ID: 905601785

View in Genome Browser
Species Human (GRCh38)
Location 1:39258515-39258537
Sequence TGGGTGTGATGGCCGCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905601785_905601789 4 Left 905601785 1:39258515-39258537 CCTTGCAGCGGCCATCACACCCA 0: 1
1: 0
2: 0
3: 9
4: 173
Right 905601789 1:39258542-39258564 CATCTTGAAGAATATTCACATGG 0: 1
1: 0
2: 2
3: 22
4: 282
905601785_905601790 12 Left 905601785 1:39258515-39258537 CCTTGCAGCGGCCATCACACCCA 0: 1
1: 0
2: 0
3: 9
4: 173
Right 905601790 1:39258550-39258572 AGAATATTCACATGGTCACATGG 0: 1
1: 0
2: 0
3: 32
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905601785 Original CRISPR TGGGTGTGATGGCCGCTGCA AGG (reversed) Intronic
900100192 1:959226-959248 TTGGTGTCATGGCAGCTGCGGGG - Exonic
900132527 1:1093441-1093463 TGGCTGTGGTGGCAGCTTCAAGG - Intronic
900233373 1:1574327-1574349 TGGTTGGGATGGCAGCTGGACGG - Intronic
900362024 1:2293736-2293758 TGGGTCTGGTGGCTGCTGCCCGG + Intronic
900621329 1:3588843-3588865 TGGGAGTGAGGGCTGCTTCATGG - Intronic
901845633 1:11980448-11980470 TGAGTGTGATGGCCGCCGCGAGG + Exonic
902426840 1:16330380-16330402 TGGGTGTGGTGGCAGCTACTTGG + Intronic
902735955 1:18400868-18400890 TGGGTGTAATGGGCTCTGAAAGG - Intergenic
903670283 1:25031309-25031331 TGGGAGGGATGGACGCTGTAAGG + Intergenic
905601785 1:39258515-39258537 TGGGTGTGATGGCCGCTGCAAGG - Intronic
905861316 1:41353892-41353914 TGGGTGAGAGGGCCTCTGAACGG + Intergenic
906153800 1:43602537-43602559 AGGGGGTGGTGGCAGCTGCAGGG + Intronic
907805607 1:57816287-57816309 TGGGAGTCATGACGGCTGCATGG - Intronic
911101994 1:94102541-94102563 TGGCTGTGATGGGTGCTGCAAGG - Intronic
913088810 1:115462202-115462224 TGGGGGTGAAGGCCACTGGAAGG - Intergenic
913576106 1:120176683-120176705 TGGGTGCAATGGCCGCTCAAAGG - Intergenic
914900913 1:151710584-151710606 GGGATGGGATGGCCCCTGCAGGG - Intronic
916597273 1:166256776-166256798 TGGCAGTGATGGTGGCTGCATGG + Intergenic
919727780 1:200895154-200895176 GGGGGGTGATGGCCACTGCTTGG - Intronic
920351823 1:205343019-205343041 TGGGGGTGGTGGCACCTGCAAGG + Intronic
922483371 1:225955010-225955032 TGGATGGGATGACCTCTGCAAGG + Intergenic
922717414 1:227884766-227884788 CAGGAGTGATGGCCCCTGCAGGG - Intergenic
923227225 1:231949350-231949372 TGGGGGTGAGGGCCGGTGCCTGG + Intronic
924801243 1:247331060-247331082 GGTGTGTGATGGGCGCCGCAGGG - Intronic
1064190552 10:13202080-13202102 TGGGTGTGATGGCTCATGCCTGG + Intronic
1064348676 10:14556844-14556866 GGGGAGTGAGGGCCGCTGCCAGG - Intronic
1064923960 10:20549886-20549908 GGGATGTGATGGCAGGTGCAAGG + Intergenic
1069303647 10:66940352-66940374 TGGGTGTGATGGCACATGCTTGG + Intronic
1069772514 10:70908541-70908563 TGGGTGTCTTGGCCACTGCAGGG + Intergenic
