACTTGTGTCCCTGG - Intergenic
921350762 1:214232149-214232171 AAGAAGCAGAGATGTTGGCCCGG + Intergenic
921827832 1:219693714-219693736 GAGAAGCAGAAGTTTGGCCCTGG - Intronic
921894447 1:220384961-220384983 AAAAAACAAAAATGTTCCCCAGG - Intergenic
922036583 1:221854129-221854151 AAGAGACAGAAATGTGCTCAAGG + Intergenic
922047797 1:221963621-221963643 AAGAAAAAGAAAAGTTGGCCAGG + Intergenic
922223734 1:223627823-223627845 GAGAAACAGAAATCTGGGCGGGG - Intronic
922426270 1:225498518-225498540 AAGAAATAGAATTGTGGCTCTGG - Intronic
922486577 1:225977699-225977721 AGGAAACAGCAAGGAGGCCCCGG + Intergenic
922546609 1:226462635-226462657 AAACAACAGAAATGTAGGCCGGG - Intergenic
922757522 1:228104857-228104879 AAGAAACAGAAATTTCCCACAGG - Intronic
923089608 1:230729864-230729886 AAGAAACAGGAAGGCGGCCTGGG + Intergenic
924122193 1:240812416-240812438 AGAAAAAAGAAATGTGGCACTGG - Intronic
1063442318 10:6082840-6082862 AAGAAACAGAAGTGTAGACTTGG - Intergenic
1063931258 10:11030532-11030554 AAGAAACAGAAGTGCGACCTCGG - Intronic
1064330780 10:14392038-14392060 AAGAAGCAGGAATGGGGCACAGG + Intronic
1065346167 10:24749874-24749896 AAGAAATAAAAATTTGGGCCGGG - Intergenic
1066789253 10:39044840-39044862 AAGAAACAGGAGTTTGGCCTGGG - Intergenic
1067695708 10:48534241-48534263 CAGCAAGAAAAATGTGGCCCAGG - Intronic
1068033547 10:51732218-51732240 AAGAAAAGGAAATTTGGGCCAGG - Intronic
1070212977 10:74346185-74346207 AAAAAACAGAAATTTTGGCCAGG - Intronic
1070230949 10:74566495-74566517 AAGAAAGAGAAAACAGGCCCAGG - Intronic
1071726781 10:88206396-88206418 AAGAGACAAAATTCTGGCCCTGG - Intergenic
1071779292 10:88825104-88825126 TAGAAACAGGAATGGGGCCATGG + Intronic
1072032968 10:91539022-91539044 AAAGAACACAAATCTGGCCCAGG - Intergenic
1072835437 10:98706462-98706484 AGGAGACAGAAATGTGGACAAGG + Intronic
1073389630 10:103163719-103163741 AAAAAACTCAAATGTGGGCCAGG + Intronic
1073854795 10:107661895-107661917 TAGTAACAGAAATCTGGCCTGGG + Intergenic
1074002166 10:109384143-109384165 AAGAAAAAGGATTGTGGACCAGG - Intergenic
1075317556 10:121465096-121465118 TTAAAACAGAAATGTGGTCCAGG - Intergenic
1075494754 10:122910346-122910368 AAGAAAAAGAAATGTGGGAAGGG - Intergenic
1076025840 10:127112440-127112462 ATGAAACAGAAATGGGGCATAGG - Intronic
1076042928 10:127266891-127266913 AGGAAGGAGAACTGTGGCCCTGG - Intronic
1076094314 10:127718672-127718694 AAGAAAAAGAAAAATGGGCCGGG + Intergenic
1076924235 10:133474015-133474037 AAGAACCAGAGACGTGGCCATGG - Intergenic
1077941027 11:6843573-6843595 AAGTGACAAAAATGAGGCCCTGG - Intergenic
1078070058 11:8102485-8102507 AGGAAACACAAATGGGGTCCAGG + Exonic
1078296843 11:10079950-10079972 AAGAAAAAAAAATGTGGGACAGG + Intronic
1078384622 11:10878454-10878476 ATGAAACAGATATATGGCCTTGG + Intergenic
1079010719 11:16826160-16826182 AAGGAAGAGCAATCTGGCCCAGG - Exonic
1079015911 11:16868513-16868535 AAGCAACACAGATGTGGTCCTGG - Intronic
1079444348 11:20545882-20545904 AAGACACAGAAATGTGGAGAGGG - Intergenic
1080517929 11:33040438-33040460 AAGAGCCAGAATTGGGGCCCAGG + Intronic
1080887907 11:36383275-36383297 AAGAAAAAGAAATACAGCCCTGG - Intronic
1080928967 11:36787452-36787474 ATGAAACACATATGTGGCTCAGG - Intergenic
1081489921 11:43559246-43559268 AAGAAAAAAAAATCTGGTCCTGG + Intronic
1082836842 11:57657415-57657437 AGGAAACAGAAGGGAGGCCCGGG - Exonic
1083431737 11:62616816-62616838 AAGAAACAGAGGGGTGGTCCGGG + Intronic
1083481774 11:62953045-62953067 AATAAAAAGAAATGGGGGCCGGG - Intronic
1083485177 11:62978967-62978989 AAGAAACAAGAATGGGGGCCCGG - Intronic
1083740728 11:64710201-64710223 AAGAAAAAGAAACGTGAGCCAGG - Intronic
1083804686 11:65066777-65066799 AAGACAAAGAAATGGGGTCCTGG + Intronic
1083907270 11:65681234-65681256 AAAAAAAAAAAATGTGGGCCGGG - Intergenic
1084499352 11:69525604-69525626 GAGAAACAGCAACGAGGCCCTGG - Intergenic
1084745367 11:71166776-71166798 AAAAAAAAGAAGTGTGGGCCCGG - Intronic
1084957715 11:72700097-72700119 AAGAAACAGAAATGGGAATCTGG + Intronic
1085459508 11:76685020-76685042 AAGGGACAGAGATGTGGCCCTGG - Intergenic
1085706291 11:78789252-78789274 GAGAAACAGACAGGTGGGCCTGG - Intronic
1086405402 11:86495082-86495104 AAGCAACAGAAATTAGGCACAGG + Intronic
1086665684 11:89479017-89479039 AAAAAAATGAAATGTGGCCAAGG + Intronic
1086813032 11:91334761-91334783 AATTAACTGAAATGTGTCCCTGG - Intergenic
1086919891 11:92574297-92574319 AAGAGACTGAAATGTGTCCATGG + Intronic
1086923236 11:92611688-92611710 AAGAAATAGAAGGGTGGGCCAGG - Intronic
1087214407 11:95479898-95479920 AAGATAGAGAAATATGGCCCAGG + Intergenic
1087681034 11:101218712-101218734 AAGAAACAGGAGCTTGGCCCAGG + Intergenic
1087784291 11:102337590-102337612 AAGACAGAGAAATGTGTCCCTGG - Exonic
1087907009 11:103709968-103709990 GAGAAAAAGAAATATGGCCAAGG - Intergenic
1088886184 11:114008870-114008892 AAAAAAAAAAAATGTGGGCCAGG - Intergenic
1089080956 11:115775897-115775919 AAGACACAGAGATGGAGCCCTGG - Intergenic
1089195524 11:116692178-116692200 AAGAAGCAGGATTCTGGCCCTGG + Intergenic
