ID: 905607135

View in Genome Browser
Species Human (GRCh38)
Location 1:39311928-39311950
Sequence CTCACTCTTCTCTTCAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 206}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905607135_905607140 2 Left 905607135 1:39311928-39311950 CCAAACCTGAAGAGAAGAGTGAG 0: 1
1: 0
2: 1
3: 16
4: 206
Right 905607140 1:39311953-39311975 GGAAGTATGATTTTTACTGGTGG 0: 1
1: 0
2: 1
3: 33
4: 318
905607135_905607144 21 Left 905607135 1:39311928-39311950 CCAAACCTGAAGAGAAGAGTGAG 0: 1
1: 0
2: 1
3: 16
4: 206
Right 905607144 1:39311972-39311994 GTGGAGAGGGAGGTAATATGAGG 0: 1
1: 0
2: 1
3: 26
4: 313
905607135_905607143 11 Left 905607135 1:39311928-39311950 CCAAACCTGAAGAGAAGAGTGAG 0: 1
1: 0
2: 1
3: 16
4: 206
Right 905607143 1:39311962-39311984 ATTTTTACTGGTGGAGAGGGAGG 0: 1
1: 0
2: 2
3: 38
4: 345
905607135_905607142 8 Left 905607135 1:39311928-39311950 CCAAACCTGAAGAGAAGAGTGAG 0: 1
1: 0
2: 1
3: 16
4: 206
Right 905607142 1:39311959-39311981 ATGATTTTTACTGGTGGAGAGGG 0: 1
1: 0
2: 2
3: 35
4: 324
905607135_905607141 7 Left 905607135 1:39311928-39311950 CCAAACCTGAAGAGAAGAGTGAG 0: 1
1: 0
2: 1
3: 16
4: 206
Right 905607141 1:39311958-39311980 TATGATTTTTACTGGTGGAGAGG 0: 1
1: 0
2: 1
3: 16
4: 230
905607135_905607139 -1 Left 905607135 1:39311928-39311950 CCAAACCTGAAGAGAAGAGTGAG 0: 1
1: 0
2: 1
3: 16
4: 206
Right 905607139 1:39311950-39311972 GAGGGAAGTATGATTTTTACTGG 0: 1
1: 0
2: 1
3: 7
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905607135 Original CRISPR CTCACTCTTCTCTTCAGGTT TGG (reversed) Intronic
900198834 1:1393145-1393167 CTGACTGCTCTCTTCAGGGTGGG + Intronic
902412109 1:16217665-16217687 CACACTCTGCCCTTCAGGCTGGG - Intergenic
904993003 1:34608742-34608764 CTCACTGGTCTCTTGAGGGTGGG + Intergenic
905551037 1:38839499-38839521 CTTACTCTTCACTCCAGGGTCGG - Exonic
905607135 1:39311928-39311950 CTCACTCTTCTCTTCAGGTTTGG - Intronic
906268856 1:44458224-44458246 CTCACTCTGCTGCTCAGGCTGGG - Intronic
906438909 1:45823076-45823098 TTCACTCTTCTTTTTATGTTTGG + Intronic
907142765 1:52203761-52203783 TTCACTTTGCTTTTCAGGTTTGG + Intronic
909700443 1:78515288-78515310 CCCCCTCCCCTCTTCAGGTTGGG - Intronic
912324463 1:108744820-108744842 CTCACTCTTCCCTCTTGGTTTGG + Intergenic
914987559 1:152473378-152473400 CTCAGGCTTATCTTCAGGGTGGG - Intergenic
915280973 1:154821932-154821954 GTGGCTCTTCTCTTCTGGTTTGG - Intronic
920788755 1:209068244-209068266 GTGACTCTTCTCTTGAAGTTAGG - Intergenic
921583622 1:216924060-216924082 CTCGAATTTCTCTTCAGGTTTGG - Intronic
921837126 1:219789850-219789872 CTCACTCTGCTCTCCACGCTGGG - Intronic
922487358 1:225984861-225984883 CTCACTTTCCTAATCAGGTTGGG - Exonic
923438336 1:233991371-233991393 CTCCCTTTGCTCTTCATGTTGGG + Intronic
923573073 1:235134067-235134089 CTCACTCTGCCATCCAGGTTGGG + Intronic
923943641 1:238858111-238858133 CTCACTCATTCCTTCATGTTTGG - Intergenic
1063142532 10:3268130-3268152 CCCAAGCTTCTCGTCAGGTTGGG + Intergenic
1063567357 10:7182358-7182380 CACACTCTTCTTTTCACTTTTGG - Intronic
