ID: 905600723

View in Genome Browser
Species Human (GRCh38)
Location 1:39248186-39248208
Sequence ATGTTTTAGTAGAAAGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 596
Summary {0: 1, 1: 0, 2: 1, 3: 54, 4: 540}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905600723_905600725 9 Left 905600723 1:39248186-39248208 CCGTCTTCTTTCTACTAAAACAT 0: 1
1: 0
2: 1
3: 54
4: 540
Right 905600725 1:39248218-39248240 CTCCAAGTCCCGTTTCTTCGAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905600723 Original CRISPR ATGTTTTAGTAGAAAGAAGA CGG (reversed) Intronic
902415694 1:16237368-16237390 ATGTTTTGGAAGAAAGACTAGGG - Intergenic
904516301 1:31058215-31058237 ATGTTGTAGTTGAAAGTAGGGGG - Intronic
904854471 1:33487049-33487071 AAGTTTTTGTATAAAAAAGAGGG + Intronic
905600723 1:39248186-39248208 ATGTTTTAGTAGAAAGAAGACGG - Intronic
906047747 1:42845830-42845852 ATGTTTCAGTGCAAAGAACAAGG - Intergenic
906868586 1:49450706-49450728 TTCTTTTAGGAGAAAGATGATGG + Intronic
907555335 1:55338481-55338503 GTGTTATAGTAGAAAGAATTTGG - Intergenic
907806326 1:57823934-57823956 ATGATGTGGTAGAAAGAACATGG - Intronic
908206538 1:61856082-61856104 ATGGTGTAGCAGAAAGAAGTGGG + Exonic
909341265 1:74533893-74533915 GTGTTTTAGTAGAAAGAGTATGG + Intronic
909556891 1:76963970-76963992 ATGTTTTTGAAGATAGAGGAGGG + Intronic
909573323 1:77142899-77142921 ATGATCTAGTAGAAAGAGCACGG - Intronic
910387126 1:86696857-86696879 GTGATTTAGAAAAAAGAAGAAGG + Intergenic
910724297 1:90322498-90322520 ATGGATTGGTAGAGAGAAGATGG + Intergenic
911488313 1:98529926-98529948 ATGTTTGAGTCCAAAGAAGGTGG + Intergenic
911562575 1:99424452-99424474 ATGTTTTAGTAGAAATGTCATGG - Intergenic
911985667 1:104618568-104618590 ATGTTTTAGTGAAAAAGAGAAGG + Intergenic
912035263 1:105304436-105304458 ATGTTTTGGAAAAAAAAAGATGG + Intergenic
912468291 1:109889131-109889153 ATGTTTTCCTAGGAAGAAGAGGG + Intergenic
912667742 1:111598143-111598165 ATGGTATAGCAGAAAGAACAGGG - Intronic
912765314 1:112404162-112404184 ATGTTATAGTGGAAAGCACATGG - Intronic
913002335 1:114593377-114593399 ATGTTTTAGAAGAAAGATTTGGG - Intronic
913008428 1:114658146-114658168 AGGTTTAAGGAGAAGGAAGAAGG + Intronic
913421425 1:118673943-118673965 ATATTTTTGTAGAATGAGGATGG - Intergenic
913434117 1:118829422-118829444 ATTTTGTAGTAGAAAGATCATGG + Intergenic
913616815 1:120568576-120568598 ATGTTTTGGTAGAATGGAAAAGG + Intergenic
914573460 1:148942334-148942356 ATGTTTTGGTAGAATGGAAAAGG - Intronic
914795951 1:150920578-150920600 ATATTTTACTAGACAGAAAAAGG + Intergenic
915065253 1:153219587-153219609 ATGCTGTAGTAGAAAGAACCTGG - Intergenic
915738164 1:158097800-158097822 TTGTTTTAGTGGAAAGAGCAAGG + Intronic
915952171 1:160196776-160196798 ATATTGTATTAGAAAGAACATGG - Intronic
916771475 1:167912949-167912971 ATGATATAGTAGAAACAACAGGG - Intronic
916987004 1:170202370-170202392 ATGTTAAAGTAGAGAGAAAAGGG - Intergenic
917490349 1:175493379-175493401 ATGTTCTATTAGCAAGGAGATGG - Intronic
917619638 1:176782962-176782984 ATGGGTTAGAAGAAAGCAGATGG + Intronic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918282597 1:183022065-183022087 ATGTTCTGGTAGGATGAAGAAGG - Intergenic
918768732 1:188523869-188523891 AAGGTGTAGTAGAAAGAAGAAGG + Intergenic
918972740 1:191440712-191440734 ATGTTGTAGTTGGAAGAATAGGG - Intergenic
919448294 1:197737934-197737956 AAATTTTATTAGAAAGGAGAGGG + Intronic
919527629 1:198673708-198673730 ATGTTTTAGAAAAATAAAGAAGG + Intronic
919574656 1:199292950-199292972 ATTTTTTAGTAGAAAAATCACGG - Intergenic
919856199 1:201707914-201707936 ATATTGTAGTGGAAAGAACAAGG + Intronic
919998035 1:202772230-202772252 AGGCCTTGGTAGAAAGAAGAGGG - Intronic
921558549 1:216628702-216628724 ATGTTTTAGTAGGAACACTATGG - Intronic
921596174 1:217055871-217055893 ATATTTTACTAGAAAAGAGAGGG - Intronic
922320906 1:224485764-224485786 AAGTTTTAAAAGAAAGAAGAGGG - Intronic
923056736 1:230432084-230432106 ATGTTTCAATAGAAAGGATATGG + Intergenic
923434762 1:233957335-233957357 ATCAGTTAGTAGAATGAAGATGG - Intronic
923470902 1:234289963-234289985 AAGTTTTCAAAGAAAGAAGAGGG + Intronic
924845494 1:247765587-247765609 AGGTTTTAGAAGAAAGCAGTGGG - Intergenic
1063295499 10:4801048-4801070 ATGTTTAAATTGAGAGAAGATGG + Intronic
1063361736 10:5465019-5465041 ATGTGATAGTAGTAAGAAGTGGG + Intergenic
1063622861 10:7665582-7665604 ATGTTTTAGTAGATGGCTGAAGG - Intronic
1064928849 10:20601310-20601332 ATTTTTTGGGAGAAAGAAAAAGG + Intergenic
1065335036 10:24648465-24648487 ATGTATTTTTAAAAAGAAGATGG - Intronic
1067499788 10:46793058-46793080 ATGTTATATTAAAAAGAAGGAGG - Intergenic
1067594843 10:47547267-47547289 ATGTTATATTAAAAAGAAGGAGG + Intronic
1067641951 10:48055377-48055399 ATGTTATATTAAAAAGAAGGAGG + Intergenic
1068168685 10:53364508-53364530 ATGTTATAAAAGAAGGAAGAAGG - Intergenic
1068466856 10:57404710-57404732 AAGTTTTAGGAGAAAAAAGTTGG + Intergenic
1068583050 10:58764669-58764691 TTGTTTTAGGAGAAAGAAAGTGG - Intronic
1069181502 10:65365788-65365810 ATTTTTTAATAGAAATATGAAGG + Intergenic
1069205417 10:65676749-65676771 ATTTTTTATTAGAAAAAAGGGGG - Intergenic
1069560959 10:69429067-69429089 CTGATATAGTAGAAAGAATATGG - Intergenic
1070226924 10:74517267-74517289 AAGATATAGTAGAAAGAAGATGG - Intronic
1072832885 10:98677694-98677716 ATGGTTTGGTAGAAACAACAAGG - Intronic