1090099464 11:123778807-123778829 AAAAAACAAAAATGAGCCCCAGG - Intergenic
1090171457 11:124609855-124609877 AAGATACAGAAATGTGGTGTGGG + Intergenic
1090357416 11:126149394-126149416 CAGAAACAGAAAAGTGTCCCAGG + Intergenic
1090542745 11:127727086-127727108 AACAAACAAAATAGTGGCCCTGG + Intergenic
1090824400 11:130374156-130374178 AAGAAAAAGATATATGTCCCAGG + Intergenic
1091033608 11:132213716-132213738 AAAAAAAAGAATGGTGGCCCAGG - Intronic
1091326354 11:134691450-134691472 CTGAAACAGAGCTGTGGCCCAGG - Intergenic
1091517683 12:1200851-1200873 AAGAAAAGGAAATGTGGGCCGGG - Intronic
1092150634 12:6245947-6245969 TTGAACCAGAAATGTGTCCCAGG - Intergenic
1094480125 12:30874954-30874976 AAGAGCCTGAAATGTGCCCCTGG - Intergenic
1095119220 12:38394726-38394748 AAAAAAGAGACATTTGGCCCTGG - Intergenic
1095921500 12:47535965-47535987 AGGAAAGAGAAATGCGGCCCTGG + Intergenic
1096491243 12:52014359-52014381 AATAACCAGAAATGTGGCTGCGG - Intronic
1096988090 12:55775181-55775203 AAGAAATAGAAATGTGTGGCTGG - Intronic
1097087467 12:56478995-56479017 AAAAAAAAAAAATCTGGCCCAGG + Exonic
1097366872 12:58725288-58725310 AAGAAACAGAGATTTGGTCAAGG + Intronic
1098407840 12:70144859-70144881 ATGGAACAGAAATATGGCCAAGG - Intergenic
1098422495 12:70315638-70315660 AAGAAACAGTAATGTGATTCTGG - Intronic
1099683675 12:85859518-85859540 AAAAAAAAAAATTGTGGCCCGGG + Intergenic
1101196820 12:102392177-102392199 AATAAAAAGAAATTTGGCTCTGG + Intergenic
1101798932 12:108003619-108003641 AAGGAACAGAGTTGGGGCCCAGG - Intergenic
1102202797 12:111069112-111069134 GAAAAAAAGGAATGTGGCCCTGG + Intronic
1102639121 12:114350935-114350957 AAGAAACACATTTGTGGGCCAGG - Intergenic
1103124468 12:118409438-118409460 AAGAAACAGAATTTTAGGCCGGG - Intronic
1103652618 12:122444613-122444635 AAGAAAAAGAAATGGGGGCTGGG - Intergenic
1103779865 12:123391184-123391206 AAGAAAAAGAAATGGGGTCAAGG - Intronic
1104488863 12:129176801-129176823 AAGAAATAGAACTCTGTCCCTGG + Intronic
1105721759 13:23123661-23123683 TAGAAACAGAAGTGTAGGCCAGG - Intergenic
1106195734 13:27492418-27492440 AAAAAACAGAAATTTAGGCCAGG - Intergenic
1107036460 13:35907456-35907478 TATAAAGAGAAATGTGGGCCAGG - Intronic
1107650889 13:42543516-42543538 AGCAAACAAGAATGTGGCCCCGG - Intergenic
1108238742 13:48438323-48438345 AAGAAAAAATAATATGGCCCTGG - Intronic
1108486328 13:50930054-50930076 AAGAAACAGAACTTTGGTGCTGG - Intronic
1110089313 13:71425070-71425092 ATGAAACTGAAGTGTGTCCCCGG + Intergenic
1110910398 13:80954322-80954344 AACATAAAGAAATGTGGCACAGG + Intergenic
1111282041 13:86039203-86039225 AGGAAACAGACAAGTGGGCCTGG - Intergenic
1111437027 13:88224487-88224509 AAAAAACAGAACTGTGGGCCTGG - Intergenic
1112187887 13:97145454-97145476 AAGAAAGAGAAAAGTGTCCAAGG + Intergenic
1112251909 13:97789416-97789438 AACAAACAGGAATGTGGTCTTGG + Intergenic
1112346338 13:98593171-98593193 AAAAAAAAAAAATGTGGGCCTGG - Intergenic
1113336760 13:109383890-109383912 AGGAAACAGAACTGTGGCAGTGG + Intergenic
1113984562 13:114303488-114303510 AAGAAGCAGAATTGTCGGCCCGG + Intronic
1114452246 14:22835088-22835110 AAGATTCAGATATGTGGTCCAGG + Intergenic
1114665268 14:24373882-24373904 AAGAGACAGAGACATGGCCCAGG - Intronic
1116419254 14:44713968-44713990 AAGGAACTCAAATGTGGCCCAGG + Intergenic
1116852182 14:49919456-49919478 AAAAAACACAAATATGGGCCGGG + Intergenic
1118289497 14:64506235-64506257 AAGAAACAGGAAACTGGGCCGGG + Intronic
1119019395 14:71094769-71094791 AAGAAACAGAAATATTAGCCAGG + Intronic
1119360489 14:74045027-74045049 CAGAAACAGAAAGGTTGGCCGGG - Intronic
1119373609 14:74169210-74169232 TAGAAAAAGAAATGTGGACTGGG - Intronic
1119613662 14:76084185-76084207 GAGAATCAGAAATGAGGCTCTGG - Intronic
1119818046 14:77588703-77588725 AAAAAAAAAAAATCTGGCCCAGG + Intronic
1120014632 14:79456951-79456973 CATAAGCAGAAATGTGGCCACGG + Intronic
1120722316 14:87902506-87902528 AAGAAACTGAAGTTTGGCCACGG - Intronic
1121160044 14:91729696-91729718 TAGAAAAAGAGATGTGGCTCAGG + Intronic
1121340144 14:93100160-93100182 CAGAGACAGGTATGTGGCCCAGG + Intronic
1121591634 14:95118033-95118055 ATTTAATAGAAATGTGGCCCAGG + Intronic
1124639689 15:31389833-31389855 TAGAGAAAGAAATGTGCCCCTGG - Intronic
1125214298 15:37252629-37252651 AAGAAACAGAAATACAGCCTGGG - Intergenic
1125586986 15:40827984-40828006 AAGAAACGAAAATGTAGCTCCGG + Intronic
1126050006 15:44676760-44676782 AAGGGACAGAAATGAGGCACAGG + Intronic
1126205690 15:46042360-46042382 AAGAAAGTGAAATGAGGCCCGGG - Intergenic
1126860311 15:52876742-52876764 AAGAAGCACATATGTGGCCGTGG - Intergenic
1126892759 15:53223647-53223669 AAGTTACAGAAACATGGCCCGGG - Intergenic
1127139157 15:55956107-55956129 AAAAAAAAGAAATGTGGGCTGGG - Intronic
1128352351 15:66899626-66899648 AAGAAAAAGAAATGGAGGCCAGG - Intergenic
1129058957 15:72845195-72845217 AAGAAAGAAAAATGTGGCAAGGG - Intergenic
1129553355 15:76477285-76477307 AAGATACAGGAATGTGACCAAGG - Intronic
1129557909 15:76532495-76532517 AAGAAAGAGGAAAGTAGCCCTGG - Intronic