1065021068 10:21501792-21501814 CCCATTCCTCTCTTCAGGTTGGG - Intergenic
1070529880 10:77327298-77327320 CTCAGTCTCCTCTTCTGCTTGGG - Intronic
1071939760 10:90576043-90576065 CTGACTCTTCTCATCAGGACTGG - Intergenic
1073351182 10:102821189-102821211 CTCTCTCTTCTCTTCTCTTTTGG + Intergenic
1073906866 10:108292212-108292234 CTCCCTCTCCTCTTTAGCTTTGG - Intergenic
1074138135 10:110644874-110644896 CTTTCTCTTCTCTTCAGGAATGG + Intronic
1074368900 10:112882926-112882948 CTCACTCATCTCTTCATTCTTGG + Intergenic
1074865616 10:117543006-117543028 TTCCCCCCTCTCTTCAGGTTGGG + Exonic
1076989049 11:259998-260020 CCCACCCTTCTATTGAGGTTCGG + Intergenic
1078529174 11:12123345-12123367 CTCACTGTTCTCTTCTAGTCAGG + Intronic
1081648720 11:44808529-44808551 CTCACTTTTCTCTGCAGCATAGG + Intronic
1082822044 11:57550656-57550678 TTCACACTTCTTCTCAGGTTAGG + Intergenic
1084262483 11:67988233-67988255 CTCACTCTCCTCTTCACTTCTGG + Intergenic
1088384440 11:109237696-109237718 CTGACCCTTCTCTTTAGGATAGG + Intergenic
1088621196 11:111685645-111685667 CTCACTCTGTTGTTCAGGCTGGG - Intronic
1090194203 11:124800620-124800642 CCCACCCTTCTCTTCAGCTCGGG - Exonic
1090782192 11:130017297-130017319 CTCATTCTGCTGTTCAGGCTGGG + Intergenic
1090991833 11:131824498-131824520 CTCACTCTTCTACTCAGCTAAGG - Intronic
1092571278 12:9724733-9724755 CTTTCTCTTCTCTTAAGTTTTGG - Intronic
1093016258 12:14157385-14157407 CTCACTCCTCTCTCCAGTTCAGG - Intergenic
1093945899 12:25109415-25109437 CTCACTCTGCTGTTCAGGCTCGG + Intronic
1095727496 12:45469454-45469476 CTCACTCTGGTCTGCAGGATTGG - Intergenic
1097531088 12:60800717-60800739 CTCACTCATAACTTCTGGTTTGG + Intergenic
1098068389 12:66644491-66644513 TTCAATCTTCTTTTGAGGTTTGG - Intronic
1098987069 12:77024082-77024104 CTTTCTCTTCTCTTCAGGACAGG + Exonic
1099372156 12:81848318-81848340 CACAATTTTCTCTTCATGTTGGG - Intergenic
1100662244 12:96712534-96712556 CTGAATCTTCTCTTCTGTTTTGG + Intronic
1101430079 12:104619475-104619497 TTCACTCTTCTCGTCAGGGGAGG + Intronic
1106096548 13:26650220-26650242 CTCCCGCTTCCCCTCAGGTTAGG - Intronic
1107974669 13:45677833-45677855 CCCAAACTTCTTTTCAGGTTGGG + Intergenic
1109217694 13:59608624-59608646 CCCAAACTTCTCTTCAGGTATGG - Intergenic
1110064080 13:71080138-71080160 CTCAGTCTCCTCTTCAGTTCGGG - Intergenic
1112146643 13:96707429-96707451 CTCACTGTTCTAGTCAGCTTAGG - Intronic
1113960527 13:114123333-114123355 TTCACTCTTCTTTTCAGCTCTGG - Intronic
1117586743 14:57214927-57214949 CCGATTCTTCTCTTCATGTTGGG - Intronic
1117968857 14:61232775-61232797 CTCTCCCTTCCCTTGAGGTTAGG + Intronic
1119323416 14:73744794-73744816 CTCACTCTTTTCATCAGGCCAGG + Intronic
1119800196 14:77437497-77437519 CTCACTCTTCTCTTCTTCTTTGG - Intronic
1120371054 14:83636249-83636271 CTCACTCTTCGCCTGAGGTCAGG - Intergenic
1122024379 14:98864492-98864514 CTCACTCCACTGTTGAGGTTGGG - Intergenic
1122468931 14:101952828-101952850 CCCACACTGCTCCTCAGGTTGGG + Intergenic
1124491727 15:30162097-30162119 CTCACTCTCCACTGCAGGGTGGG + Intergenic
1124751809 15:32376212-32376234 CTCACTCTCCACTGCAGGGTGGG - Intergenic