1073361040 10:102899085-102899107 ATCATTGAGTGGAAAGAAGAGGG + Intronic
1073733050 10:106313484-106313506 AGGTTATATTAAAAAGAAGATGG - Intergenic
1074160931 10:110835851-110835873 ATATTTCTGTGGAAAGAAGAGGG - Exonic
1074664830 10:115709656-115709678 AATTTATAGTATAAAGAAGAAGG + Intronic
1074839130 10:117330623-117330645 ATGTTTTAATAGGAACAAGAAGG - Intronic
1077231981 11:1461829-1461851 ATGTGTGTGTAGAAAGAAGCAGG - Intronic
1077263974 11:1639877-1639899 GTGTTTAAGTACAAAGAAAATGG - Intergenic
1078240535 11:9527003-9527025 ATTTTTTAGTAGAAATGAAATGG + Intronic
1078306117 11:10188075-10188097 GTGGTTCAGTAGAAAGAATACGG - Intronic
1078360681 11:10665353-10665375 GTGTATTAGTAAAAAGAAGTGGG - Intronic
1078741574 11:14071568-14071590 ATGTTCTAGGAGAAGGAACAGGG - Intronic
1078945331 11:16060540-16060562 ATGTTTTGTTAGACAGAATATGG - Intronic
1079022446 11:16920526-16920548 ATATTATACTACAAAGAAGATGG - Intronic
1079157112 11:17958381-17958403 ATTTTTTAGAAGAATGAGGATGG - Intronic
1079950001 11:26790255-26790277 AAGTCTAGGTAGAAAGAAGATGG + Intergenic
1080262189 11:30361450-30361472 ATCTTTCAGTGGAAATAAGATGG + Intergenic
1080496198 11:32822742-32822764 ATGACTTAGAAGAAATAAGAGGG + Intergenic
1082653875 11:55828223-55828245 GTGTTGGAGTAGAGAGAAGAAGG + Intergenic
1084395882 11:68909802-68909824 ATTTTTTAGTAGAGACAACATGG + Intronic
1086127127 11:83360430-83360452 ATGTGATAGCAGAAAGGAGAAGG - Intergenic
1086204399 11:84240514-84240536 TTATTTTAGTAGAAAGAGAATGG - Intronic
1086271370 11:85070794-85070816 AGATTTTAGAACAAAGAAGATGG - Intronic
1086474233 11:87153290-87153312 ATGTTTGAGTACAAATAAGATGG - Intronic
1086550911 11:88050587-88050609 AAGTTTTACTAGAAAGAATAAGG + Intergenic
1086673554 11:89575751-89575773 ATGAAGTAGAAGAAAGAAGAAGG - Intergenic
1086893252 11:92283209-92283231 TTGTTTTAGTGGAAATAAAATGG - Intergenic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087148912 11:94840400-94840422 CTGGTTTGGTAGAAAGAAGGGGG + Intronic
1087198686 11:95323684-95323706 ATGATATAGTAGTAAGAAGTGGG + Intergenic
1087294990 11:96361299-96361321 ATTTTTAAGTTGAAACAAGAGGG + Intronic
1087468132 11:98536625-98536647 ATTTTTTAGTAAAGAGAACAAGG - Intergenic
1087609624 11:100418421-100418443 TTCTATTAGTAAAAAGAAGATGG + Intergenic
1087668510 11:101078491-101078513 GTTTTCTAGAAGAAAGAAGATGG + Intronic
1087677330 11:101178224-101178246 ATGTGGTAGAAGAAAGAACATGG + Intergenic
1087860242 11:103144609-103144631 ATGTTTTATTAGAGACTAGAGGG + Intronic
1088211325 11:107459892-107459914 ATTTTTTATTAGAAAAATGATGG + Intergenic
1089110137 11:116049043-116049065 ATTTTTTAAAATAAAGAAGAGGG - Intergenic
1089938501 11:122390593-122390615 ATCCTTTGGTAGAAAGAAAATGG + Intergenic
1090141097 11:124263653-124263675 ATGATTTCTTAGAAAGAACATGG - Intergenic
1092064866 12:5581595-5581617 ATGTTTGCGTTGACAGAAGAGGG - Intronic
1092593340 12:9972788-9972810 ATTTTTTTTTAGAAAGAAGAAGG + Intronic
1092872986 12:12823352-12823374 ATGCTTTGGTGAAAAGAAGAGGG - Intronic
1092934542 12:13348373-13348395 AAGTTTTAGTAGAAAACAGGGGG + Intergenic
1093184482 12:16003938-16003960 ATGTTTTAGGAAACAGAGGAAGG - Intronic
1093338809 12:17945574-17945596 AGGTTCTAGTAGACAGAACAGGG - Intergenic
1094177566 12:27557089-27557111 GTGTTTTAGGAAAAAGAAGGGGG + Intronic
1095129497 12:38522504-38522526 ATTATATAGTAGGAAGAAGAGGG - Intergenic
1095614813 12:44175683-44175705 ATGTTTTTGTCAAATGAAGAAGG + Intronic
1096592803 12:52673049-52673071 ATGGTAGAGTAGAAAGAACAAGG - Intergenic
1096793292 12:54058460-54058482 ATGGCTAAGTAAAAAGAAGACGG + Intergenic
1096828945 12:54300025-54300047 ATGTGTGAGAACAAAGAAGAGGG + Intronic
1097929022 12:65163975-65163997 ATGGTATAGTAGAAAGAACAAGG + Intergenic
1098188083 12:67919806-67919828 ATGGTCTTGGAGAAAGAAGAAGG - Intergenic
1098968268 12:76819048-76819070 ATTTTAAAGTAGAAATAAGAAGG + Intronic
1099013868 12:77323148-77323170 ATGTTATAGTATTAAGAGGAGGG + Intergenic
1099252451 12:80272912-80272934 ACATTTTAGTAAAAAGGAGAAGG + Intronic
1099579709 12:84428691-84428713 AGGGTTTAGTGGAAAGAAAAAGG - Intergenic
1100091348 12:90975396-90975418 TTGTTTTAGTAGTAAAAATATGG + Intronic
1100287245 12:93178772-93178794 ATGTTTTATTAGGAATATGAAGG + Intergenic
1100397640 12:94198797-94198819 ATTTTCTAGGAGAAAGGAGAGGG - Intronic
1100690723 12:97036084-97036106 CTGGTGTAGTAAAAAGAAGATGG - Intergenic
1100755655 12:97748566-97748588 ATGATTTATGAGAAAGTAGATGG + Intergenic
1100914366 12:99402241-99402263 ATGATGTAGTTGAAAGATGAAGG + Intronic
1101310579 12:103575183-103575205 ACATTTTAGTAGCATGAAGAGGG - Intergenic
1101358935 12:104008341-104008363 ATGTTTTAGCAAAAAGACCAGGG + Intronic
1102790004 12:115636938-115636960 AGGTTATAATAGAAAGAAGGGGG + Intergenic
1103118328 12:118357391-118357413 ACGTGTTAGCAGAAAAAAGATGG - Intronic
1103278022 12:119730459-119730481 ATGTTTTCCTAAAAAGCAGAAGG + Intronic
1103826790 12:123745410-123745432 AAGTGTTAATAGAAAGAAAATGG + Intronic
1103977468 12:124712818-124712840 ATTTTTTATTATAAAAAAGAGGG + Intergenic
1105457570 13:20555485-20555507 ATGTTTTAATAATAAAAAGAAGG - Intergenic
1106058952 13:26266852-26266874 ATTTTTTAATAAAAAGAAAATGG + Intronic
1106308196 13:28532118-28532140 ATTTTTTAAAAGAAAGGAGAAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107240508 13:38228599-38228621 AGGTCTTTGTAGAAAGGAGATGG + Intergenic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1107568422 13:41630425-41630447 GTGTTCAAGCAGAAAGAAGAAGG - Intronic