1129747719 15:78036516-78036538 AGGAGACAGCAATGTGGCCAAGG + Intronic
1130157595 15:81365375-81365397 AAGAAACAGAAAAAAGGGCCGGG + Intronic
1130330480 15:82918443-82918465 AGGACACGGAAATGAGGCCCTGG - Intronic
1130793871 15:87187969-87187991 AAGAAGAAAAAATGTGGGCCAGG + Intergenic
1131095783 15:89653570-89653592 AAGAAAAAGAAAGATGTCCCTGG - Intronic
1131978690 15:97973550-97973572 AAAAAACAAAAACGTGGCCTTGG + Exonic
1132524002 16:405326-405348 AAGCCACAGAATTGTGTCCCAGG - Intronic
1133326526 16:4945390-4945412 AAGAAAAAGGAATGTGGCCCAGG - Intronic
1133480173 16:6162408-6162430 AAAATACAGAAATCTGGGCCAGG - Intronic
1134146046 16:11763402-11763424 ATGAAACAGTAATTTGGGCCTGG - Intronic
1137596808 16:49729401-49729423 ACCAAACAGATATGTGACCCCGG + Intronic
1140921621 16:79543656-79543678 AAGAAAAAGAAAAGAGGGCCTGG - Intergenic
1141159167 16:81617640-81617662 AAGAAAGAGGAAAGTGACCCAGG - Intronic
1141208245 16:81952018-81952040 AACAAACAGAAATGTGGTGTGGG + Intronic
1141345951 16:83246030-83246052 AAGAAATAGGAATTTGGGCCAGG - Intronic
1141516193 16:84546972-84546994 AAGAAACATAAGTGGGGCTCGGG + Intronic
1141533771 16:84664741-84664763 AAGTAACAAAAACCTGGCCCGGG - Intronic
1141866729 16:86755471-86755493 CAGAGGCAGAAATGTGGACCAGG - Intergenic
1141956835 16:87377860-87377882 AAAAAACAGAAATCTAGGCCAGG + Intronic
1142765983 17:2064648-2064670 AAGAAAGGGAAGTGTGCCCCAGG + Intronic
1143286895 17:5796862-5796884 AAGAAAAAGAAATATGGCAGAGG - Intronic
1143389662 17:6552742-6552764 AAGAAAAAGAAAGGTGGCCAGGG - Intronic
1143454366 17:7056649-7056671 AAGCAACAGAAATTTGAGCCAGG - Intergenic
1144024991 17:11269677-11269699 AAGAAACAGAACTGTTGTTCTGG + Intronic
1144480081 17:15621873-15621895 AAAAAAAAAAAATGTGGCCTTGG + Intronic
1144963266 17:19058950-19058972 AAAACACAGAAATGTAGGCCGGG + Intergenic
1144964424 17:19067090-19067112 ACAAAACAGAAATGTAGGCCGGG - Intergenic
1144971893 17:19115575-19115597 AAAACACAGAAATGTAGGCCGGG - Intergenic
1144983543 17:19185083-19185105 AAAAACCAGAAATGTAGGCCGGG + Intergenic
1144984682 17:19193156-19193178 AAAAACCAGAAATGTAGGCCGGG - Intergenic
1145098909 17:20057144-20057166 AAAAAACAGAAAGGTTGGCCGGG + Intronic
1145987077 17:29054281-29054303 AAGAGACAGAAATATGGCTGGGG + Intronic
1146618839 17:34380279-34380301 AAAAAGCACAAATGTGGTCCAGG + Intergenic
1147433988 17:40395448-40395470 AAGAAACAGAAAAGAGAACCAGG - Exonic
1148372986 17:47114957-47114979 AAGAAAGAGAAATGTAGGCTGGG - Intergenic
1148906396 17:50915142-50915164 AGGAACCAGCAATGGGGCCCAGG - Intergenic
1149434522 17:56621788-56621810 AAGAAACAGAAAGGTGCAACTGG - Intergenic
1150315387 17:64164709-64164731 AAGAAAAATAAAAGTGGCCTAGG + Intronic
1150498228 17:65625599-65625621 AAGAAACAGATGTGGGGCCAAGG - Intronic
1150595901 17:66604245-66604267 AAGAAAAAAAAAAGTGGCCTGGG + Intronic
1150979469 17:70125340-70125362 AAAGGACAGAAAAGTGGCCCAGG + Intronic
1151485300 17:74395202-74395224 TAGAAACACAAATCTGGTCCTGG + Intergenic
1151946229 17:77321386-77321408 AAAAAAAAAAGATGTGGCCCTGG - Intronic
1151981460 17:77512439-77512461 AGGACACAGAAATCTGGACCAGG - Intergenic
1152764921 17:82131133-82131155 AAGAAAAATAAATGTAGGCCAGG + Intronic
1153199983 18:2638091-2638113 AAGAAACAGAAATTTAGCCCGGG + Intergenic
1153643749 18:7176469-7176491 CAGAACGAGAAATGTGGGCCGGG - Intergenic
1153671424 18:7415856-7415878 CAGATACAGAAATTAGGCCCCGG - Intergenic
1157181024 18:45498266-45498288 AAAATACAGAAATGTGTTCCCGG - Intronic
1157364304 18:47049387-47049409 AAGAAACTGGAATGTGGGCTTGG + Intronic
1157811806 18:50702662-50702684 AGGAAACAGAAAAGGGGCCAGGG - Intronic
1159062563 18:63531345-63531367 GAGAAACACAGACGTGGCCCAGG - Intergenic
1159273800 18:66189217-66189239 AAGAAAAAGAAATGTTTCCGTGG + Intergenic
1160593811 18:79960954-79960976 AAGAAACAAAAAGGGGGCCCAGG - Intergenic
1160804333 19:985328-985350 AAAAAATACAAATGTGGGCCGGG - Intronic
1161392067 19:4026425-4026447 AAGAAAAAGAAATGTGGGATGGG - Intronic
1161588025 19:5115926-5115948 CAGAAAAAGAAAAGTGTCCCGGG + Intronic
1161636298 19:5391364-5391386 ATGAAACAGAAAGGAGGGCCAGG - Intergenic
1161658510 19:5530946-5530968 AAGCAACAGAAATGTGCTCCAGG + Intergenic
1161895832 19:7079533-7079555 AAGAAACAAAAAAATGGGCCGGG - Intronic
1162285637 19:9736712-9736734 AAGAAAGAGAAATCTGGTACAGG - Intergenic
1162288756 19:9762340-9762362 AAATAACAAAAATGTTGCCCAGG + Intronic
1162477250 19:10908029-10908051 AAGGAACAGAAATCTGGAACAGG - Exonic
1162914630 19:13867544-13867566 AACAAACAAAAATTTGGGCCAGG - Intronic
1163384611 19:16991864-16991886 AAACAACAGAACAGTGGCCCAGG + Intronic
1163465614 19:17466816-17466838 AGGAAACTGAGATGTGGACCAGG - Intergenic
1163480272 19:17551388-17551410 AAAAAAAAGAAATGTAGGCCGGG - Intronic
1163582049 19:18144901-18144923 AAGCAACAGCAAAGTGGCCAGGG + Intronic
1163614445 19:18318411-18318433 AAGAAAGGGCCATGTGGCCCCGG + Intronic
1163834765 19:19566427-19566449 GGGATACTGAAATGTGGCCCTGG - Intronic