1131043372 15:89293981-89294003 CTCACTGCTCTTTTCAGGTAAGG + Exonic
1132212455 15:100034501-100034523 CTCACTGTGCTCTTCAGGTGAGG - Intronic
1132360116 15:101205525-101205547 ATCACAGTACTCTTCAGGTTTGG - Intronic
1137249939 16:46733879-46733901 CTCTCTTTTCTCTTCAGGGACGG + Intronic
1137433177 16:48434705-48434727 CTCACTCTTCTCCTTAGGCATGG + Intronic
1137500276 16:49005650-49005672 CTCACTCTGCTCTCCAGTTTAGG - Intergenic
1144259306 17:13502513-13502535 CTCACTCTTCTTATCAATTTGGG + Intronic
1144316613 17:14068424-14068446 CTCGATCTTCTTTTCAGATTGGG - Intergenic
1145784216 17:27583580-27583602 TTCATTCTCCTGTTCAGGTTGGG - Intronic
1146024349 17:29306709-29306731 CTCACTATGTTATTCAGGTTGGG - Intergenic
1146241808 17:31236468-31236490 CTCACTCTGCCATTCAGGCTGGG + Intronic
1147360232 17:39925617-39925639 CTCAGTCTCCTGTGCAGGTTTGG - Exonic
1148109793 17:45137896-45137918 CTGACTCATCTCAGCAGGTTTGG + Exonic
1155930017 18:31697267-31697289 CTCTCTCTTTTTTTCAGGGTGGG - Intergenic
1157386497 18:47263017-47263039 CTCACTCTTCTCCTCTGCTTGGG + Intergenic
1157946139 18:51983001-51983023 CTCCCTCTTCTTTTCACTTTTGG - Intergenic
1159809533 18:72999955-72999977 CACACTGTTCTATTCAGGCTGGG + Intergenic
1161711477 19:5851096-5851118 GTCACTCTTTCCTTCCGGTTTGG + Intronic
1161826853 19:6573326-6573348 CTCACTCTTCTCGCCCGGGTTGG - Intergenic
1162823004 19:13234758-13234780 CTCACCCTTCTTTTCCGGTAGGG - Intronic
1164078544 19:21842905-21842927 CTCACTCTTCTCTCCTGCCTGGG - Intronic
1164099439 19:22041697-22041719 ATGACTCTTCTCTTCTGCTTGGG - Intergenic
1164119636 19:22254577-22254599 GTGACTCTTCTCTTCTGCTTGGG - Intergenic
1164794917 19:31018268-31018290 CTCAATTTTCTTTTCAGGGTAGG - Intergenic
1168024849 19:53636579-53636601 CTCTCTCTTCCCTTCAGGTCTGG + Exonic
925881010 2:8352841-8352863 CTTTCTCTTCTCTTCAGCTTTGG - Intergenic
929289211 2:40170054-40170076 ATCAGTCTTCTCTGCAGGCTGGG + Intronic
929599921 2:43198560-43198582 CTCAGTCTCCTCTTCAGGAAAGG + Intergenic
929615864 2:43306747-43306769 CTAACTCCTCTCTCCATGTTGGG - Intronic
930388510 2:50729809-50729831 GTCACAATTCTCTTCAGGTTTGG + Intronic
932579635 2:72984983-72985005 CTCACACTTCTGAGCAGGTTGGG - Intronic
932740336 2:74286194-74286216 CTCACTTCTCTCTTCAGTTCTGG - Intronic
932882644 2:75518195-75518217 CTCCTTCTTCTCTTCTGTTTGGG + Exonic
933343089 2:81047894-81047916 CTTACTCTTCATTTCATGTTTGG - Intergenic
933507814 2:83201240-83201262 TCCACTCTTCTCTTCTGTTTTGG + Intergenic
934128498 2:88921890-88921912 TTCTCTTTTCTCTTCAGTTTTGG - Intergenic
935231090 2:101096765-101096787 CTCACTTTGCTTTTCAGTTTGGG - Intronic
938709467 2:133963608-133963630 CTCATGCTCCTCTGCAGGTTAGG - Intergenic
941298558 2:163772220-163772242 CTCATTCTTTTCTTTAGGCTTGG - Intergenic
941862286 2:170296187-170296209 ATCACTCTGCTCATCAGGGTGGG - Intronic
943591346 2:189801057-189801079 CTCACTCTCTTGTTCAGGCTGGG + Intronic
944110234 2:196124154-196124176 CTCATTCCTCTCTTCAGGAGAGG + Intergenic
947073096 2:226313023-226313045 CACACTCTTTTCTTAAGGGTGGG - Intergenic
947574553 2:231262319-231262341 CTCCCTCTGCTCTCCAGGATGGG - Exonic