1069813256 10:71178056-71178078 TGGGGGTGTTGGCCGCTGTCTGG - Intergenic
1070160299 10:73862793-73862815 TGGATGTGAAGGCCCCTGCCCGG - Intronic
1071451323 10:85793588-85793610 AGGGTCTGATGGTCTCTGCAGGG + Intronic
1074146366 10:110720677-110720699 AGGGTGGGATGGACACTGCAAGG - Intronic
1074394927 10:113089690-113089712 TGGGTGTGCTGACCGCTGATAGG + Intronic
1074840990 10:117350760-117350782 TGGGTGTGGTGGCAGGTGCCTGG + Intronic
1076226640 10:128781883-128781905 TGGGTGTGATAGCTACTGCTTGG - Intergenic
1076674291 10:132140275-132140297 TGGGTGTGAGGGGCGCTCTATGG - Intronic
1084488235 11:69463578-69463600 GGGGTGGGATGGGGGCTGCAGGG - Intergenic
1084644533 11:70447503-70447525 TGGGTGTGATGGCTGATGGCTGG + Intergenic
1085038577 11:73313828-73313850 TGGGGGTAATGGCCTCTGCCTGG + Intronic
1088597527 11:111451190-111451212 TGGGAGTGGTGGCTGATGCAGGG - Intronic
1088601241 11:111478100-111478122 TGGTGGTGATGGCAGCTGCAGGG - Intronic
1091110900 11:132965672-132965694 TGGGCGTGGTGGCCCTTGCATGG - Intronic
1091685164 12:2556315-2556337 TGGGTGTGAGGGTGGCTGCCTGG - Intronic
1092922894 12:13247973-13247995 TGGGTGGGAAGGCTGCTGCCTGG + Intergenic
1093749637 12:22783084-22783106 TGGGTGGGGTGGAGGCTGCAGGG + Intergenic
1096283153 12:50274440-50274462 TGGGTGTGGTGGCAGGTGCCTGG + Intronic
1096541896 12:52312686-52312708 TGGGTGTGCTGGCAGCAGTAAGG + Intergenic
1099295331 12:80822414-80822436 TGGGTGTGATGGCAGGCGCCTGG + Intronic
1101367192 12:104084313-104084335 TGGGAGTGGTGGCTGCTTCAGGG + Intronic
1102986799 12:117284907-117284929 TGGGTGTGGTGGCGGGTGCTTGG + Intronic
1103633567 12:122283598-122283620 TGGGTGTGGTGGCGGGTGCCTGG - Intronic
1103909565 12:124344820-124344842 TGGATGTGATGGCCGACGCCCGG - Exonic
1104177043 12:126342952-126342974 TGGGTGGGATGGAGGATGCAGGG + Intergenic
1105805968 13:23951724-23951746 TGGGAGTCATGGCAGCTGGATGG + Intergenic
1107317936 13:39153761-39153783 TGGGTGTGAAGGGGGATGCAGGG - Intergenic
1112723141 13:102269664-102269686 TGGGTGTGATGGCACATGCCTGG - Intronic
1114139617 14:19895133-19895155 TGGGTGTGCTGGAGGCTGGAAGG + Intergenic
1117074644 14:52089957-52089979 TGGGAGGGATGGCCCCTGGAAGG + Intergenic
1118698925 14:68413952-68413974 TGGGTGTAGTGGCCTCTGCTTGG - Intronic
1119409614 14:74422222-74422244 TGGGGGTGGGGGCAGCTGCAGGG + Intronic
1121024214 14:90602557-90602579 TGGGTATGATGGCGTGTGCATGG + Intronic
1122773212 14:104106280-104106302 TGGGTGTGGTGGCCCCTGTGGGG + Intronic
1123957254 15:25350342-25350364 TGTGTGTGTTGGCGGGTGCAGGG - Intronic
1124791175 15:32728803-32728825 TTGTTGTGATGGCCGCAGGAGGG + Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1131068729 15:89450640-89450662 AGGGTGTGCTGGTCCCTGCAGGG + Intergenic