1107645024 13:42485278-42485300 ATGTATTATTACAGAGAAGAAGG - Intergenic
1108738758 13:53313096-53313118 GTGTTTTGGAAGAAAGAAAAAGG - Intergenic
1108745323 13:53387628-53387650 AAGTTTTAGGAAAAAAAAGAAGG - Intergenic
1109162778 13:58996562-58996584 ATGTTTAATTAGAAAGAATCTGG - Intergenic
1109168994 13:59073100-59073122 ATGTATGATTAGTAAGAAGAAGG - Intergenic
1109401568 13:61836696-61836718 TTTTTTTAATAGAAAGATGAAGG + Intergenic
1109492754 13:63125076-63125098 ATGTATTAGTAGAAATAATAAGG - Intergenic
1109568198 13:64147923-64147945 ATGTTGTAACCGAAAGAAGAAGG + Intergenic
1109828802 13:67757993-67758015 AATTTTCAGTAGAGAGAAGATGG - Intergenic
1109935601 13:69279833-69279855 TTTTTTTAGTAGAAAGAAAGTGG + Intergenic
1110125066 13:71932381-71932403 AGGTTTCAGTGGAAAGATGATGG + Intergenic
1110344966 13:74435478-74435500 ATTTTCTATTAGATAGAAGAAGG - Intergenic
1111106832 13:83656359-83656381 AAGTTTTAGTGGGAAGAATAGGG + Intergenic
1111700286 13:91678579-91678601 ATGTTCTAGCACCAAGAAGAGGG + Intronic
1112079619 13:95955008-95955030 ATGTCTTACAAGAAAGTAGAGGG + Intronic
1112484151 13:99804630-99804652 ATGCCTTAGTTGAAAGATGAGGG - Intronic
1112910821 13:104481302-104481324 ATATTTAAATAGAAAGAACAAGG + Intergenic
1114028929 14:18558079-18558101 AAGTTATAGTAGAAAGAAAAGGG - Intergenic
1114895935 14:26991394-26991416 CTGGTTTTGAAGAAAGAAGAAGG - Intergenic
1114967236 14:27977941-27977963 ATGTTTTAAGAGAAAAAAGGAGG - Intergenic
1115119546 14:29924680-29924702 ATGTTTCAGGAGAGAGCAGAGGG - Intronic
1115178366 14:30592041-30592063 ATATTTTAGTAGGAAGGAAAAGG + Intronic
1116349094 14:43836114-43836136 AGGTATTAGTAGTAAGCAGATGG + Intergenic
1116377410 14:44221191-44221213 AAATAATAGTAGAAAGAAGAAGG + Intergenic
1117236846 14:53786951-53786973 ATGTTTAAGGAGAAAGAAAAAGG - Intergenic
1117251141 14:53939934-53939956 ATGTTCTAATAAAGAGAAGAGGG + Intergenic
1117707709 14:58488978-58489000 ATGGTATAGTAGAAAGAATAGGG + Intronic
1118649488 14:67874954-67874976 ATGTTTTTGGAGAAATAAAATGG + Intronic
1119008339 14:70956239-70956261 ATGTTTTCTTAGAAAGAATAAGG + Intronic
1119030202 14:71186382-71186404 AGGTTTTATTAGCAAGAAAAAGG - Intergenic
1119871178 14:78019256-78019278 AAGTTTGAGTACAAACAAGAAGG - Intergenic
1121167043 14:91813080-91813102 ATGTTTTAATGTAAAAAAGAAGG + Intronic
1121391041 14:93574815-93574837 AAGTGTTAATAGAAAGAACATGG + Intronic
1121960085 14:98251527-98251549 ATGTTTAAGTAGGAGTAAGAAGG + Intergenic
1122680148 14:103454036-103454058 CAGGTTTAGTAGAAAGAGGATGG + Intronic
1202942709 14_KI270725v1_random:169090-169112 AGGTTTTGGTTGAAAGAACAAGG + Intergenic
1125084977 15:35719329-35719351 TAGATTTAGTAGAAAGAAGAAGG - Intergenic
1125295974 15:38203493-38203515 ATGTTTTATTATGAAGGAGAGGG + Intergenic
1125401775 15:39311807-39311829 ATTTTTGAGTATGAAGAAGAAGG - Intergenic
1125800972 15:42446554-42446576 ATATTTTGGAAGAAAGAAGTTGG - Intronic
1126373363 15:47970293-47970315 ATAATTTAGTAGAAAGAATCAGG + Intergenic
1126806947 15:52360526-52360548 ATGGTTTAAAAGAAAGATGAAGG + Intronic
1127826092 15:62704460-62704482 ATGTGTTAGTTAAACGAAGATGG + Intronic
1128485722 15:68085550-68085572 ATGGTTTAGTGGAAAGAGCATGG + Intronic
1131013544 15:89039076-89039098 ATGTTTAAAAAGAAAGAAGTCGG - Intergenic
1133070956 16:3246543-3246565 ATGTCCTAGGAGAAAAAAGAAGG + Exonic
1135269887 16:21060151-21060173 AGGTTTTGGTAGAAAGCAGAGGG + Intronic
1135790242 16:25387693-25387715 ATTTTTTTTTAGGAAGAAGAGGG - Intergenic
1135876155 16:26202089-26202111 AGGCTTTAATAGAAAGAAAAGGG - Intergenic
1137989833 16:53142958-53142980 ATCCTGTAGTAGAAAGCAGAGGG + Intronic
1138324306 16:56150739-56150761 AACTTAAAGTAGAAAGAAGATGG + Intergenic
1138356971 16:56389919-56389941 ATGCTTGAGGAGAAAGCAGATGG - Intronic
1138717451 16:59040198-59040220 CTGGTATAGTGGAAAGAAGACGG - Intergenic
1138827016 16:60333058-60333080 ATGTTTTAGTATTAAGGAGGGGG - Intergenic
1138838246 16:60464732-60464754 ATGTTTCAGAAGAAAACAGAAGG + Intergenic
1139289917 16:65848471-65848493 AAGATTTAACAGAAAGAAGAAGG + Intergenic
1139576277 16:67844207-67844229 ATGTTTTTGTAAAAATAAAATGG - Intronic
1140833569 16:78773265-78773287 AAGTTGTAGTAGAAGGAACATGG - Intronic
1141869459 16:86774829-86774851 ATGTATTCATAGGAAGAAGAAGG + Intergenic
1142191715 16:88721199-88721221 ACGTTTTAGAAGAAGGAAGAAGG - Exonic
1142989450 17:3720391-3720413 ATCTTTTAGTAACTAGAAGATGG + Exonic
1145856179 17:28160344-28160366 ATGTTTTAGCAAAAACAAGTAGG - Intronic
1146032666 17:29379561-29379583 TTGTTCTAGTCGAAACAAGAAGG + Intergenic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1148004673 17:44416957-44416979 GTATTTTAGCAGAAAGAAGAGGG + Intronic
1148728910 17:49818525-49818547 CTGTTTTATTAGGAAAAAGAGGG - Intronic
1149081792 17:52666607-52666629 GTGTTTTAGGAGAAAGAATTGGG + Intergenic
1149085735 17:52713953-52713975 ATGATTCAGTAGAAAGAAACTGG - Intergenic
1149183743 17:53972805-53972827 TTGATTTTGTAGAAATAAGATGG + Intergenic
1149631592 17:58129793-58129815 ATATTTAACTAAAAAGAAGAAGG - Intergenic
1151065891 17:71149247-71149269 GTGTTTTAGTACAGAGAAAAAGG - Intergenic
1151911171 17:77084228-77084250 TTATTTTAGTAGAGACAAGAAGG - Intergenic
1153080775 18:1222084-1222106 ATGTTTGAGGAGACAGGAGAAGG - Intergenic
