ID: 905598743

View in Genome Browser
Species Human (GRCh38)
Location 1:39232057-39232079
Sequence GTCTTAACATGCCTCTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905598743 Original CRISPR GTCTTAACATGCCTCTGTTA TGG (reversed) Intronic
902853195 1:19178005-19178027 GCATTAACACGCCTGTGTTAAGG - Intronic
905598743 1:39232057-39232079 GTCTTAACATGCCTCTGTTATGG - Intronic
905598747 1:39232177-39232199 GTCTTAACATGCCTCTGTTTTGG - Intronic
910337326 1:86149269-86149291 GTTTTAAAATGCCTGTGTTATGG - Intronic
918693174 1:187508293-187508315 GTGTCAACTTGCCTGTGTTAAGG + Intergenic
1078062607 11:8057744-8057766 TTCTTAACAGGCCTCGTTTAAGG - Intronic
1085762661 11:79255761-79255783 GTCTTAACAAGATTGTGTTAGGG - Intronic
1088765772 11:112975084-112975106 GTCTGAACATTCCTCTGTTCGGG - Intronic
1089828852 11:121306666-121306688 GTCTTAAAATTCGTCTGTTCCGG + Intronic
1095847977 12:46767674-46767696 GCCTTAACATGACTTTATTAAGG + Intronic
1100299799 12:93296580-93296602 GCCTTAACATGTCTCTGCTTGGG - Intergenic
1100794403 12:98164984-98165006 TTCTTAGCAACCCTCTGTTATGG + Intergenic
1103228368 12:119307265-119307287 GTCTTCTCATGCCTCAGTGATGG - Intergenic
1111585328 13:90276627-90276649 GTTTAAACAGGACTCTGTTATGG + Intergenic
1113307045 13:109090197-109090219 GTCTGCACATGGCTCTGCTAAGG - Intronic
1115172597 14:30526140-30526162 TTCTCCAGATGCCTCTGTTATGG - Intergenic
1120436643 14:84490798-84490820 CTCTTTACTTTCCTCTGTTATGG - Intergenic
1125827186 15:42686428-42686450 GACTTCACATGCTTCTGTCATGG - Exonic
1132040356 15:98520306-98520328 GGCTTACCATGCCTCACTTAGGG - Intergenic
1135557833 16:23452102-23452124 TTCTTAACATGTCTTTGTTGAGG - Intronic
1140559692 16:75964227-75964249 GTCTGTACATTCCTCTGTTATGG - Intergenic
1144603925 17:16646802-16646824 GTCTTAACAAGCCTGTCTAAGGG - Intronic
1150102631 17:62437671-62437693 GCCTTAAAATGTATCTGTTATGG + Intronic
1156006853 18:32452398-32452420 CCCCTAACATGCCTCTGTTCAGG + Intronic
1156176134 18:34548767-34548789 ATATTAACATACTTCTGTTAAGG - Intronic
1157463096 18:47919236-47919258 GTCTGAAAATGCCTTTGTTCTGG - Intronic
1158859209 18:61575665-61575687 GTCTGAAGATGCCTCTCTTTTGG - Intergenic
1162487851 19:10972670-10972692 GCCTTTGCATGCCTCTGTTGTGG + Intronic
1165169636 19:33882636-33882658 CTCTCAACACCCCTCTGTTAGGG + Intergenic
925592874 2:5527418-5527440 GTCACAACATCCGTCTGTTAAGG - Intergenic
930714002 2:54575846-54575868 GTCTCAACATGCCTCTGCCTAGG + Intronic
930884754 2:56313019-56313041 GTCTTAACATGCTCATTTTATGG + Intronic
936412518 2:112273339-112273361 GTCTTTAATTGCCTCAGTTAAGG - Intergenic
940135240 2:150428211-150428233 ATATTAACCTGTCTCTGTTATGG - Intergenic
940344505 2:152615424-152615446 GTCTGAACATTCCTGTCTTACGG + Intronic
941118096 2:161494856-161494878 GTCATGACATGCCTCCATTAAGG - Intronic
942808263 2:179962196-179962218 GTCTTATCTTCCTTCTGTTATGG - Intronic
945384236 2:209178283-209178305 GTTTTTATATGTCTCTGTTATGG + Intergenic
