ID: 905596814

View in Genome Browser
Species Human (GRCh38)
Location 1:39214690-39214712
Sequence CCGCACTTACAGCTGCCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905596814_905596822 6 Left 905596814 1:39214690-39214712 CCTTTTGGCAGCTGTAAGTGCGG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905596822 1:39214719-39214741 GAAACTTTCTTTGGAATCTAGGG 0: 1
1: 0
2: 4
3: 15
4: 225
905596814_905596823 21 Left 905596814 1:39214690-39214712 CCTTTTGGCAGCTGTAAGTGCGG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905596823 1:39214734-39214756 ATCTAGGGATCTGTTCACAGTGG 0: 1
1: 0
2: 1
3: 15
4: 103
905596814_905596824 25 Left 905596814 1:39214690-39214712 CCTTTTGGCAGCTGTAAGTGCGG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905596824 1:39214738-39214760 AGGGATCTGTTCACAGTGGACGG 0: 1
1: 0
2: 0
3: 11
4: 178
905596814_905596820 -3 Left 905596814 1:39214690-39214712 CCTTTTGGCAGCTGTAAGTGCGG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905596820 1:39214710-39214732 CGGGGAAGGGAAACTTTCTTTGG 0: 1
1: 1
2: 0
3: 12
4: 128
905596814_905596821 5 Left 905596814 1:39214690-39214712 CCTTTTGGCAGCTGTAAGTGCGG 0: 1
1: 0
2: 0
3: 4
4: 65
Right 905596821 1:39214718-39214740 GGAAACTTTCTTTGGAATCTAGG 0: 1
1: 0
2: 1
3: 30
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905596814 Original CRISPR CCGCACTTACAGCTGCCAAA AGG (reversed) Intronic
900677419 1:3896518-3896540 CAGCTCTTACACCTGCCCAAAGG + Intronic
905490034 1:38336238-38336260 CAGCACTTCCTCCTGCCAAAGGG + Intergenic
905596814 1:39214690-39214712 CCGCACTTACAGCTGCCAAAAGG - Intronic
906211183 1:44013121-44013143 CAGCAGTTACAGCTGTAAAAGGG + Intronic
910550268 1:88467139-88467161 CCGCACTCGGAGCTGCCAACCGG + Intergenic
911520432 1:98923546-98923568 CAGCCCTTGTAGCTGCCAAAAGG + Intronic
917406233 1:174711115-174711137 CCGCACTCACAGCGGCCAGCTGG - Intronic
922700242 1:227755098-227755120 CCGCACTTAGAGATGACAGATGG - Intronic
1064139415 10:12777908-12777930 CCTCCCTCGCAGCTGCCAAATGG - Intronic
1067317650 10:45183422-45183444 CCTGACTCACAGGTGCCAAATGG + Intergenic
1071328230 10:84537321-84537343 CTGCACTTACAGCTATTAAATGG + Intergenic
1071879036 10:89874640-89874662 CTGCAATTACAGCTGCCATGAGG - Intergenic
1072247953 10:93559689-93559711 CCGCCCTCACAGTTGCTAAAAGG + Intergenic
1076170398 10:128314586-128314608 CTCCAATTACAGGTGCCAAATGG + Intergenic
1076217632 10:128709391-128709413 CAGCAATTATAGCTGCGAAATGG - Intergenic
1079486999 11:20945512-20945534 GCGCACATAGAGCTGACAAAAGG + Intronic
1088910014 11:114183619-114183641 CCGCTCTCACAGCTCCCTAAAGG - Intronic
1092546809 12:9459327-9459349 CCCCACTTACAGCTACCCCAGGG - Intergenic
1094506127 12:31062746-31062768 CCCCACTTACAGCTACCCCAGGG + Intergenic
1101990139 12:109477510-109477532 CCGCTATTTCAGCTGCCAGAGGG + Exonic
1103940472 12:124498731-124498753 CAGAATTTACAGCAGCCAAAAGG + Intronic
1113385338 13:109843021-109843043 GCCCACTGACAACTGCCAAAAGG + Intergenic
1124441142 15:29687418-29687440 CCACACTGGCAGCTGCCCAAGGG - Intergenic
1130580772 15:85135197-85135219 CCGAACTTCCAGCTCCCAAATGG - Intronic
1131145546 15:90009302-90009324 CAGCACTACCAGCTTCCAAAGGG - Intronic