1155585019 18:27354939-27354961 ATGTTGTAGTAGGAACTAGAGGG + Intergenic
1155800328 18:30093476-30093498 ATGTTCTAGAAGAAAGCAAATGG - Intergenic
1155873016 18:31050665-31050687 ATTTATAGGTAGAAAGAAGAAGG + Intergenic
1156320666 18:36018748-36018770 AAGTATTAATAGAAAGAATATGG + Intronic
1156340057 18:36202602-36202624 ATGTTTTATAAGACAGCAGAGGG + Intronic
1156558492 18:38094399-38094421 AGGTTATAGGAGAAAGAAAAAGG + Intergenic
1156725752 18:40124392-40124414 ACGTTATAGAAGAAACAAGATGG + Intergenic
1157829298 18:50841762-50841784 ATGGTATAGTGGAAAGAATATGG + Intergenic
1158075004 18:53517722-53517744 ATTTTTGAGGAGAAATAAGAAGG + Intronic
1158316595 18:56217873-56217895 AAGCTTGATTAGAAAGAAGAAGG - Intergenic
1158819475 18:61142587-61142609 ATGTCATGGTAGAAAGAGGATGG + Intergenic
1158821470 18:61164149-61164171 ATGTTTTATTACAAAGGAAAGGG + Intergenic
1158928623 18:62297854-62297876 ATGTTTAAGTAAAAACATGAAGG - Intronic
1159303813 18:66613800-66613822 ATGTTTTACTAATAATAAGAAGG + Intergenic
1159540602 18:69769969-69769991 AAATTTTTGTAGGAAGAAGAAGG + Intronic
1163539548 19:17899365-17899387 GTATTTTAGTAGAGAGTAGAGGG + Intergenic
1164279958 19:23760362-23760384 AGGCTTTATTAGAAGGAAGAGGG + Intergenic
1164375288 19:27678737-27678759 GTGTCTATGTAGAAAGAAGAAGG - Intergenic
1164566898 19:29332298-29332320 TTTTTTTAGTAGAAACCAGAAGG + Intergenic
1166406159 19:42523289-42523311 ATGTTTCAGCAGAAATAACAGGG + Intronic
1168332036 19:55576230-55576252 ATGTTTGATTTGAATGAAGATGG - Intergenic
925472850 2:4181761-4181783 ATGTTTTGGTAGAAAAATGATGG - Intergenic
925825597 2:7845918-7845940 ATATTTCTGTAGAAAGTAGATGG + Intergenic
927042570 2:19244550-19244572 GTGGTTTAGTAGAAAGTTGAGGG - Intergenic
927115039 2:19891365-19891387 ATGTATTTGTACAAAGAAAAAGG + Intergenic
927377021 2:22429760-22429782 TTGTTTGAGTAAAAACAAGATGG - Intergenic
927410792 2:22823838-22823860 ATTTTTAAGTAGAAAGACCAAGG + Intergenic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
928271098 2:29855436-29855458 ATCTCTTGGTAGAAGGAAGAAGG - Intronic
929030823 2:37648749-37648771 ATGTTTTAACAGGAAGAACATGG - Intronic
929159256 2:38815234-38815256 ATTTTTTTGTAGAGAGATGAGGG + Intronic
929217682 2:39433375-39433397 ATTTTTTGCTAGAAAGAAGCAGG - Intronic
929226257 2:39514438-39514460 ATGGTTTTGTGGAAAGAACATGG + Intergenic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929797268 2:45069744-45069766 ATGTTTTAGGAGGAAGATGCAGG - Intergenic
929811685 2:45194118-45194140 ATGGCTTAGAAGCAAGAAGAGGG + Intergenic
930614813 2:53582611-53582633 AGGTTTTATTAGCAGGAAGATGG - Intronic
930901230 2:56509704-56509726 ATGTCTTAAAAGAAAAAAGAAGG + Intergenic
931327808 2:61245209-61245231 ATGTTTTGGTGGAGAGATGACGG - Exonic
931956029 2:67426217-67426239 ATGTTTTATGAGGAAAAAGAAGG - Intergenic
932118237 2:69073443-69073465 CTGTTTTAGTAGAAAATATAAGG - Intronic
932641358 2:73450515-73450537 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
932641388 2:73450800-73450822 GTGTGTGAGTAGAAAGTAGAGGG - Exonic
934962119 2:98685458-98685480 ATTTTAAATTAGAAAGAAGATGG + Intronic
936248125 2:110846242-110846264 CTCCTTTAGTAGACAGAAGAGGG + Intronic
938451868 2:131428210-131428232 GTGTTTTAGCAGAAGGAAGTTGG + Intergenic
938846189 2:135211647-135211669 ATGTTTTGGTAAAAAGAGCAAGG - Intronic
939063181 2:137449286-137449308 ATGTTTGTGTAGAATGATGAAGG + Intronic
939104872 2:137937452-137937474 ATGTGTTCCTATAAAGAAGAAGG + Intergenic
939208300 2:139137208-139137230 ATGTCTATGTAGAAAGAAGTGGG - Intergenic
939271873 2:139949523-139949545 ATGTTTTAGTTGCAAGAAAATGG - Intergenic
939451083 2:142375963-142375985 ACGTTTTAGTAATATGAAGAAGG + Intergenic
940321412 2:152381219-152381241 AGGTTTTAGTTGACAGAAGATGG + Intronic
940393357 2:153159128-153159150 CAGTTTTAGTATAAAGAAAATGG - Intergenic
941260817 2:163294741-163294763 ATGTTTTACAAGAAATAAGAAGG + Intergenic
941624432 2:167815130-167815152 ATGTGAGAGGAGAAAGAAGAAGG - Intergenic
942593454 2:177570002-177570024 CTGTTTAAATAGAAAGAATAGGG + Intergenic
942729292 2:179045946-179045968 AAGAATTAGTACAAAGAAGAAGG - Intronic
942843019 2:180387022-180387044 ATGAATCAGTAGAATGAAGATGG - Intergenic
943569244 2:189553585-189553607 ATGTATTTGTGTAAAGAAGAAGG - Intergenic
943823528 2:192358834-192358856 ATGTTCTATAAGAAAGAAAATGG - Intergenic
943856078 2:192793103-192793125 ATAGTTTACTAGAAAGATGAAGG - Intergenic
943904104 2:193475741-193475763 ATCTTTTAGCAGAAAAAGGAGGG + Intergenic
943909864 2:193549886-193549908 AAGTTTTAGTAGGAAGGATATGG - Intergenic
944299768 2:198110303-198110325 ATGTTTTAGATAAAAGCAGAAGG - Intronic
945194631 2:207226906-207226928 ATGCTTCAGTAGCAACAAGAGGG - Intergenic
945935437 2:215898707-215898729 ATGTTATGGTAGGAAGAAAAGGG - Intergenic
946076374 2:217076986-217077008 AGGTTGAACTAGAAAGAAGATGG - Intergenic
946838248 2:223794614-223794636 TTGATCTAGCAGAAAGAAGAGGG - Intronic
947072458 2:226305655-226305677 ATGTGTAACAAGAAAGAAGAGGG + Intergenic
947370850 2:229444154-229444176 ATGTTTTAGCAGAGAATAGACGG + Intronic
947860931 2:233356607-233356629 TTGTTTTAGGAGAAAAAAGAAGG - Intronic
947863850 2:233382282-233382304 ATGTTTCAGTGGAAAGAAGCTGG - Intronic
947955156 2:234183390-234183412 ATATTCCAGTAGAAAGGAGAAGG - Intergenic
948257945 2:236581653-236581675 ATGCTTGAGTAGAGTGAAGAGGG + Exonic
1169241998 20:3990101-3990123 ATATTTTAATACAAAGAATAAGG - Intronic
