ID: 905603096

View in Genome Browser
Species Human (GRCh38)
Location 1:39270817-39270839
Sequence AGCCTTATGCTGCTAGTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905603096_905603099 28 Left 905603096 1:39270817-39270839 CCTATCACTAGCAGCATAAGGCT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 905603099 1:39270868-39270890 GTGCCTAGAATTTCCTCTTTGGG 0: 1
1: 1
2: 0
3: 31
4: 237
905603096_905603100 29 Left 905603096 1:39270817-39270839 CCTATCACTAGCAGCATAAGGCT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 905603100 1:39270869-39270891 TGCCTAGAATTTCCTCTTTGGGG 0: 1
1: 0
2: 0
3: 25
4: 276
905603096_905603098 27 Left 905603096 1:39270817-39270839 CCTATCACTAGCAGCATAAGGCT 0: 1
1: 0
2: 0
3: 4
4: 102
Right 905603098 1:39270867-39270889 TGTGCCTAGAATTTCCTCTTTGG 0: 1
1: 0
2: 2
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905603096 Original CRISPR AGCCTTATGCTGCTAGTGAT AGG (reversed) Intronic
901730943 1:11279272-11279294 ATGCTTATGCAGCTATTGATAGG - Intronic
905603096 1:39270817-39270839 AGCCTTATGCTGCTAGTGATAGG - Intronic
906119934 1:43382660-43382682 GGCCTTATGCTGACATTGATTGG + Intergenic
910656288 1:89622200-89622222 AGCCTCATGCTGCTAGTAAGTGG - Intergenic
913315748 1:117549869-117549891 AGCCTTATGTTCCTACTGAAGGG - Intergenic
916654905 1:166866264-166866286 GGCCTTATCCAGCTAGTAATTGG - Intronic
917611916 1:176697306-176697328 ACCTTTATGCTGCTAGTATTGGG + Intronic
923392291 1:233524867-233524889 AACATTATGCTGATAGTCATAGG + Intergenic
1065637914 10:27750111-27750133 AACCTTATATTGCTTGTGATAGG - Intergenic
1068500150 10:57834020-57834042 AGCATTCTCCTGCTAGTGTTGGG - Intergenic
1073271029 10:102264284-102264306 AGCCTTATGCTGCCTTTGCTGGG - Intronic
1078616219 11:12868568-12868590 AGCTTTATGCTTCTACTAATTGG + Intronic
1079080802 11:17412509-17412531 TGCCTTATCATCCTAGTGATAGG - Intronic
1087490785 11:98824392-98824414 AGCCTTATACTAATAGTTATTGG - Intergenic
1092477366 12:8830577-8830599 AGGCTTATGATTCTAGGGATGGG - Intronic
1096171380 12:49473654-49473676 TTACTTATCCTGCTAGTGATGGG - Intronic
1104248988 12:127071725-127071747 AGCAAAATGCTGCAAGTGATTGG - Intergenic
1104602832 12:130164464-130164486 ATCTTTATGCTGCTGGTGGTGGG + Exonic
1105242133 13:18618419-18618441 AGCCTGAAGCTGCCAGTGTTTGG - Intergenic
1110337028 13:74345144-74345166 ACCCTTATGTTGGTAGTGGTTGG + Intergenic
1112149915 13:96747265-96747287 AGCCTTATGCTGCATTTGTTAGG - Intronic
1112732339 13:102378406-102378428 AGCCCTATGCTACTAGCTATAGG + Intronic
1114065723 14:19058629-19058651 AGCCTGAAGCTGCCAGTGTTTGG - Intergenic
1114096538 14:19341371-19341393 AGCCTGAAGCTGCCAGTGTTTGG + Intergenic
1114770491 14:25425264-25425286 ATTCTTATGCTGCTGCTGATGGG - Intergenic
1117856874 14:60043407-60043429 TTCATTATGCTGCTAGTCATAGG + Intronic