1132908575 16:2297030-2297052 TGCGTGTGTTGGCCTCTCCAAGG + Intronic
1133745099 16:8680251-8680273 TGGATGTGATGGCTGCTTCCAGG - Intronic
1134241912 16:12512846-12512868 AGGGCGAGATGGCCTCTGCAGGG + Intronic
1134273631 16:12756549-12756571 TGGGTGTGATGGCACAGGCATGG + Intronic
1134821594 16:17251610-17251632 TGGCCGTGAGGGCCACTGCACGG + Intronic
1136005307 16:27325127-27325149 TGGCTGGGATGGCAGCTGGAAGG - Intronic
1136101223 16:27997792-27997814 TGGGTATGATGGACACTGCTTGG - Intronic
1139865010 16:70054682-70054704 TGGGTGTGATGGCGGGCGCCTGG - Intergenic
1142222511 16:88862462-88862484 TGGATGTGATGGCTGGTGCTGGG + Exonic
1143992773 17:10980692-10980714 TGGGTGTGATGGCACGTGCCTGG + Intergenic
1145782605 17:27572870-27572892 TGGCTGTGAAGGCCCCTGCGAGG - Intronic
1146085145 17:29821391-29821413 TGGGTGTGATGGCATATGCCTGG - Intronic
1147167521 17:38601420-38601442 TGGGTGTGAGGGGCAGTGCAAGG + Intronic
1151595518 17:75076084-75076106 AGGGTGTGATGGCAGCTTAAAGG - Intergenic
1151905598 17:77046526-77046548 TGGGAGTGGTGGCACCTGCATGG + Intergenic
1152061524 17:78079450-78079472 TGGCTGTGGCGGCTGCTGCATGG - Exonic
1158156419 18:54430613-54430635 TGTGTGTGAAGGCTGCTCCACGG + Intergenic
1158549002 18:58419073-58419095 AGGGTGTGCTGGCCCCTTCAGGG - Intergenic
1158732872 18:60045026-60045048 TGGGTGTGATGTGAGTTGCAAGG - Intergenic
1160160735 18:76468020-76468042 GGGGTGTGTTGGCTGCTGCAGGG - Intronic
1161089485 19:2352870-2352892 TGGGTGTCCTGGCCCCTGCCAGG + Intronic
1161252140 19:3285949-3285971 TGGGCGTGATGGCCGCGGTGGGG - Exonic
1161440993 19:4291546-4291568 TGGGAGTGATGCCAGCTGCGGGG + Intergenic
1162132930 19:8538095-8538117 TGGGTGTGGTGGCAGCTACTCGG - Intronic
1165291542 19:34889982-34890004 TGGGGATGATGGCCTTTGCAGGG - Intergenic
1165451696 19:35887567-35887589 TGGCTGTGATGCCCGCTGAGGGG - Intergenic
1165741412 19:38207249-38207271 GGGGTCTGGTGGCCGCTGCTCGG - Exonic
1166040029 19:40196658-40196680 TGGGTGTGGTGGCGGGTGCCTGG - Intronic
925182004 2:1823473-1823495 TGGGTGTGGTTGACGCTGGAGGG + Intronic
925911002 2:8573636-8573658 TGGGAGTGAAGGCCTGTGCAAGG + Intergenic
929846285 2:45532145-45532167 TGGTGGTGATGGCAGCGGCATGG - Intronic
931519638 2:63081843-63081865 TGGGTGTGGTGGCGGGTGCCTGG - Intergenic
933833957 2:86231262-86231284 TGGGGGTGATGGCCACCTCAGGG - Intronic
936250621 2:110865675-110865697 TGGCAGTGCTGGCCTCTGCAAGG - Intronic
936653998 2:114463092-114463114 TGGGTGTGCTGGTCACTACAGGG + Intronic
937318709 2:120948124-120948146 TGGGAGTGAGGCCCGCTGGAGGG + Intronic
937928063 2:127183023-127183045 TGGGTGTGCTTGCCTCTGCCGGG + Intergenic
938203478 2:129397292-129397314 TGGCTGTGATGAAAGCTGCAGGG - Intergenic
938307080 2:130263718-130263740 TGGGAGTGAGTGCAGCTGCAGGG - Intergenic