1170484851 20:16806002-16806024 TGGTTTTAATAGAAAGAGGAAGG - Intergenic
1170898006 20:20433968-20433990 ATGTCTGAGTACAAAGAACATGG - Intronic
1171172176 20:23025214-23025236 ATTTTTTAGTAGTGAGATGATGG - Intergenic
1171564270 20:26163991-26164013 CTGTTAGAGTAGAAAGAAAAAGG - Intergenic
1172473299 20:35217294-35217316 AAGTTTTACTACAAAGAAGAAGG - Intergenic
1173190474 20:40871976-40871998 TGGTTTTGGTAGAAAGAAGTAGG - Intergenic
1173557786 20:43979170-43979192 ATGTTCAAGTAGATAGATGATGG + Intronic
1174763951 20:53234206-53234228 ATGTTTTATTGGAAAATAGAAGG + Intronic
1175694893 20:61094818-61094840 ATGTTTTAATTAACAGAAGAGGG + Intergenic
1176458324 21:6932302-6932324 ATGTGTTCCTATAAAGAAGAAGG + Intergenic
1176836498 21:13797396-13797418 ATGTGTTCCTATAAAGAAGAAGG + Intergenic
1176960221 21:15151142-15151164 AAGATTGAGAAGAAAGAAGAAGG - Intergenic
1177609654 21:23430620-23430642 ATCTCGTGGTAGAAAGAAGAAGG - Intergenic
1177731781 21:25036510-25036532 ATGGTTTAGCAGAAATAATATGG - Intergenic
1178268250 21:31165351-31165373 ATGTAATAGTAGTTAGAAGAGGG + Intronic
1178463112 21:32821032-32821054 AAGTGTTATCAGAAAGAAGAGGG - Intergenic
1180453048 22:15485141-15485163 AAGTTATAGTAGAAAGAAAAGGG - Intergenic
1181784188 22:25214473-25214495 ATGAATTAGTAGAAAGAAACAGG + Intergenic
1182074538 22:27486966-27486988 ATGTTTTATTGGATAGAAGCAGG + Intergenic
1182253560 22:29021281-29021303 CAGTTTTAGTAGATAGCAGAAGG + Intronic
1182804152 22:33056805-33056827 TTGGTGTAGTAGAAAGAACAAGG - Intronic
951019787 3:17770043-17770065 AATTTTTAGGAGAATGAAGATGG + Intronic
951108946 3:18778257-18778279 AGGATGTGGTAGAAAGAAGAGGG + Intergenic
951501797 3:23396552-23396574 ATGATTTAGTAGAAAGAGCATGG + Intronic
951924391 3:27891588-27891610 ATGCCTTAGGAGAAAGAAAAAGG - Intergenic
951942064 3:28090426-28090448 ATGTGTTAGTATTAAGAAGTAGG + Intergenic
952008057 3:28865069-28865091 ATGTTTTAAAAGAAATAAAAGGG + Intergenic
952231386 3:31434380-31434402 ATGTTTCAAGAGAAAGGAGAGGG + Intergenic
952559494 3:34574107-34574129 AGGTTTTATTACAAAGGAGAAGG - Intergenic
952593304 3:34984284-34984306 ATGTTTTAGAAAAAATATGAAGG + Intergenic
952638898 3:35567671-35567693 AAGACTTAGTAGTAAGAAGATGG - Intergenic
953008914 3:39005263-39005285 CTGTTTTAGAAGAAACAACAAGG - Intergenic
953909031 3:46882648-46882670 ATGTTTTCGTAGAGAGAAAAGGG + Intronic
954186002 3:48917657-48917679 ATTTTTTTGTAGAAAGGAGGGGG + Intergenic
954623518 3:52009559-52009581 ATGTTTTACTGGGGAGAAGAAGG - Intergenic
954981149 3:54746709-54746731 ATATTTTTATAGAAAAAAGAAGG - Intronic
957158775 3:76581310-76581332 ATGGTTTGGTGGAAAGTAGAAGG + Intronic
957161356 3:76613662-76613684 ATGTATTTGTAGAAAGGAGAGGG + Intronic
958081027 3:88746674-88746696 AAGTTTCAGTAGAAAGAAAACGG - Intergenic
959538441 3:107513247-107513269 TTGTTTTTGAAGGAAGAAGATGG + Intergenic
959731225 3:109604702-109604724 AATTTTTACTAGCAAGAAGATGG - Intergenic
960166271 3:114405313-114405335 ACATTTTAGTAGAGAGAACATGG + Intronic
960263504 3:115594304-115594326 ATATATTAGTAGAAAAATGAAGG + Intergenic
960600776 3:119456205-119456227 GTGTTTTAAAAGAAAGAAGTTGG - Intronic
962012471 3:131405816-131405838 TTGGTTTATTAGAGAGAAGAGGG - Intergenic
962067680 3:131999168-131999190 ATGTTTGAGGAGAAAAACGAAGG + Intronic
963200410 3:142580271-142580293 ATGTTTTAGGAGAAAGGACATGG + Intergenic
963752286 3:149194825-149194847 AAGGTTCAGTAGAAAGAATAAGG + Intronic
964171729 3:153778749-153778771 ATGCTTAAGTAGAAAGCAGTTGG + Intergenic
964680484 3:159332414-159332436 ATGATTTAATGGAAAGAATATGG - Intronic
964993954 3:162851009-162851031 ATGAGTTCATAGAAAGAAGAGGG - Intergenic
965034728 3:163423872-163423894 ATGTTTTTAAAAAAAGAAGAAGG + Intergenic
965777813 3:172251379-172251401 CTGCTTTTGTAGATAGAAGAAGG - Exonic
965911033 3:173776061-173776083 AAGGTTTAGTAAAAAGATGAAGG - Intronic
966703408 3:182882464-182882486 ATTATTTAGTAGAAAAAAAATGG + Intronic
967161776 3:186745572-186745594 ATGTTTTAGCAGAAAAATAAGGG + Intergenic
967591417 3:191279436-191279458 ATGTTTTCATTGAAAAAAGAAGG + Intronic
968394166 4:217996-218018 ATGTTTTAGTTTAAAAAACAGGG - Intergenic
968411256 4:392587-392609 ATGTTTTAATTTAAAGAACAGGG - Intergenic
968855608 4:3118864-3118886 AGTTTTTAGTCAAAAGAAGATGG - Intronic
969665887 4:8557471-8557493 AATTTTTAGTGAAAAGAAGAAGG + Intergenic
969762241 4:9196369-9196391 ATGTCTTAGATGAAAAAAGATGG - Intergenic
969943822 4:10762204-10762226 ATGTTCTAGTGGAAAAGAGATGG + Intergenic
970454439 4:16208561-16208583 GTCTTCTAGTAGAAAGATGACGG - Intronic
970690912 4:18619526-18619548 AGGTGTTAGTATAAAGCAGAAGG + Intergenic
970765824 4:19547757-19547779 AGGCATAAGTAGAAAGAAGATGG + Intergenic
972020488 4:34307547-34307569 ATGTTATTGAAGAAACAAGAGGG - Intergenic
972876527 4:43368012-43368034 CTGTTCTATTAGAAAGATGAAGG - Intergenic
973255900 4:48113047-48113069 ATGTTCTAGAAGAAAGTAAAAGG - Intronic
973573365 4:52262382-52262404 ATGATTTAGAAGAAAGATGAAGG + Intergenic
973735195 4:53864651-53864673 AAGTTTGAGTAGGAAGATGAAGG + Intronic
973938679 4:55880030-55880052 ATGCTTCAGAAGAAAGCAGAAGG + Intronic
974081264 4:57215699-57215721 ATGTTTTAGAAGAAAACAAAGGG + Intergenic
974272221 4:59665115-59665137 AGGTTTTAGTTAAAAGAAAATGG - Intergenic
974629758 4:64471427-64471449 AGGTCTTAATATAAAGAAGATGG + Intergenic