1165241757 19:34474404-34474426 AAAAACCAAAAATGTGGGCCAGG + Intergenic
1165561113 19:36680810-36680832 AAGAGGCAGCAATGTGACCCCGG - Intergenic
1165989012 19:39795441-39795463 AATAAATTAAAATGTGGCCCGGG + Intergenic
1166344520 19:42156949-42156971 AAGCAACAGGCATGTGCCCCAGG - Intronic
1166398721 19:42462042-42462064 AAGAAGCAGAATTGTGGGCCAGG + Intergenic
1166839229 19:45686414-45686436 AAGAAACAGAAAAAAGGGCCGGG - Intergenic
1167324364 19:48814864-48814886 AAAAAACAGAAATCTGTCACAGG + Intronic
1167481918 19:49737910-49737932 AAGAAACAGAAAAATAGGCCGGG - Intergenic
1167620755 19:50559137-50559159 AAGAAAAAGAAAAGAGGGCCGGG + Intronic
1167771562 19:51523539-51523561 AAGGAAAAGAAATGTGCCCTAGG + Intronic
1167841609 19:52126230-52126252 ATTAAAAAGAAATGTGGGCCGGG + Intronic
1168218020 19:54940529-54940551 AAGTACCAGAAATGAGGGCCAGG + Intronic
1168229580 19:55021061-55021083 AAAAAAAAAAAAGGTGGCCCTGG + Intronic
1168350771 19:55674517-55674539 AAGGAACAGAGCTGTGGTCCTGG - Intronic
1168681961 19:58322582-58322604 AAGAACCATAAATATGGCCGTGG - Intergenic
925106636 2:1297696-1297718 AAGTGACAGGAAAGTGGCCCAGG + Intronic
925339604 2:3127015-3127037 AAACAACTGAAATGAGGCCCTGG + Intergenic
925371321 2:3347799-3347821 AAGAAACAGAAATGCGAGTCAGG + Intronic
925922700 2:8647848-8647870 AAGCAGCAGAAAGGAGGCCCTGG - Intergenic
926191647 2:10732675-10732697 AAGAAAAAGAAATGAAGGCCAGG + Intronic
926910417 2:17847782-17847804 AAGAAAGACAGATGAGGCCCTGG - Intergenic
928038280 2:27847538-27847560 TATAAACAGAAATGTTGACCAGG + Intronic
928318390 2:30263818-30263840 AAGAAAAAGAAATGTTGGCTGGG + Intronic
928375082 2:30767381-30767403 AAGAAATAGGAACGTGGACCTGG - Intronic
928952655 2:36826945-36826967 CAAAAACAGAGGTGTGGCCCTGG - Intergenic
929256603 2:39817680-39817702 AAGAGACAGAAATCAAGCCCTGG - Intergenic
929895610 2:45958212-45958234 AAGAAAAAGAAAATTGGGCCAGG + Intronic
929977804 2:46652315-46652337 GAGAAACAGGTGTGTGGCCCTGG + Intergenic
930044534 2:47157508-47157530 AAGAAAATGAAATGAGGCACAGG - Intronic
930703601 2:54483600-54483622 AAGCAACAGAAATCTGCTCCTGG - Intronic
930769356 2:55116219-55116241 AACAATTAGAAATGAGGCCCCGG - Intergenic
930889499 2:56366847-56366869 AAGAAGGAGAAATCTGGACCAGG - Intronic
931654952 2:64502470-64502492 AAAAAACAAAATTGTGGGCCGGG + Intergenic
931715011 2:65021925-65021947 AGGAAGCAGAAAAGTGCCCCAGG - Exonic
932578155 2:72973972-72973994 AAGTTACAGGAATGTGGTCCAGG + Intronic
933796541 2:85924540-85924562 AAGAAACAGTGGTGTGACCCTGG + Intergenic
935227679 2:101068231-101068253 AAGAATCACAAATGTGCCTCAGG + Intronic
935391947 2:102562129-102562151 AAGAAGCAGAAATGTGAGCTTGG + Intergenic
935562151 2:104570089-104570111 AAATACCAGAAATATGGCCCAGG + Intergenic
936092531 2:109510599-109510621 TAGGAACAGAAATGAAGCCCTGG - Intergenic
936279923 2:111129761-111129783 AAGAGACAGAAAGGTGGCTGTGG - Intronic
936863117 2:117045748-117045770 TAGAAATAGATAAGTGGCCCTGG + Intergenic
937052574 2:118904503-118904525 CAGAGACAGAAATTTGGCCTGGG + Intergenic
937106290 2:119317011-119317033 AAGGCACAGAACTGTGGCTCTGG - Intronic
937423053 2:121774529-121774551 CAGAAAAAGAAAAGTGGGCCGGG + Intergenic
937550666 2:123086125-123086147 AAGAATCAGTAATGTGACACAGG + Intergenic
937973520 2:127567252-127567274 AAGAAAAAGATATGGGACCCAGG + Intronic
938311276 2:130289765-130289787 CAGAACCTGAAATGTCGCCCAGG - Intergenic
939410518 2:141818829-141818851 AAGATACAGAAATGTTATCCAGG - Intronic
940480704 2:154227309-154227331 AAAAAAGAAAAATGTGCCCCAGG - Intronic
942125560 2:172821637-172821659 AAGACACAGGAATGAGACCCTGG - Intronic
942253776 2:174071221-174071243 AAGATACAGAAATGTTCCCCTGG + Intergenic
942844393 2:180405124-180405146 AAGAACCTGGAATCTGGCCCGGG - Intergenic
943977999 2:194508502-194508524 AAGTAACAGTAACCTGGCCCAGG + Intergenic
944055542 2:195518530-195518552 GGGAAAAAGAAATGTGGCCAAGG - Intergenic
944300495 2:198119448-198119470 AAGAAACAGAACTGAGGGCCTGG - Intronic
944799112 2:203219558-203219580 AAAAACCAAAAATGTGGGCCGGG + Exonic
945522249 2:210843393-210843415 AAGAAACAAGAATGTTACCCAGG + Intergenic
946811054 2:223526120-223526142 ATGAATCAGCCATGTGGCCCAGG - Intergenic
948036382 2:234861669-234861691 AAGCAACAGAAATGATGTCCAGG + Intergenic
948074516 2:235155633-235155655 AACAAAAAGAACTGTGGCTCTGG + Intergenic
948130183 2:235594867-235594889 AAAAAACAGCAATCTGGGCCGGG - Intronic
948307974 2:236963811-236963833 AGAAAACATAAATGTGGCCCTGG - Intergenic
949036534 2:241818184-241818206 AAGAAAGAGAAGTGAGCCCCCGG + Intergenic
1168856160 20:1010683-1010705 AAGCTACAGAAATGGGGTCCTGG - Intergenic
1169375894 20:5066372-5066394 AAAAAACAAAAATGTTGCCTGGG + Intergenic
1170796868 20:19555348-19555370 AAGAAACAAAACTGAGGCCAAGG + Intronic
1171050014 20:21849125-21849147 AAAAACCAGAAAAGTGGGCCAGG - Intergenic
1171126371 20:22605434-22605456 AAGAAACAGGATTTTGGGCCTGG - Intergenic
1171285110 20:23930468-23930490 AAAAAACAGAACTCTAGCCCAGG + Intergenic