946277938 2:218644644-218644666 TGGGGGTGTTGGGCCCTGCATGG + Exonic
946890105 2:224266363-224266385 TGGGTGAGATGGCCTCTGTTAGG + Intergenic
947727283 2:232408416-232408438 TGGGTGTGCTGGGCACAGCAGGG + Intronic
948305007 2:236940234-236940256 TGGGTCTGGTGGGGGCTGCAGGG + Intergenic
1168803141 20:656591-656613 TGGCTGGGATGGCTGCTCCATGG + Intronic
1171409209 20:24934804-24934826 TGGGTTTGAGGGCCTTTGCATGG - Intergenic
1171489424 20:25506118-25506140 CGGGTGTGATGGCAGCCGCCTGG + Intronic
1173408896 20:42792182-42792204 TGGCTGTGATTCCAGCTGCAGGG - Intronic
1174650997 20:52125472-52125494 AGTGTATGATGGCTGCTGCAGGG - Intronic
1179904050 21:44412672-44412694 TGGGTATGATGTTAGCTGCAGGG + Intronic
1179970829 21:44836107-44836129 GGGGTGTGGTGGGGGCTGCACGG - Intergenic
1179970895 21:44836244-44836266 GGGGTGTGGTGGGGGCTGCAGGG - Intergenic
1180038434 21:45263294-45263316 TGCGTAGGAGGGCCGCTGCAGGG - Intergenic
1180736941 22:18024388-18024410 TGGGCGGGATCGCAGCTGCAGGG - Exonic
1181930291 22:26395456-26395478 TGGGTGTGGTGGCGGGTGCCTGG - Intergenic
1182858913 22:33542018-33542040 TGGGTGTGGTGGCGGCTGCCTGG + Intronic
1183248742 22:36713343-36713365 TGGGTGTGATGGCAGAGTCATGG + Intergenic
1183392955 22:37556252-37556274 TGGGTGTGTAGGCGGCTGGATGG + Intergenic
1184730658 22:46369418-46369440 TGGGTGTGGTGGGCGCTGTGGGG - Intronic
1184858083 22:47157480-47157502 TAGGTGTCCTTGCCGCTGCACGG + Intronic
1185398000 22:50602207-50602229 AGGTTGTGATGGCAGCTGCCAGG - Intronic
950095089 3:10324387-10324409 AGGGGGTGATGGCTGCTGCCTGG + Exonic
953474373 3:43193507-43193529 TGGGGCTGATGGCCTCTGCAGGG + Intergenic
954833853 3:53447455-53447477 TGGGTGTGCTGGCCTGTGCCTGG - Intergenic
955632527 3:60990067-60990089 TGGGTGTGATGGGCGGGGCTGGG - Intronic
961444691 3:126973745-126973767 TTGCTGTGATGGCCTCTGCTGGG + Intergenic
965723421 3:171686618-171686640 TGGTTGTGTTGTCTGCTGCATGG - Intronic
966065464 3:175816231-175816253 TGGGAGTGATGTCAGCTACATGG - Intergenic
966965372 3:184986541-184986563 TGCGTCTGATGGCTGCTGGAAGG - Intronic
967189709 3:186974853-186974875 TGGGGTTCATGGCAGCTGCAGGG + Intronic
967605420 3:191439592-191439614 TGAGTGTAATGGGTGCTGCAGGG - Intergenic
973855839 4:55009048-55009070 TTGGTGAGATGGTGGCTGCATGG + Intergenic
976359035 4:84155911-84155933 TGGGAGTGAGGGCAGGTGCAAGG - Intergenic
978354650 4:107858525-107858547 TGGGAGTGTTGACTGCTGCAAGG + Exonic
979155551 4:117384727-117384749 CGGGTGTGATGGCACATGCATGG - Intergenic
981528022 4:145726540-145726562 TGGGTGTGATGGTGGCTCCTGGG - Intronic
984261748 4:177451247-177451269 TGGGTGTGGTGGCCCATGCCTGG - Intergenic
984812790 4:183809538-183809560 TGGGTGTGATGGCACGTGCCTGG - Intergenic