974771609 4:66421956-66421978 ATGTTTAAATAGAATAAAGATGG - Intergenic
974921002 4:68238798-68238820 ATAAAATAGTAGAAAGAAGAGGG - Intronic
975366335 4:73533281-73533303 ATGGTTTAGAAGAAAGAAGAGGG - Intergenic
975609266 4:76188398-76188420 ATGTTTTTGGAAAAAGATGATGG - Intronic
975697385 4:77026688-77026710 ATTGTTTGTTAGAAAGAAGAGGG + Intronic
976108122 4:81641242-81641264 ATGATTTAGCAGAAAGAATGGGG - Intronic
976147648 4:82057958-82057980 ATGTTTTAGGATAAAGATGGTGG - Intergenic
976318279 4:83682869-83682891 CTGTTTTAGTGGCAAGAAGAAGG - Intergenic
976825599 4:89257012-89257034 ATGTTTTTAAAGAAAGAAGAAGG - Intronic
976904200 4:90216316-90216338 ATGCCTTAGTACACAGAAGAAGG - Intronic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977640968 4:99358038-99358060 TTTTTTTAGTGGAAAGAATATGG - Intergenic
978497701 4:109377791-109377813 ATATTGTAGGAGAAAGACGATGG + Intergenic
978520829 4:109613192-109613214 ATATTGGAGTAGAAAGTAGAGGG + Intronic
978588515 4:110299124-110299146 ATGTTTCAATAGAAATAGGATGG + Intergenic
978734006 4:112064641-112064663 ATGTTTTACAACAAAGATGAAGG - Intergenic
979048927 4:115904848-115904870 ATGTTGAAGGAGAATGAAGAGGG + Intergenic
980108067 4:128607532-128607554 ATGAATTGGTAGAAAGTAGAAGG + Intergenic
980161916 4:129174822-129174844 ATATTTTTGAAGGAAGAAGAAGG + Intergenic
980457451 4:133063880-133063902 CTGTTTTTTAAGAAAGAAGATGG - Intergenic
980782674 4:137512043-137512065 ATGTTGTAAGAGAAAGAAGACGG + Intergenic
981006536 4:139880903-139880925 ATATTTAAGAACAAAGAAGATGG + Intronic
981176036 4:141684658-141684680 AAGTTTGAATAGAAAGAAGGAGG - Intronic
981855279 4:149282220-149282242 ATTTTTTAGTACAAAGTAGAAGG - Intergenic
981955622 4:150469861-150469883 ATGTGTTATTAAAGAGAAGATGG - Intronic
982460650 4:155665863-155665885 ATTCATTAGTAAAAAGAAGAGGG - Intergenic
982538206 4:156633402-156633424 TTGTTTTTGTAGAAACAAAATGG + Intergenic
982781859 4:159499731-159499753 CTCTTTTAATAGAAAGATGATGG - Intergenic
983105193 4:163678155-163678177 ATGTTTTAGTATAAGAAATAGGG - Intronic
983264330 4:165492187-165492209 ATGTTGATTTAGAAAGAAGATGG - Intronic
983319714 4:166180402-166180424 ATGTTTTGGTAGAAGGAAGGAGG + Intergenic
984469302 4:180146174-180146196 ATGATTTAATAGAAGGAACATGG + Intergenic
984792677 4:183628813-183628835 ATGATTCAGTAGAAAGAAAGCGG + Intergenic
986111237 5:4720707-4720729 AGGTTGCAGTAGTAAGAAGAAGG - Intergenic
986120478 5:4831139-4831161 ATGTTTTAATAAAAATATGAAGG - Intergenic
987265239 5:16246535-16246557 AGGCTTAAGAAGAAAGAAGAAGG - Intergenic
987875072 5:23671380-23671402 ATGGTTTAGTTCAAAGAACATGG + Intergenic
988095565 5:26604918-26604940 ATGTTTTATTAGCATGAAAATGG + Intergenic
988777247 5:34488753-34488775 ATGTTTTATTAAAAATAAAAAGG - Intergenic
988874633 5:35430368-35430390 ATGTTGTAGTAAACAGAAGTAGG - Intergenic
990191318 5:53263301-53263323 ATGTGTGAGTAGAAAGCAGAGGG - Intergenic
990755597 5:59066061-59066083 TTCTTTTAGTAGAAGGAATAAGG - Intronic
990788513 5:59450618-59450640 GTATTTGAGAAGAAAGAAGAAGG - Intronic
992550345 5:77853457-77853479 ATTATTTATTAGAAAGGAGATGG - Intronic
992579831 5:78160729-78160751 ATCTTTTAATACAAAGAGGAAGG + Intronic
992611660 5:78513345-78513367 ATGTTTTAGCATAAAGGAGAGGG - Intronic
993515082 5:88822088-88822110 ATGCTTTATTAGAAAAAACAGGG - Intronic
993605353 5:89984180-89984202 ATGGTTTAATAGAAAAGAGATGG - Intergenic
994263645 5:97688883-97688905 ATGTTTTACAATGAAGAAGACGG - Intergenic
994362915 5:98875697-98875719 ATTTTCTGGTAGAAAGAATAAGG + Intronic
994537070 5:101045644-101045666 ATATTTTAGTAGAAAATAGTAGG + Intergenic
995740358 5:115349618-115349640 ATTTTTCATTAGAAAGAAGATGG - Intergenic
995900191 5:117056542-117056564 ATGTCTTTATAGAATGAAGAAGG - Intergenic
996608081 5:125347180-125347202 ATGTTGCAGCAAAAAGAAGAAGG + Intergenic
997313477 5:132911287-132911309 GATTTTTAGTAGAAAGATGAGGG - Intronic
997858315 5:137392945-137392967 ATGTGTTAGGAGAAAGAGGCTGG - Intronic
998124599 5:139608737-139608759 TTGTGTTAGTAGGAAGAACAGGG + Intronic
998384911 5:141751520-141751542 ATAATTTACTAGAAGGAAGATGG + Intergenic
998677619 5:144427186-144427208 ATGTTTCAGGATAAAGAAGTTGG + Intronic
999360415 5:150981224-150981246 ATTTTCTAGTAGAAAGAAATTGG + Intergenic
999553124 5:152711740-152711762 GAGTTTTACTAGAAACAAGATGG - Intergenic
999609355 5:153352460-153352482 GTGCTATAGTTGAAAGAAGATGG - Intergenic
1000402791 5:160849741-160849763 ATTGTTTAGTAGAAAAAAAACGG - Intronic
1000876605 5:166646893-166646915 ATGTCATAGGAGAAAGCAGAAGG - Intergenic
1000933939 5:167285399-167285421 ATATTTTAGTAGAGGGAAAAGGG - Intronic
1001186043 5:169573874-169573896 ATGTTTTTATAGGAACAAGAAGG - Intergenic
1001222454 5:169913395-169913417 GTGTTTTTGGAGAAAGAGGAGGG - Intronic
1001967999 5:175926892-175926914 ACATTTTTGTAGAAAGAAGAAGG + Intronic
1002249444 5:177916912-177916934 ACATTTTTGTAGAAAGAAGAAGG - Intergenic
1002957063 6:1876529-1876551 AGGTTTGAGTAGAAAGACGAGGG + Intronic
1003595531 6:7470940-7470962 TTGTTTCAGTAGAGAGATGAGGG - Intergenic
1003596259 6:7476808-7476830 TTGTTTCAGTAGAGAGATGAGGG + Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1004078627 6:12368963-12368985 GCGTTTTAGAAGAAAGAAGGTGG + Intergenic
1004554453 6:16682114-16682136 ATCTTTAATAAGAAAGAAGAAGG - Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1004827602 6:19440390-19440412 ATGGTGTAGTGGAAAGAACATGG - Intergenic