1171314954 20:24182257-24182279 CAAAAACAGAAATATGTCCCAGG + Intergenic
1172726353 20:37045399-37045421 CATAAACATAAATGTGGGCCAGG - Intronic
1174001611 20:47378928-47378950 AGGAAACAGAAATATGTCGCAGG + Intergenic
1174396343 20:50249071-50249093 AAGAAAAGGAAATGTGGGTCAGG + Intergenic
1174679273 20:52389565-52389587 AAGAAACAGAAGAGTGGTCCAGG - Intergenic
1174788001 20:53450817-53450839 TAGAAAGAAAAATGTGGGCCAGG - Intronic
1175315920 20:58046596-58046618 AAAAATCAGAAATGTCTCCCAGG - Intergenic
1176302073 21:5103160-5103182 AAAAAAAGGAAATGTGGGCCGGG + Intergenic
1177708062 21:24735221-24735243 AAGAAAGAGAAATATGTTCCAGG + Intergenic
1178116727 21:29425519-29425541 AAGAAACAGAAGTGTGGGGGTGG + Intronic
1178284377 21:31312908-31312930 ATGATACAGAAATGTGTGCCAGG + Intronic
1178377069 21:32075552-32075574 AAGAAACCAAAGTGTGGCCGGGG - Intergenic
1179316171 21:40246219-40246241 AAGAAGCAGAAAAGAGGCTCTGG + Intronic
1179812855 21:43883467-43883489 AAGGAACAGAAATGGCTCCCGGG - Intronic
1179854956 21:44158740-44158762 AAAAAAAGGAAATGTGGGCCGGG - Intergenic
1180991161 22:19937325-19937347 AAGAAACAGAAGCTTGGCCTGGG - Intronic
1181967825 22:26668940-26668962 TAGAAAGAGACAGGTGGCCCTGG + Intergenic
1182007365 22:26972025-26972047 AAGAACCAGAAATGACTCCCAGG + Intergenic
1182282055 22:29223560-29223582 CAAAAAAAGAAATCTGGCCCTGG + Intronic
1182421642 22:30251323-30251345 AACAACCAGCTATGTGGCCCGGG + Intergenic
1182574498 22:31263804-31263826 TAGAGACAGGAATGTGGCCCAGG - Intronic
1182904494 22:33923180-33923202 AAGAAAGAAAAATGTGACCATGG + Intergenic
1183171957 22:36194883-36194905 AAGAAAAAGACTTTTGGCCCTGG + Intronic
1183178839 22:36244979-36245001 AAGAAGGAGAACTTTGGCCCTGG - Intergenic
1183404570 22:37624077-37624099 AAGAACCTGGTATGTGGCCCTGG - Intronic
1184721321 22:46315350-46315372 AAAACACAAAAATGTGGGCCAGG - Intronic
1185300381 22:50076918-50076940 AAGAAACAGAACTGTCACCCCGG + Intronic
1185359738 22:50398466-50398488 AAGAAATAGAGATGGGGGCCGGG - Intronic
949496799 3:4640090-4640112 AAGAAAGCCACATGTGGCCCTGG - Intronic
950989795 3:17420768-17420790 AGGAAACAGAAGTGTGTCCAGGG + Intronic
951554662 3:23909224-23909246 GAAAAACAGAAATGTGGGCCAGG + Intronic
951856877 3:27206938-27206960 AATAAATAGAAATGTTTCCCAGG - Intronic
952439185 3:33307457-33307479 AAGAAAAAAAAATCTGACCCAGG - Intronic
952507166 3:34017797-34017819 AACTATCAGAAATGTGGGCCTGG + Intergenic
952632609 3:35487654-35487676 AGGAAGCAGAAATGTGACCTTGG - Intergenic
952713548 3:36455246-36455268 AAGAAATAGAAATATTGCCCAGG + Intronic
952809877 3:37392252-37392274 GAGCATCAGAAGTGTGGCCCTGG + Intronic
953973747 3:47367257-47367279 AAGAAAAAAAAATGTTGACCGGG + Intergenic
954166170 3:48760060-48760082 AAAAAACAAAAATGTAGGCCAGG + Intronic
955885838 3:63597208-63597230 AAGAATAATAATTGTGGCCCTGG - Intronic
956624926 3:71257660-71257682 AAGAAAAAGAAATGGAGCCACGG + Intronic
956632105 3:71326917-71326939 TAGAAAGAGAAATGTGTACCAGG + Intronic
956902460 3:73730813-73730835 TAGGAACTGAAAGGTGGCCCTGG + Intergenic
957682645 3:83457468-83457490 GAGAAGCAGAACTGTGGCCCTGG - Intergenic
957999341 3:87731529-87731551 AAGAAAAAGAAATATGGCAAAGG - Intergenic
958192009 3:90195624-90195646 GAGAGACAAAAATGTAGCCCAGG - Intergenic
960123092 3:113967365-113967387 AAGAAAGAGAAATGTAGGCAAGG - Intronic
960591973 3:119375378-119375400 AAGAAAAGGCAATGTGGCCCTGG - Intronic
961056506 3:123793520-123793542 AAGAAAGAGAAAAGTGGCACAGG + Intronic
961397854 3:126609609-126609631 AAGAAATAGGCATGTGGCCAGGG + Intronic
961698336 3:128722360-128722382 AAAAAAAAGAAATGTGATCCAGG + Intergenic
962566701 3:136667788-136667810 AAAACACAGAAATGGGGCCAGGG - Intronic
962796643 3:138855349-138855371 ATAAAACAGAAATGTCGGCCAGG - Intergenic
963371936 3:144412180-144412202 AAGAAACAGAACTGTTGCTCAGG + Intergenic
964103756 3:153018153-153018175 AAAAAACAAAAATGGGGCCGGGG + Intergenic
964707007 3:159629713-159629735 TATAAACATAAATGAGGCCCAGG - Intronic
965126680 3:164639540-164639562 AATAAAAAGAAATGTTGGCCGGG - Intergenic
965316005 3:167191321-167191343 AAGATCCAGAAATGTGGCAATGG - Intergenic
965559240 3:170045837-170045859 AAGAACCAGAAATGAAACCCAGG - Intronic
966028321 3:175313767-175313789 AGGAATCAGAAAAGTGGTCCGGG + Intronic
966159866 3:176956313-176956335 AAGTTACTGAAATGAGGCCCTGG - Intergenic
967633572 3:191775558-191775580 AAGAAAAAGAAATGTGGGTCTGG - Intergenic
967704194 3:192630851-192630873 AAGAAAAAAAAAAGTGGGCCGGG - Intronic
967725445 3:192858144-192858166 AACAAACAAAAAAGTGGCCTTGG + Intronic
968149167 3:196323529-196323551 AAGAAGCTGAAATGAGACCCTGG + Exonic
968399411 4:279141-279163 AAAAAACAGACATGGGGGCCGGG + Intronic
969562955 4:7961072-7961094 AACAAACAGAAATGTGGTCTCGG - Intergenic
970585147 4:17508139-17508161 AATAATCAGATATGTGGGCCAGG + Intronic
972065270 4:34934987-34935009 AAGAAAAAAAAATGTGGCGTGGG - Intergenic
972324823 4:38005552-38005574 AAGAAACAGAGATATCCCCCAGG - Intronic