1118081030 14:62361227-62361249 AGCCTTAATCTGTTGGTGATAGG + Intergenic
1119916226 14:78404613-78404635 ATTATTATGCTGTTAGTGATCGG + Intronic
1123489182 15:20766179-20766201 AGCCTGAAGCTGCCAGTGTTTGG + Intergenic
1123545681 15:21335266-21335288 AGCCTGAAGCTGCCAGTGTTTGG + Intergenic
1126888357 15:53176430-53176452 AGCTCCATGCTGCTAGTGGTGGG - Intergenic
1130083727 15:80758955-80758977 AGCCTTATGCTACTTTAGATTGG + Intergenic
1130827438 15:87564100-87564122 AGCGTCTTGCTGCTAGTAATTGG + Intergenic
1202954025 15_KI270727v1_random:62536-62558 AGCCTGAAGCTGCCAGTGTTTGG + Intergenic
1132860732 16:2070552-2070574 AGCCGGATGCTGCTCGCGATTGG - Exonic
1133667785 16:7986458-7986480 AGCCTTATGTTGGTAAGGATGGG + Intergenic
1137789900 16:51166165-51166187 AGCCTTTTATTGCTAGTGATAGG + Intergenic
1138414835 16:56865706-56865728 AGCTTTGGGTTGCTAGTGATTGG - Intronic
1139104762 16:63815351-63815373 AGCCCCATGCTGCAAGGGATAGG - Intergenic
1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG + Intronic
1146472229 17:33133771-33133793 ATCCTTTTGATGGTAGTGATGGG - Intronic
1150803633 17:68301692-68301714 AGGCTTTTGCTGCGAGAGATGGG - Intronic
1151442324 17:74138385-74138407 AACCTAATGCTGCCATTGATAGG + Intergenic
1154446817 18:14441461-14441483 AGCCTGAAGCTGCCAGTGTTTGG + Intergenic
1156510034 18:37628520-37628542 AGCGATATGCTTCTAGTGAATGG + Intergenic
1158146892 18:54323927-54323949 AGCCTTCTCCTCCTAGTCATAGG - Intergenic
1158682786 18:59583612-59583634 GGCCTTAGGCTGCTATTTATAGG - Intronic
1166331630 19:42081134-42081156 TGCCTGATGCTGCTGCTGATGGG - Exonic
928097068 2:28411293-28411315 AGCCCTAGGCTGCTAGAGAGTGG - Intronic
935253897 2:101290997-101291019 AGCCACATGCTGATACTGATTGG - Intronic
935265646 2:101391637-101391659 AGCCTGATGCTGCTTCTTATAGG - Intergenic
939100515 2:137890295-137890317 AGCCTCCTGCTGCTGATGATTGG + Intergenic
939187851 2:138881466-138881488 TGCATTAGGCTGCTAGAGATAGG - Intergenic
939861506 2:147426435-147426457 ATGCTTATGCTACTAGTAATGGG - Intergenic
940744445 2:157552019-157552041 AGGATTATGCTGCTAGTGAGAGG + Intronic
945132248 2:206585240-206585262 AACCTTATGCAACCAGTGATCGG - Intronic
945526997 2:210900515-210900537 AGCTTTATGCTGTTAGAGACTGG + Intergenic
946285430 2:218699007-218699029 AGCCTTCTGCTGCTTGGGCTTGG + Exonic
1176449158 21:6848379-6848401 AGCCTGAAGCTGCCAGTGTTTGG - Intergenic
1176827326 21:13713403-13713425 AGCCTGAAGCTGCCAGTGTTTGG - Intergenic
1180259621 21:46660210-46660232 AGCCTAGTGCAGCCAGTGATGGG + Intronic
1180484204 22:15781221-15781243 AGCCTGAAGCTGCCAGTGTTTGG - Intergenic
1181916171 22:26282020-26282042 AGCCTTTTGCTGCTACAAATGGG + Intronic
950542008 3:13618413-13618435 AGCCTGAAGCTTCCAGTGATGGG + Intronic
950632078 3:14288834-14288856 AGCCTTAATCAGCTAATGATGGG - Intergenic