1173948744 20:46973430-46973452 GTCTCAACATGCCTTTGTAAGGG - Intronic
1178516933 21:33255888-33255910 TTGTTAACAAGCCTCTTTTAGGG - Intronic
1184946897 22:47810228-47810250 GTGTTTATATGCCTGTGTTAAGG + Intergenic
951293597 3:20904509-20904531 GGCTTCATATGCCCCTGTTATGG - Intergenic
957415568 3:79898635-79898657 TTCTTAACATGAGTCTTTTAAGG - Intergenic
972606535 4:40619056-40619078 GTATCTACCTGCCTCTGTTATGG - Intronic
975262050 4:72314954-72314976 TTCTTAACATGCCTTTGTTTTGG + Intronic
980112848 4:128651034-128651056 GACATGACATGCCCCTGTTATGG + Intergenic
983699152 4:170570047-170570069 GTATCAAAATGCCTCTGTAAAGG - Intergenic
984154775 4:176182171-176182193 GTTTAAATATGCCTCTGTAAAGG + Intronic
984207937 4:176809159-176809181 CTCCTAACATACCTCTGTTCTGG - Intergenic
985893175 5:2732056-2732078 GTGTGAGCATGCCTCTGTTTGGG - Intergenic
986757534 5:10852153-10852175 GTCTTTACATAGCTCTGTGACGG + Intergenic
987591554 5:19934361-19934383 GTCTAAGCATCCCTCTTTTAGGG + Intronic
990036568 5:51328813-51328835 GTCTTATCAGGGGTCTGTTAGGG + Intergenic
998037401 5:138928599-138928621 GTCTTAAAATGCCGGTGTTGGGG + Intronic
998794802 5:145807490-145807512 GTCTTCACATCACTCTGTGAGGG + Intronic
1008867104 6:56225853-56225875 GTCTTACCATTCCTATGTGATGG + Intronic
1012197484 6:96361984-96362006 GTGTTAACTTGCCTGGGTTAAGG + Intergenic
1015565661 6:134567846-134567868 CTCTTAAACTGCCTCTGTGACGG + Intergenic
1018402144 6:163434205-163434227 GGCTGGGCATGCCTCTGTTAGGG - Intronic
1018983332 6:168616767-168616789 GTCTTATGATGCCTCTGGGATGG - Intronic
1019086997 6:169487870-169487892 GACTAAACATGCTTCTTTTATGG - Intronic
1022473036 7:30693357-30693379 GGGTTAATATGCCTCTGTAATGG + Intronic
1024250047 7:47499253-47499275 GTATAAACATGCCTCTAGTAAGG + Intronic
1024646975 7:51379041-51379063 GTCCTAGCATGCTTCTGTTTGGG - Intergenic
1029520203 7:101056003-101056025 GCCTTAATATGCCTGTATTAGGG + Intronic
1030201890 7:106914318-106914340 GTATTATCAGGCCTCTTTTATGG - Intergenic
1032031836 7:128490860-128490882 GCCTTAAAATGTATCTGTTATGG + Intronic
1034033900 7:147799965-147799987 TACTTAACAGGCCTCTGTCATGG + Intronic
1034853780 7:154521474-154521496 GTCTAAACAGGACTCTGTTAAGG + Intronic
1037265347 8:17053238-17053260 GTTTTAAATTGCCTCTTTTAGGG + Intronic
1040784988 8:51155100-51155122 GTCTTAATCTGCCTCTGCTGGGG - Intergenic
1043226576 8:77739829-77739851 TTCTTACCATGCCTCAGTCAAGG + Intergenic
1045159823 8:99526223-99526245 TTCTTAACATGATTCTTTTAGGG - Intronic
1047997246 8:130348502-130348524 GTCTGAACAGCCCTCTGTCATGG - Intronic
1050948604 9:11559014-11559036 GTCTTTACCTCCCTCTTTTAAGG - Intergenic
1051379086 9:16436685-16436707 GCCTTCACATGCCTATGCTAAGG - Exonic
1055792003 9:79932598-79932620 GTCTTGCTGTGCCTCTGTTATGG + Intergenic
1194717920 X:97308479-97308501 GTGTTAAAAAGCCTCTGCTAAGG + Intronic
1201743468 Y:17347064-17347086 GTCTTGACATGCATGTGTTCTGG + Intergenic