972607793 4:40630068-40630090 AAACAACAGGAATGTGGCACTGG - Intronic
973899999 4:55459610-55459632 AAGGAACAGTGATGTGGCCCGGG - Intronic
973983296 4:56325037-56325059 AAGAAAGATAAATGTGGGCCAGG + Intronic
974043708 4:56879581-56879603 AAAGAAAAGAAATGTGGACCGGG + Intergenic
974902560 4:68019306-68019328 AAGAAACAGAGGTGGTGCCCAGG + Intergenic
975210967 4:71699379-71699401 AAGAAGCAGCAATCTTGCCCTGG - Intergenic
975792999 4:77974798-77974820 AAGAAAGTGAAAAGTGGCCCAGG - Intergenic
976218192 4:82734174-82734196 AGGATGCAGAAATGTGGCACTGG + Intronic
977351475 4:95894211-95894233 AAGTGACTGAAATGAGGCCCTGG - Intergenic
977734777 4:100400343-100400365 AAAAAAAAAAAATGTGGCCTAGG - Intronic
978482006 4:109203454-109203476 AAGAAGAAGAAATGGGACCCAGG + Intronic
978648390 4:110970328-110970350 AGAAAAGAGAAATGTGGCCTGGG + Intergenic
978786606 4:112616539-112616561 AAGAAACACAATTATGGGCCAGG + Intronic
980255041 4:130368946-130368968 AAGAAACATATATGTAGGCCTGG + Intergenic
980905102 4:138940657-138940679 AAGAAAAAGAATTTTGGGCCGGG + Intergenic
980946221 4:139323023-139323045 AAGAAAAAGAAATCTGCCACAGG - Intronic
981308852 4:143276071-143276093 AAGAAACTGAAATGAAACCCAGG + Intergenic
981319602 4:143376013-143376035 AAGTAATAGAAATGTGGCTTTGG + Intronic
981828615 4:148974086-148974108 AAGAAAAAGAATTGTCGACCGGG - Intergenic
982300915 4:153878756-153878778 AAGAAACAGAAATATGAGTCTGG - Intergenic
983496526 4:168448541-168448563 AAGAAACAAAAATGTTGCTGTGG + Intronic
983927893 4:173421528-173421550 AAGACACTGAAAGGTGGGCCTGG + Intergenic
984794470 4:183645576-183645598 CAGAGACAGATATGTTGCCCAGG - Intronic
984854855 4:184186478-184186500 AAGAAAGAGAAATAAGGACCAGG + Intronic
985171763 4:187157685-187157707 AAGAATCAGAAATGTTGCTGAGG + Intergenic
985272131 4:188203619-188203641 AAGAAGCAGAATTATGGGCCGGG - Intergenic
985285280 4:188330771-188330793 AAGTATCAGAAGTGTGGGCCTGG - Intergenic
986423358 5:7606279-7606301 TAGAAAAATAAATGTGGCCCAGG + Intronic
988331363 5:29844777-29844799 TAGAAATAGAAATATGGGCCGGG + Intergenic
988446809 5:31295723-31295745 AAGAACCAGCAGTGTAGCCCTGG + Intronic
988451931 5:31352206-31352228 AAGAAAGAGAAAACTAGCCCAGG - Intergenic
988894013 5:35652036-35652058 AAGAAACACAAATTTGACCAAGG + Intronic
989112848 5:37924005-37924027 AAGGAACAGGAAGGTGTCCCAGG - Intergenic
989517788 5:42363501-42363523 AAGAAAAACAAATGTTGGCCGGG - Intergenic
989837341 5:46009046-46009068 AAGAAAGAAAAAGGGGGCCCAGG + Intergenic
990658945 5:57990826-57990848 GAGAAAGAGAAATGTTGCCCTGG - Intergenic
992635653 5:78723712-78723734 AAGAATCAGAAATCTAGGCCAGG + Intronic
992687743 5:79214788-79214810 AAGAAACACAACTGGGGGCCGGG + Intronic
993136286 5:83969311-83969333 AATGAAGAGATATGTGGCCCAGG - Intronic
993318495 5:86441996-86442018 AAGAACCAGAAATTGAGCCCAGG + Intergenic
993439532 5:87938347-87938369 AGGAGCCAGAAATGGGGCCCAGG - Intergenic
994324881 5:98436841-98436863 AAGTGCCAGAAATCTGGCCCTGG + Intergenic
995251365 5:109996921-109996943 AAGAAACAGAAATGTTTGTCAGG - Intergenic
996411018 5:123159260-123159282 AAGAGACAGATATTTAGCCCAGG - Intronic
996527509 5:124494323-124494345 AAGAAGCAGAAAGATGGCCTCGG + Intergenic
997184570 5:131868723-131868745 AAAAAAAAAAAATGTTGCCCAGG + Intronic
998237129 5:140407579-140407601 AAAAAAAAAAAATGTTGCCCAGG + Intronic
998238949 5:140425551-140425573 AAAAAACAGAAAAGAGGCCTGGG - Intronic
998301375 5:141024476-141024498 AATAAACAGAAATGTGGGGTGGG - Intergenic
998350274 5:141495770-141495792 GAGAAACAGAAAAGAGGTCCAGG - Intronic
998418923 5:141965983-141966005 AAAAAAAAAAAAAGTGGCCCAGG + Intronic
998550375 5:143071610-143071632 AGCAAAAATAAATGTGGCCCAGG + Intronic
998739297 5:145180567-145180589 AAGAATGTGAAATGTGGCCAGGG + Intergenic
999285993 5:150394619-150394641 AAGCAGCAGAAAAGTGGGCCTGG + Intronic
999845814 5:155478871-155478893 AAGAAACAGTGATGTGGACAAGG - Intergenic
999859093 5:155626028-155626050 GAGAAACTGACATTTGGCCCAGG + Intergenic
1000482488 5:161796504-161796526 AAGGAACAGCAATGTGTGCCTGG + Intergenic
1000913541 5:167051274-167051296 AATAAAAATAAATGTGGCACAGG - Intergenic
1002270504 5:178068687-178068709 GAGAAAGAGAAATGTGAACCAGG - Intergenic
1002396698 5:178962031-178962053 AAGAAACACAGATGTGTTCCAGG - Intronic
1003221476 6:4164601-4164623 AATAAACAGAGATTTGGCCTTGG - Intergenic
1003650201 6:7952250-7952272 AAGAAACAGCAATGAGGGGCAGG + Intronic
1003777469 6:9384992-9385014 AAGAAACAGAAGGGCCGCCCTGG + Intergenic
1004133977 6:12948973-12948995 AAGAAATAGAAAAATGGGCCAGG + Intronic
1004224727 6:13775092-13775114 AAGAAAGAAAAAAGTGGGCCTGG - Intergenic
1004383941 6:15155926-15155948 AATAAACAGAAATATGGGCCAGG - Intergenic
1005752597 6:28897086-28897108 GAGAAACAGAAAAGTGGATCAGG - Intergenic
1007499036 6:42281250-42281272 AGAAGACAGAAATGCGGCCCCGG + Intronic
1007598602 6:43067485-43067507 AAGAAATAGCAAAGTGGCCTGGG + Intronic
1008047781 6:46869054-46869076 CAGAAACAGAAATTGGGTCCGGG + Exonic
1010142389 6:72626218-72626240 AAGAAAAAGAAGTGAAGCCCGGG + Intronic