1005344125 6:24872724-24872746 ATGTCTTAGAAGGAAAAAGAAGG - Intronic
1006254744 6:32821721-32821743 ATGTGTTAGGAGGAAGTAGAAGG - Intronic
1006953141 6:37842137-37842159 ATGTGATAGTATAAAGAAGTGGG - Intronic
1007701841 6:43770369-43770391 ATGTTTAAGAAAAAAGAAGAGGG - Exonic
1008016279 6:46523752-46523774 ATGTTCCAGTAGACATAAGATGG - Intergenic
1008289744 6:49700205-49700227 ATATTTTAATAGTAATAAGATGG + Intronic
1008336949 6:50318005-50318027 ATGTTCTGGGAGACAGAAGACGG + Intergenic
1010048454 6:71474892-71474914 ATGTTTTAGTAGAAATGGCATGG - Intergenic
1010377394 6:75187186-75187208 ATGTTTAAGTAGAAAATAGTAGG + Intronic
1010808575 6:80269157-80269179 ACGTTTGGGTAGAAAGAAAATGG + Intronic
1012082414 6:94777615-94777637 GTGTTTTAGTAGTGAGCAGAAGG + Intergenic
1012223567 6:96679693-96679715 AAGTTTGTTTAGAAAGAAGATGG - Intergenic
1012696646 6:102392117-102392139 ATGTTTAATGAGAATGAAGAAGG - Intergenic
1013029225 6:106314839-106314861 ATGTTTTTCTAGACAGAAAACGG + Intronic
1013402988 6:109816741-109816763 AAAGTTTATTAGAAAGAAGATGG + Intronic
1013744098 6:113323998-113324020 ATTTGTTAGTAGAATCAAGAAGG + Intergenic
1013798667 6:113914350-113914372 ATGTTTAAGAAGATAGAAAATGG - Intergenic
1013821845 6:114163479-114163501 ATTATTTAGTGGAAAGAATATGG + Intronic
1014255026 6:119152399-119152421 ATTTATTAGTAAGAAGAAGATGG + Intergenic
1014292301 6:119572727-119572749 TTCTTTAAATAGAAAGAAGATGG + Intergenic
1014648530 6:124006347-124006369 ATGTTTTACTGGAAAAAAGCTGG + Intronic
1015131262 6:129812673-129812695 ATGTTGTGGTACAAATAAGATGG - Intergenic
1015148513 6:130014617-130014639 ATATTTTAGTACAAATAATATGG - Intronic
1015467665 6:133565675-133565697 ATGTTTTAAGAAAAAGAAGTGGG + Intergenic
1015914781 6:138204822-138204844 AGTGTTTAGTAGAAAGAACATGG - Intronic
1016164698 6:140926169-140926191 TTTTCTTAGTTGAAAGAAGAAGG + Intergenic
1016261684 6:142178975-142178997 ATGTGTTACTAGAAATAAAAGGG + Intronic
1017219130 6:151945331-151945353 GTGTTTTAGGAGAAAGAGAAAGG + Intronic
1017285347 6:152668259-152668281 CTGTTTTTGTAGAAAGACAAGGG + Intergenic
1017574093 6:155782323-155782345 GTGTTTTAGTAGAAGGAGCATGG + Intergenic
1018062768 6:160103542-160103564 GTGATTGAGTGGAAAGAAGATGG - Intronic
1018227551 6:161643763-161643785 TTGTTTTAGTAGTAAAAAGTGGG - Intronic
1018335053 6:162777915-162777937 ATGTTTTGGGAGAAAGGAGATGG - Intronic
1018728735 6:166633041-166633063 ATTTTTTAGTAGAGAAAACATGG - Intronic
1020433623 7:8138566-8138588 ATGCTGTAGTAGAAAAAACATGG - Intronic
1020743193 7:12048541-12048563 ATGTTTTGGGAGGAAAAAGATGG - Intergenic
1021400304 7:20202461-20202483 GTGTTTTAGAGGAAAGAAAATGG + Intronic
1021511997 7:21443392-21443414 ATGTTTTGGTAGACAGTTGAAGG + Intronic
1021899843 7:25274123-25274145 ATGTTTTTGAAAACAGAAGATGG + Intergenic
1022936610 7:35185582-35185604 AGGTCTGAGTAGAAAGAAGTTGG - Intergenic
1023098652 7:36690078-36690100 ATGTGTAAGTACAAAGAAGCAGG - Intronic
1023342928 7:39241227-39241249 AGGTTTTCTTAGAAAGAAGGAGG + Intronic
1023475076 7:40568714-40568736 ATTTATTATTAGAAAGATGATGG + Intronic
1023484189 7:40666517-40666539 ATGTTTTCAAAGAATGAAGAAGG + Intronic
1023897254 7:44444308-44444330 ATGCTTTCTCAGAAAGAAGAGGG - Intronic
1023958462 7:44906902-44906924 ACATGTTAGTAGAAAGTAGAAGG - Intergenic
1024801450 7:53085135-53085157 ATGGTTTAGTTGAATGAAAATGG + Intergenic
1025854491 7:65265556-65265578 AGATTTTATTAGAAGGAAGAGGG + Intergenic
1025998895 7:66545785-66545807 ATGTTTCAGGAGAAAGAGGCAGG - Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1026621170 7:71950998-71951020 ATGTTATGGTAGAAATAAAACGG - Intronic
1026991953 7:74591131-74591153 ATGTTTCAGGAGAAAGAGGCAGG - Intronic
1027529873 7:79316940-79316962 TTATTATAGTAGAAAGAACATGG - Intronic
1028251491 7:88543995-88544017 ATGTAATGGTATAAAGAAGAAGG + Intergenic
1028330329 7:89582961-89582983 ATGTCTTTGAAGAAAGAAGACGG - Intergenic
1028432636 7:90765100-90765122 ACCTCTTAGGAGAAAGAAGAGGG + Intronic
1028748295 7:94353061-94353083 ACGTTTTAGCAGAAAGAATGAGG - Intergenic
1029913769 7:104184451-104184473 ATTTTTTTTTAGAAAGAAGCAGG - Intronic
1030211851 7:107004497-107004519 ATGTGACAGTAGAAAGAACACGG + Intergenic
1031388658 7:121185584-121185606 AGGTTTTAGTATAAAGTGGATGG + Intronic
1032696700 7:134342951-134342973 TTGATTAAGAAGAAAGAAGAAGG - Intergenic
1032760538 7:134937068-134937090 ATGTCTTTATAGAAAGAAGTGGG + Intronic
1032926465 7:136611441-136611463 CTGTTTTGGTAGCAAGATGATGG + Intergenic
1033465536 7:141585962-141585984 ATGGTGTAGTGGAAAGAACATGG + Intronic
1033512614 7:142074701-142074723 ATGTTCTGGTAGAAAAGAGAAGG + Intronic
1033984063 7:147200983-147201005 ATATTTTAGAAGAGTGAAGATGG + Intronic
1037348978 8:17929075-17929097 ATGTATTATTGGAAGGAAGAGGG - Intronic
1038254674 8:25940584-25940606 ATTTTTTGGTAAAATGAAGATGG - Intronic
1038321594 8:26532052-26532074 ATGTTTGTGTAGAGAGAGGAAGG + Intronic
1038847215 8:31241397-31241419 ATTTTTTAGTTGATAGAAGCAGG + Intergenic
1038890730 8:31719897-31719919 ATGATTTAGTAGGAGAAAGAAGG + Intronic
1039287468 8:36058038-36058060 AAGTGTTACTAGAAAGAAAAGGG + Intergenic
1039619871 8:38986774-38986796 GTGATTTAGTGGCAAGAAGATGG + Intronic
1039909518 8:41813465-41813487 ATGTTTCAGTAGAAACTATAGGG - Intronic
1039998124 8:42552649-42552671 ATGATTTAGTAGAAAGAATCAGG - Exonic