1147847200 17:43412916-43412938 CCTCAATTAGAGCCGCCAAAGGG + Intergenic
1148769743 17:50060017-50060039 CTGCAGTTTCAGCTGCCACAGGG + Intronic
1153009725 18:527435-527457 CTGCATTAACAGTTGCCAAAGGG - Intergenic
1153736850 18:8079869-8079891 CAGCACTTACAGCAGTCAACAGG + Intronic
1154040463 18:10849838-10849860 CCAGACTAACAGCTGCCATAGGG + Intronic
1156914131 18:42445574-42445596 CAGCACTAACAACTGCCAATTGG - Intergenic
1158463648 18:57669997-57670019 CTGCACTTCCAGTTTCCAAAGGG + Intronic
1159354124 18:67315223-67315245 CCGCACTTTTAGCTACAAAATGG + Intergenic
926706380 2:15840633-15840655 CCACACATAGAGCTGCCATATGG + Intergenic
929049101 2:37819446-37819468 CAGCAGATACAGCTGCCCAATGG - Intergenic
929201722 2:39243861-39243883 CCGCACTTACTGCACCCACAGGG + Intergenic
948728417 2:239948496-239948518 CTCCACTTACAGCTGCAAAATGG - Intronic
1169759519 20:9075909-9075931 AAGCACTTACAGCTAACAAAAGG - Intronic
1170089124 20:12570561-12570583 CCCCAGCTACAGCTGCCACATGG - Intergenic
1173049935 20:39549694-39549716 CCGCACGCCCAGCTGCAAAAAGG - Intergenic
1175036670 20:56006037-56006059 CTACACTTCCAGCTGCCAGAGGG + Intergenic
1183201258 22:36387286-36387308 ACGCCCTGACAGCTGCCAAACGG + Intronic
958491960 3:94787162-94787184 CCTCTATTACAGCTGCCAAGAGG + Intergenic
961619779 3:128214848-128214870 CAGCACTTACAGCTGCGATCTGG + Intronic
963778070 3:149460176-149460198 CTTCACTTTGAGCTGCCAAAAGG - Intergenic
965563495 3:170084900-170084922 CAGCACTTCCAGTTGACAAATGG - Exonic
971342505 4:25783472-25783494 AGGCACATCCAGCTGCCAAAAGG + Intronic
974478748 4:62418326-62418348 CCTCACTGGCAGCTGCTAAATGG + Intergenic
975280635 4:72558289-72558311 TCTCTCTTACAGCTTCCAAAAGG - Intronic
978645493 4:110926082-110926104 CAGCACTTTGAGATGCCAAATGG - Intergenic
979307945 4:119169668-119169690 CCAGACTTGAAGCTGCCAAAAGG - Intronic
980759758 4:137215535-137215557 CAGTACTCACAGCAGCCAAAAGG - Intergenic
981720209 4:147794078-147794100 CTACACTTACAGCTCCCGAAGGG - Intronic
985897464 5:2757310-2757332 CCGAATTTACAGTTGGCAAAGGG - Intergenic
1000084729 5:157879374-157879396 CCGCACTCAGAGCTGCCAGCTGG + Intergenic
1007231578 6:40351803-40351825 CCGCACCTCCAGCTTGCAAAGGG + Intergenic
1019315412 7:381869-381891 CCCCACCTAGAGCTGCCACATGG + Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1036398222 8:8386455-8386477 CCGCGCTCACAGCTGCCACCCGG - Exonic
1041072273 8:54136855-54136877 CTGCACTTAGACCTGCAAAATGG + Intronic
1042807931 8:72792078-72792100 CCCCATTTACTGCTGCTAAATGG - Intronic
1048554720 8:135463699-135463721 CCGCAGTTTCAGATGCCAAAGGG + Intronic
1057546343 9:96022158-96022180 CCGCCCTTCCAGCTCCCAACTGG + Intergenic
1059305724 9:113351605-113351627 CCTCAGTTCCATCTGCCAAAAGG - Intronic
1060593618 9:124834824-124834846 CCACACTTTCATCTGTCAAATGG + Intergenic
1061825527 9:133256212-133256234 CAGCACTGACAGCTGCCGACCGG + Exonic
1062148863 9:135007239-135007261 AGGTATTTACAGCTGCCAAAGGG - Intergenic
1062354555 9:136155634-136155656 CATCATTTACAGCAGCCAAAAGG + Intergenic
1197313251 X:124931903-124931925 ACGCACACACACCTGCCAAAAGG + Intronic
1199407443 X:147479096-147479118 CCGCACTGACAGCTGACAGCTGG - Intergenic