1010683807 6:78828223-78828245 AAGTAACATAAATGTGACACAGG - Intergenic
1011043636 6:83058242-83058264 AAGAACCAAAAATCTGTCCCAGG - Intronic
1012948808 6:105495858-105495880 AGAAAACAGAAATGAGGCACAGG - Intergenic
1013136704 6:107289393-107289415 AAGAAAAAGAAATGGAGGCCAGG + Intronic
1013620708 6:111885841-111885863 AAGAAACAGAAAGGAGGCCTGGG + Intergenic
1015357617 6:132297476-132297498 AGGAAACAGAAAAGAGGGCCAGG + Intronic
1016304977 6:142674527-142674549 AAAAATCAAAAATGTGCCCCAGG + Intergenic
1016357513 6:143234304-143234326 AAGAAAAAGTAATGTTGCTCAGG + Intronic
1018292163 6:162302843-162302865 AAGAAATATAAATGTGGCAGTGG - Intronic
1018423878 6:163663065-163663087 AAGGAACAGGAGGGTGGCCCGGG + Intergenic
1018593270 6:165451582-165451604 AAGAAGCAGAAAGATGGCCAGGG - Intronic
1018637840 6:165880085-165880107 AAGAAAAAGAAATGCTTCCCTGG - Intronic
1018666954 6:166147537-166147559 AAGAAACAGAAGATTGGGCCAGG - Intergenic
1019757115 7:2779165-2779187 GAGAAACAGCCATGTTGCCCAGG - Intronic
1020050750 7:5080078-5080100 AAAAAAAAAAAATGTGGGCCGGG + Intergenic
1020084865 7:5304802-5304824 AAAAAACAAAAATGAGGCACAGG - Exonic
1020200404 7:6075399-6075421 AAGAAAAAGTAATGTTGGCCGGG - Intergenic
1020690440 7:11348251-11348273 TAGAACCAGAAATCTGACCCAGG - Intergenic
1020806275 7:12794154-12794176 AATAAACAGAAATGTGGATAAGG + Intergenic
1021012911 7:15493668-15493690 GGGAAAAAGAAATGTGGGCCGGG - Intronic
1021613619 7:22480867-22480889 AAGAAACAGAAGCCTGGCGCAGG + Intronic
1022013492 7:26329179-26329201 CAGAAAGAGAGATGTGGGCCGGG - Intronic
1022740390 7:33114438-33114460 CAGAAAGAGAAATGTTGACCAGG - Intergenic
1023135822 7:37050393-37050415 AAGAAATAGAACTGGGGGCCAGG - Intronic
1023303199 7:38795557-38795579 AAGAATCACCAATGTGCCCCGGG - Exonic
1024410829 7:49039213-49039235 AATAACCAGAAATGTTACCCAGG + Intergenic
1024667285 7:51559519-51559541 CAGAAAAAGAAATGTGGGGCTGG + Intergenic
1024814460 7:53252820-53252842 ATGAAACAGAAAGGTGGCAGAGG + Intergenic
1025209441 7:57012397-57012419 AAAAAACAAAAATGAGGCACAGG + Intergenic
1025662505 7:63564457-63564479 AAAAAACAAAAATGAGGCACAGG - Intergenic
1026303024 7:69115459-69115481 AAGAAAAAGAACAGTGGTCCTGG - Intergenic
1026328844 7:69334744-69334766 CAGAAACAGGGATGTTGCCCAGG - Intergenic
1026772335 7:73210499-73210521 AAAAAACAGAAATGGGAACCAGG - Intergenic
1027013203 7:74763898-74763920 AAAAAACAGAAATGGGAACCAGG - Intergenic
1027074837 7:75182136-75182158 AAAAAACAGAAATGGGAACCAGG + Intergenic
1027119328 7:75505443-75505465 AAAAAACAGAATTGTGTCACAGG - Intergenic
1027424201 7:78046098-78046120 CAGAAATAGGAATGTGGGCCAGG + Intronic
1028101990 7:86832189-86832211 CAGAAACATTAATGAGGCCCTGG + Intronic
1028202833 7:87982445-87982467 GAGAGACAGAAATGTGGCTAAGG + Intronic
1028482856 7:91326704-91326726 AAGATACAAATATGTGGGCCTGG + Intergenic
1028606407 7:92660902-92660924 AAGAAACTGCAGTTTGGCCCTGG + Intronic
1028809618 7:95069256-95069278 AAGAATCAGAAATGTGGAGGGGG + Intronic
1029346933 7:99985494-99985516 AAGAGACAGAAATCTGCCCACGG + Intergenic
1029891015 7:103930656-103930678 AAGGTATAGATATGTGGCCCAGG + Intronic
1030140491 7:106299297-106299319 AAGAAATTGTAATGTGGGCCGGG + Intergenic
1030204793 7:106942374-106942396 AAAAAAAAAAAATGTGGGCCAGG - Intergenic
1031084825 7:117292069-117292091 AAGAAATAGAAAGCTGGCCAGGG - Intronic
1031349237 7:120708577-120708599 AAGAAACATTAATGTGGTCCTGG - Intronic
1031673140 7:124576572-124576594 AAGAAACGAAAATCTGGCCAAGG - Intergenic
1031924796 7:127629142-127629164 AAAAAAGAGAAATGTGGAGCAGG - Intergenic
1032308009 7:130754863-130754885 AAGGATCAGAAATGTGGTGCTGG - Intergenic
1033102027 7:138482104-138482126 AGGAAAAAAAAGTGTGGCCCTGG - Intronic
1033310312 7:140256465-140256487 AAAAAACAGAAATTGGGGCCGGG - Intergenic
1033332589 7:140428720-140428742 AAAAAAAAAAAATGTGGCGCAGG - Intergenic
1033783033 7:144695361-144695383 CAGAGACAGAAATATGACCCAGG + Intronic
1033806622 7:144961634-144961656 TAGAAACCAAAATGTGGGCCAGG + Intergenic
1034022034 7:147655106-147655128 AAGAAAAAGAAATATGGGCCAGG - Intronic
1035344736 7:158190688-158190710 GAAAAACACAAATATGGCCCAGG + Intronic
1035862195 8:3040967-3040989 AGGAAACAGAAATATGACACTGG - Intronic
1036009550 8:4706711-4706733 AAAAGACAGAGATGTGGCCGGGG + Intronic
1036118292 8:5985825-5985847 AAGAAACACAACTGAGGGCCGGG + Intergenic
1037702503 8:21287748-21287770 AAGAAGCATAAAAGTGCCCCAGG - Intergenic
1037771754 8:21805225-21805247 AAGAAACAGAATTGTAGACTAGG - Intronic
1037970080 8:23165463-23165485 AAGAAAAAAAAATGTGTGCCAGG + Intergenic
1038333820 8:26630544-26630566 ACAAAACTGAAATGTGGGCCAGG - Intronic
1038418715 8:27418073-27418095 AGGAATCAGAACTGAGGCCCTGG - Intronic
1039158603 8:34591549-34591571 AAGAAACAGACATATAGGCCAGG - Intergenic
1039914209 8:41847871-41847893 AAAAAATAGAACTGTGGGCCAGG + Intronic
1040641583 8:49340629-49340651 AAGAAAGAGAAATATGCCACTGG - Intergenic