1040836640 8:51738334-51738356 ACGTTTTGGGAGACAGAAGATGG - Intronic
1041422076 8:57678596-57678618 ATATTTTTGCAGAAATAAGAAGG - Intergenic
1041550855 8:59099329-59099351 TTGGTATGGTAGAAAGAAGATGG - Intronic
1042136658 8:65639105-65639127 ATACTGTAGTAGAAAGAATATGG - Intergenic
1042451347 8:68950577-68950599 CTATTTCAGTTGAAAGAAGAAGG - Intergenic
1042842884 8:73141867-73141889 ATTTTTTAAAAGAAATAAGAAGG + Intergenic
1042975745 8:74467183-74467205 AAGTTTGAGGAGAAAGGAGAAGG + Intronic
1043238574 8:77901012-77901034 ATTTCTTATTAGATAGAAGATGG + Intergenic
1043958848 8:86391908-86391930 ATGTTATAGGAGACAGAGGAAGG + Intronic
1044022063 8:87117075-87117097 ATGTTCAAGTAGATATAAGATGG - Intronic
1045745875 8:105421367-105421389 ATGTTTAATTTGAAAGTAGAAGG + Intronic
1045840043 8:106569249-106569271 ATCATTGAGAAGAAAGAAGAAGG - Intronic
1045971684 8:108085409-108085431 TTCTTTGTGTAGAAAGAAGAGGG + Intergenic
1046456237 8:114466435-114466457 TTGTTTTATTAGAATGATGAAGG + Intergenic
1048349712 8:133606338-133606360 ATATTTTAAAAGAAAGGAGAAGG - Intergenic
1048349718 8:133606378-133606400 ATATTTTAAAAGAAAGGAGAAGG - Intergenic
1048710367 8:137203329-137203351 AGTTTGTAGTAGAAAGAACATGG - Intergenic
1049028184 8:140012144-140012166 AGCTTTTAGAAGAAAGAAGTGGG + Intronic
1049057569 8:140250884-140250906 TTGTTTTAAAAGATAGAAGAAGG + Intronic
1049130973 8:140840482-140840504 ATGTGTAAGTTGGAAGAAGATGG + Intronic
1050135405 9:2458206-2458228 AGGTTTTAGTTGAAAGGGGAAGG + Intergenic
1050321691 9:4459079-4459101 ATGTTTTAGTAGAAACACTCTGG + Intergenic
1050446710 9:5730557-5730579 ATGATTTAAAAGAAAGAAGGAGG + Intronic
1050466262 9:5927364-5927386 ATGATTTAGTAGACAAAAAATGG - Intronic
1050519726 9:6484712-6484734 ATTTATTAATAGAAATAAGAAGG - Intronic
1050927043 9:11276651-11276673 ATGCTTTAGACCAAAGAAGATGG - Intergenic
1051352601 9:16212633-16212655 ATGCTTGGGGAGAAAGAAGAGGG + Intronic
1051956831 9:22705694-22705716 GTATTTTAGAAGGAAGAAGAGGG + Intergenic
1053117181 9:35515526-35515548 ATATTATAGTAGAAAGAGCAAGG + Intronic
1053132173 9:35622035-35622057 ATGATGTAATAGAAAGAATAGGG + Intronic
1053179508 9:35956442-35956464 ATGTTCTAGAAAAAAGATGATGG - Intergenic
1054826598 9:69579741-69579763 ATGTTATAATTGAAATAAGATGG + Intronic
1054896850 9:70323076-70323098 ATGGTGTAGTGGAAAGAACATGG + Intronic
1054998735 9:71424343-71424365 ACGTTTTAGTGGAAAAAAAATGG - Intronic
1055543400 9:77339807-77339829 ATGTTACAGTACAAAGCAGACGG + Exonic
1055726896 9:79240184-79240206 AACTTTTAGTAGAAGGAAGAAGG + Intergenic
1056277094 9:85003970-85003992 CTATTTAAGGAGAAAGAAGAAGG + Intronic
1057482038 9:95452284-95452306 ATCTTCAAGTAAAAAGAAGAGGG - Intronic
1057515568 9:95717533-95717555 TTGTGTTATCAGAAAGAAGATGG + Intergenic
1057527459 9:95815632-95815654 GTGTCATAGTAGAAAGAACATGG - Intergenic
1057646409 9:96879036-96879058 ATGTTTTAATGGAAAGAAAGTGG + Intergenic
1057960632 9:99453122-99453144 ATTTTTGAATAGAAAGAAGCTGG - Intergenic
1059267063 9:113044429-113044451 ATGTTGTAGTAAAAAGAGGTGGG + Intronic
1060131720 9:121106619-121106641 AAGTTTGAGAAGAAAGAGGAAGG + Intronic
1060166787 9:121423966-121423988 ATGTTTTAGCTGCAAGAAGTGGG - Intergenic
1060254447 9:122014805-122014827 ATGATGTAGTGGAAAGATGACGG + Intronic
1185799555 X:2997462-2997484 ATTTTTTAGTATAAAGTAAAGGG + Intergenic
1185835500 X:3342885-3342907 ATGTTTTAGTAAAAATAAAATGG - Intronic
1187551238 X:20307561-20307583 GTGTTGTAGTGGAAAGAATATGG - Intergenic
1187585163 X:20652502-20652524 AGGTTTTCTTAGAAAGATGAAGG + Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188324620 X:28785644-28785666 ATGTATTAGGAAAAACAAGAAGG - Intronic
1188679331 X:32982539-32982561 CTGTTTTAGTGGGAAGAGGAAGG - Intronic
1188985271 X:36763363-36763385 ATGTCTTAGTAGAAGAAAAATGG - Intergenic
1189365580 X:40385419-40385441 CTGTTTCCGTAGAAAGAATATGG - Intergenic
1189402385 X:40683361-40683383 ATGATATAGTACAAAGAATAAGG + Intronic
1189758523 X:44297245-44297267 TTGGTATAGTAGAAAGAACAAGG - Intronic
1189883949 X:45520565-45520587 CTTTTTTAATAGAAAGTAGATGG - Intergenic
1192077509 X:68015395-68015417 ATGTTTGAGGAAAAGGAAGAAGG + Intergenic
1193692039 X:84658335-84658357 TTGTTTTGGTGGAAAAAAGAGGG - Intergenic
1194173614 X:90619648-90619670 ATGTTTTGTTAGAAAGCACATGG - Intergenic
1194590054 X:95789378-95789400 ATGTTTCAGTAGAAAAATGAAGG + Intergenic
1194726367 X:97402141-97402163 ATGTTTTAGTTTTAAGAACATGG - Intronic
1195783751 X:108493563-108493585 ATGTGTTAGTAGAAATCATAAGG + Intronic
1196323069 X:114366943-114366965 ATATTTTTATATAAAGAAGAGGG + Intergenic
1196429201 X:115604571-115604593 ATGTTTTAACAGAAAGATGTTGG - Intronic
1196545042 X:116952843-116952865 ATGGTGTAGTGGAAAGATGATGG + Intergenic
1197737309 X:129861264-129861286 ATGTATTAGCAGGAAGAAAAAGG + Intergenic
1197891134 X:131271730-131271752 ATGTTTTAGAAGGAAAAAAATGG - Intergenic
1198642686 X:138774097-138774119 ATGATCTAGTAGAAAAAAGTAGG + Intronic
1199153294 X:144516037-144516059 TTGTTTTTGTGGAAAGATGAAGG - Intergenic
1199561498 X:149168482-149168504 ATGTTTTAAGGCAAAGAAGAAGG + Intergenic
1199739503 X:150720093-150720115 ATATTTTATTAAAAAGTAGAGGG - Intronic
1199835373 X:151585034-151585056 ATGTTTTAGGATATAGAAAATGG + Intronic
1200013403 X:153138856-153138878 ATTTATTAGTGGAAAGCAGAGGG + Intergenic
1200026199 X:153261062-153261084 ATTTATTAGTGGAAAGCAGAGGG - Intergenic