953809949 3:46103703-46103725 AGCCTTATGCTGTCAGTTGTAGG - Intergenic
956592638 3:70931533-70931555 AGCCTTATGCTGTTTGAAATCGG + Intergenic
958117616 3:89241941-89241963 AGCCTTAAGCTTATATTGATAGG + Intronic
959137882 3:102447606-102447628 AGCATTCTGATGCTAGTGAAGGG + Intronic
965102777 3:164322573-164322595 AGCCAAATGTGGCTAGTGATAGG - Intergenic
970659831 4:18272460-18272482 AGCCCTATGCTGTAAGTGAGTGG - Intergenic
972148442 4:36059430-36059452 AGCATTATTCAGCTAATGATTGG - Intronic
977114371 4:93004373-93004395 AGGCTGATGGTGCTGGTGATGGG - Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
987496475 5:18652185-18652207 AGCCATCTGGTGCTAGGGATTGG + Intergenic
989117284 5:37967404-37967426 AACTTTATGCTGCTACTGGTTGG + Intergenic
989245615 5:39250769-39250791 AGCTTCATGCTGCGAGTGCTGGG + Intronic
992079629 5:73222905-73222927 ACCCTTCTGCTGCTTGTGGTGGG + Intergenic
993793859 5:92241730-92241752 AGCCTTATTCTGGTAGATATCGG + Intergenic
995414601 5:111895046-111895068 AGCTTTATGCTGCTAATACTAGG + Intronic
997488990 5:134256853-134256875 AGGCTGCTGGTGCTAGTGATTGG - Intergenic
997615460 5:135243304-135243326 AGGCTCATGCGGCTAGTGAGTGG - Intronic
1011263238 6:85490109-85490131 GGCCTTATACTGATACTGATTGG - Intronic
1013056418 6:106587622-106587644 AGCCTCCTGCTGCTAGAAATTGG - Intronic
1016244670 6:141967785-141967807 ACCAATATGCTGATAGTGATAGG - Intergenic
1016759690 6:147723427-147723449 AGCCTTAAGCTGCTAGGGGAAGG - Intronic
1016870174 6:148808510-148808532 AGCCATATGCTACTAGGGGTGGG - Intronic
1016988918 6:149916198-149916220 AGACTGAAGCTGGTAGTGATGGG + Intergenic
1018354395 6:162997496-162997518 AGCATTATTCTGCTATTCATTGG - Intronic
1021901569 7:25290751-25290773 AGTCTTATCCTGCCAGTGGTGGG + Intergenic
1023615885 7:42018961-42018983 AGGGTTATGCTGCTGGGGATTGG + Intronic
1029574627 7:101395387-101395409 AGCATTCTGCAGCTTGTGATGGG + Intronic
1033231470 7:139601432-139601454 AGCCATATGCTTCTGGTGTTAGG + Intronic
1033777214 7:144625936-144625958 AGACTTATGATGCCAGTGAGTGG + Intronic
1034157021 7:148964395-148964417 CGCCTTGTGCTGCTGGTGAGAGG + Intergenic
1034289376 7:149916864-149916886 TGCTTTATGCAGCTATTGATTGG - Intergenic
1034661691 7:152775962-152775984 TGCTTTATGCAGCTATTGATTGG + Intronic
1046625563 8:116573209-116573231 AGCCATATGCTGGTCTTGATCGG + Intergenic
1049935043 9:493523-493545 AGTCTCATGCTGCTAGTTTTGGG + Intronic
1203520030 Un_GL000213v1:36137-36159 AGCCTGAAGCTGCCAGTGTTTGG + Intergenic
1190389882 X:49921597-49921619 AGCCTTATGCTGATTGGGCTAGG + Intergenic
1197882898 X:131187924-131187946 AGACTTAAGATGCTAGGGATAGG - Intergenic
1198632524 X:138656645-138656667 ACCCATATGCTTCTAGTGTTTGG - Intronic
1201344971 Y:12973028-12973050 ATCCTTATTCAACTAGTGATCGG - Intergenic
1201407679 Y:13664925-13664947 AGCATTATCCTGTTAGTGTTGGG + Intergenic