985519438 5:366121-366143 TAGGTGTGATTGCTGCTGCTAGG - Intronic
988862256 5:35294624-35294646 TGGGTGTGGTGGCGTGTGCATGG + Intergenic
990471994 5:56123983-56124005 CGGATGTGGTGGCCGCTGAATGG + Intronic
996108840 5:119540318-119540340 TTGCTGTGATGTCCGGTGCATGG + Intronic
999149630 5:149418144-149418166 TGGGTGTGAATGCCGGTGAATGG - Intergenic
999447141 5:151649105-151649127 TGGGAGTGCTGGCCCCTCCAGGG + Intergenic
1003006729 6:2389499-2389521 TGGGTGTGCTGGAGGCTGAAGGG + Intergenic
1003193182 6:3891912-3891934 TGGCTGTAGTGGCCACTGCAGGG - Intergenic
1003628467 6:7765191-7765213 TGGGTGAGTTGGCTGGTGCAGGG + Intronic
1003955965 6:11165203-11165225 TGGCTGTGTTGGTTGCTGCAGGG - Intergenic
1006054250 6:31369373-31369395 TGGCTGTGATGGACACTACATGG + Intergenic
1006073483 6:31513955-31513977 TGGCTGGGATGGACACTGCATGG + Intergenic
1006597528 6:35204203-35204225 TGGGTGTGGTGGCGGATGCCTGG - Intergenic
1011554229 6:88557722-88557744 TGGGTGTGTTGGGGGGTGCAGGG + Intergenic
1013302966 6:108821400-108821422 TGGGTGTGGTGGCAGGTGCCTGG - Intergenic
1016110600 6:140218888-140218910 TGAGGGTGATTGCCTCTGCATGG + Intergenic
1019480545 7:1264750-1264772 TGGTTGTGTTGGCCGGGGCATGG - Intergenic
1019556691 7:1635103-1635125 TGGGTGTGAGGGCCCCTGGCTGG - Intergenic
1022736661 7:33082354-33082376 TGGGTGTGGTGGCTCCTGCCTGG + Intergenic
1028170446 7:87589641-87589663 TGGGTGTGATGGCATGTGCCTGG + Intronic
1029127883 7:98307659-98307681 TGGGCGTGATGGTCCCCGCAGGG - Intronic
1029362957 7:100100605-100100627 TGGGTGTGATGGCCAATGGCTGG - Intronic
1037653960 8:20867122-20867144 TGGGAGTGATGGCCCCAGCAGGG - Intergenic
1037674093 8:21039556-21039578 TGGGCGTGGGGGCTGCTGCAGGG - Intergenic
1038547096 8:28434100-28434122 TGGGTGTGGTGGCAGGTGCCTGG - Intronic
1038759863 8:30376349-30376371 TGGGTGTGGTGGCTGATGCCTGG - Intergenic
1039052663 8:33508998-33509020 TGGGTGTGGTGGCTGCTACTAGG + Intronic
1040801842 8:51350671-51350693 CGGGTGTCATGGCCGCTGCCAGG - Intronic
1044997618 8:97852166-97852188 TGGATGTGTTTGGCGCTGCATGG + Exonic
1049541361 8:143210636-143210658 TGGTCCTGATGGCAGCTGCATGG - Intergenic
1057633866 9:96744710-96744732 TGGGTGTGATGGCACTTGCCTGG + Intergenic
1061274350 9:129560975-129560997 TGAGTGTGATGGACACTGCCCGG + Intergenic
1061438973 9:130586525-130586547 TGGGTGTGGTGGCAGCTACTGGG - Intronic
1061678047 9:132229430-132229452 CGGGAGTGAGGGCTGCTGCAGGG - Intronic
1062401967 9:136376716-136376738 TGGGTGTGATGGCTGTCCCATGG - Intronic
1186853285 X:13601482-13601504 TGGGTTTGTTGGGGGCTGCAAGG - Intronic
1191966623 X:66766261-66766283 TGAGGGTGATGGCCTTTGCATGG + Intergenic
1192244538 X:69361737-69361759 TGGGTGAGCTGGCCGCTGGCTGG + Intergenic
1194571117 X:95555497-95555519 TGGGTGTGAAGGCCACTCTAAGG - Intergenic