1041105205 8:54436001-54436023 AAGAGAGAGAAATGTGGGCAAGG - Intergenic
1041798112 8:61768633-61768655 AACAAACAAAAATGTTGCCATGG - Intergenic
1042831427 8:73033432-73033454 AAGAAAAGGAAATGTAGGCCAGG + Intronic
1044367618 8:91367895-91367917 AAGGGACAGGAATGTGGCTCAGG - Intronic
1046335193 8:112776952-112776974 CCGAAACATAAATGTGGCTCTGG + Intronic
1046410613 8:113837907-113837929 AATAAACAGAAACTTGGCCGGGG + Intergenic
1046628773 8:116602981-116603003 AAGACAAAGAAATGTACCCCAGG + Intergenic
1047108946 8:121767212-121767234 ATGAAACATAAATGAGGCCCTGG + Intergenic
1048912388 8:139148342-139148364 CAGAAACAGAACTGTGGCTTGGG + Intergenic
1048939591 8:139386887-139386909 AAGATACAGAAATGTATCACAGG - Intergenic
1049375118 8:142285710-142285732 AAGGAACAGAAACGTGGGCCAGG + Intronic
1050015842 9:1233310-1233332 AAAAAAAAGAAATGTTGCCCAGG + Intergenic
1050128911 9:2389111-2389133 AAGAAAGAAAAATGAGGCCCTGG + Intergenic
1050204763 9:3184583-3184605 AAGAAAGATAAACATGGCCCAGG - Intergenic
1050368448 9:4896060-4896082 AAGAAAAAGAAATGAGGTCAGGG - Intergenic
1050478638 9:6066904-6066926 AGGAAACAGGAATTTGGCTCAGG + Intergenic
1050547638 9:6722180-6722202 AAGAAAGAGGGATGTGGGCCAGG + Intronic
1051191019 9:14513332-14513354 ATGAAACAGAAATGAAGGCCGGG + Intergenic
1051308013 9:15736645-15736667 AAGAAAAAGAAATGTGAGCCGGG - Intronic
1051345890 9:16151069-16151091 AGGAGAAAGAAATGTGACCCTGG + Intergenic
1051359941 9:16272977-16272999 CCGAAACAGAAGTGTGGCCCAGG - Intronic
1051615865 9:19006113-19006135 AAGAAAGAGAAATGTTGGCAAGG + Intronic
1051654438 9:19364913-19364935 AAAAAAAAGAAATTTTGCCCAGG + Intronic
1051895431 9:21981934-21981956 AAGAAAAAACAATGTGTCCCTGG + Intronic
1053136479 9:35653667-35653689 AAGAAAGAAAAATTTGGGCCAGG + Intergenic
1053504334 9:38628390-38628412 TAAAAACAGAAATGTGACCCTGG + Intergenic
1054788546 9:69233475-69233497 AAGATACAGAACTATGGGCCAGG + Intronic
1055208232 9:73759818-73759840 AAGAAACAGATATATGACTCTGG - Intergenic
1055458842 9:76497176-76497198 AATTAACAAAAATGTGGCCATGG - Intronic
1057152100 9:92805537-92805559 TAAAAACAGAAATGTGACCCTGG - Intergenic
1057421800 9:94918798-94918820 AAGAATAAGGAATGTGGCCCTGG + Intronic
1057715404 9:97491225-97491247 ATAAAACAGAAATGTGGGCTGGG - Intronic
1058254122 9:102739435-102739457 AAGAAATAGTAATGTGGCTCAGG - Intergenic
1058666895 9:107326932-107326954 AAGAAATAGAAAAGTTGGCCGGG - Intronic
1059499538 9:114739235-114739257 AAGAAACTGGCATGTGGCCCAGG - Intergenic
1059628564 9:116094281-116094303 TAGAAACAGAATTTTGACCCAGG + Intergenic
1060299948 9:122369414-122369436 AAGAAACACTTGTGTGGCCCTGG - Intergenic
1060690313 9:125651952-125651974 AAGAAAAAAAAATGTAGCCTGGG - Intronic
1060836933 9:126763030-126763052 AAGAAACAGAAACGTAACCCAGG + Intergenic
1060975125 9:127760616-127760638 AAAAAAAAGTAATGTGACCCAGG + Intronic
1061145843 9:128797950-128797972 AAAATACAAAAATTTGGCCCTGG + Intronic
1061154371 9:128848520-128848542 AAGAAACTCAAATGGGGGCCAGG + Intronic
1061336983 9:129945450-129945472 AAGAAACAGAAACGTGGGGAAGG + Intronic
1061891262 9:133621708-133621730 AAAAAACAGAAATCTTGGCCGGG - Intergenic
1062311876 9:135942736-135942758 AAGAGACAGAAAGCTAGCCCTGG + Intronic
1062458392 9:136651824-136651846 AAAAAAAAGGAATGAGGCCCGGG - Intergenic
1062714738 9:138003089-138003111 AAAAAAAAGAAATTTGGGCCAGG - Intronic
1185721442 X:2385236-2385258 AAGGAACACAAATGTGACACTGG + Intronic
1185818566 X:3180221-3180243 AGGAAACAGTAAAGGGGCCCAGG + Intergenic
1185870261 X:3658807-3658829 AAGAAAACAAAATGAGGCCCAGG + Intronic
1186840788 X:13483121-13483143 AAAAAAAAGAAATGGGGCCAAGG - Intergenic
1188865893 X:35312715-35312737 AAGAAAAAGAATTGTAGGCCAGG + Intergenic
1189531997 X:41894521-41894543 GAGTAACAGAAATGTAGTCCAGG + Intronic
1189700097 X:43709532-43709554 AAAAAACATAAATATTGCCCGGG - Intronic
1192254617 X:69444942-69444964 TAGAAAAAGAACTGAGGCCCAGG - Intergenic
1194080395 X:89455811-89455833 AATAAACAGTAATCTGGGCCAGG - Intergenic
1194681271 X:96856734-96856756 AAGAAAAAAAAATGTGGTCTTGG + Intronic
1195073703 X:101305684-101305706 AAGAAAAAGAAATGGGGCTAGGG + Intergenic
1195554004 X:106200751-106200773 AAGAAACAGAATTGCCGGCCGGG + Intronic
1196081862 X:111641084-111641106 AAAAAAAAAAAAAGTGGCCCTGG + Intergenic
1196159787 X:112470322-112470344 GAGAAACAGAAATGCATCCCTGG - Intergenic
1196611048 X:117715071-117715093 AAGTAGCAGAAATGTGCCCAGGG + Intergenic
1196654077 X:118198782-118198804 AAGAAAAGGAAATGTGGACACGG + Intergenic
1197133705 X:123035885-123035907 AAGAAAAAGAACTGTTGCCAAGG - Intergenic
1197337039 X:125221032-125221054 AAGAAGCAGACAAGTGGCACTGG - Intergenic
1198233114 X:134712367-134712389 AAGACAGATAAATGTGGTCCCGG + Intronic
1198605730 X:138334519-138334541 AATAAACAAAAATCTGGCCAAGG - Intergenic
1199494350 X:148436635-148436657 AAGAAACACACATGTGGACTGGG - Intergenic
1200298710 X:154950058-154950080 AAGAAGAGGAAATGTGGGCCAGG - Intronic
1200433073 Y:3111877-3111899 AATAAACAGTAATCTGGGCCAGG - Intergenic