948137742 2:235649402-235649424 CTCACTCTACTGCTCAGGCTGGG + Intronic
948492459 2:238321856-238321878 CTCACTCTTTTCAACAGGTTGGG + Intronic
948821736 2:240553269-240553291 CTCTGTCTTCTCCTCAGGTGGGG + Intronic
1168785867 20:539794-539816 CTCATTCATCTATTCAGGTGTGG + Intronic
1170731758 20:18982318-18982340 CTCTGCCTTCTCTGCAGGTTCGG + Intergenic
1170962720 20:21039626-21039648 CACCCTCTTCACATCAGGTTTGG + Intergenic
1171938238 20:31297168-31297190 CTTATTGGTCTCTTCAGGTTTGG - Intergenic
1173906443 20:46633222-46633244 CTGTCTCTTCTTTCCAGGTTGGG - Intronic
1177755115 21:25336827-25336849 CTCACTCTTCACATGAGTTTTGG + Intergenic
1178500524 21:33122182-33122204 CCCACTCATCTTTTCAAGTTAGG + Intergenic
1179375311 21:40845618-40845640 CTCTCTCCTCTCTTCTGGCTAGG + Intronic
1181015397 22:20065834-20065856 CTCCCTCTTCCCTCCAGGTGAGG + Exonic
1181647015 22:24236951-24236973 CTCAGCCTCCTCTTCAGGATTGG - Intronic
1185159849 22:49216908-49216930 TTCTCTTTTCTCTTCAAGTTTGG - Intergenic
949180674 3:1126741-1126763 CTTTCTCTTCTCTTCAGGCTTGG - Intronic
950117602 3:10461623-10461645 CTCATTCATCTCTGCAGGGTGGG - Intronic
951293557 3:20903957-20903979 CTTATTCTTCTGTTCAGGTGGGG - Intergenic
952577629 3:34794183-34794205 CTGACTCTTCTCCTCAGCTCTGG + Intergenic
952704293 3:36361687-36361709 TTCTCTTTACTCTTCAGGTTGGG + Intergenic
953664748 3:44917728-44917750 CTCCTTCTTCTCTCCATGTTGGG - Intronic
953820274 3:46202384-46202406 ATCTCTCTTCTTTTCAAGTTGGG - Exonic
954123397 3:48514144-48514166 GTCACTCTTCTCCATAGGTTAGG + Intergenic
954962590 3:54579427-54579449 CTCACTCTTTTCTTCCTGCTTGG - Intronic
956002870 3:64747723-64747745 TTCACTGTTTTCTTCAGATTAGG - Intergenic
957278332 3:78117265-78117287 CTCACTCTCCACTTCAGGGTGGG + Intergenic
957314136 3:78556020-78556042 CACACTCTTTTCTATAGGTTCGG + Intergenic
958982072 3:100733295-100733317 TTCTCTCTGTTCTTCAGGTTGGG + Intronic
960640032 3:119815423-119815445 CTCCCTCTTCTCCCCAGGTGAGG + Exonic
965746841 3:171935185-171935207 CTCACTAATCCCTTCAGGGTGGG - Intronic
971279305 4:25229151-25229173 TTCTCTCTGTTCTTCAGGTTTGG - Intronic
973662740 4:53124741-53124763 TTCACTTTTCTCTTCTGATTTGG - Intronic
975210657 4:71696190-71696212 CCCACTCCTCTCTCCAGGCTAGG - Intergenic
975448967 4:74502270-74502292 CTAACAATTCTCTTCAGCTTTGG + Intergenic
975468082 4:74732692-74732714 CTTTCTCTTCTCTTTTGGTTTGG + Intergenic
976033721 4:80790574-80790596 CTCTCTCTTTTCATCAGGTAAGG + Intronic
976218074 4:82733243-82733265 CTCACTCTTCACTCTAGCTTTGG + Intronic
978083899 4:104626200-104626222 CTCCCCCTTCTCTAGAGGTTGGG - Intergenic
980039054 4:127917529-127917551 CTGACTCTCCTGTTCAGGTCAGG + Intergenic
982684982 4:158477303-158477325 CTCACACATCTCTTCAGACTTGG + Intronic
983153209 4:164311917-164311939 CTCTCTCTTCTCTTAAATTTGGG + Intronic
983297790 4:165888500-165888522 CTCATTCTACTCTTCCTGTTGGG + Intronic
993205759 5:84876322-84876344 CTCCTTCTTCTCTTCTAGTTGGG - Intergenic
994656417 5:102599496-102599518 CTCATTATTTTCTTCAGTTTGGG + Intergenic
996237791 5:121153830-121153852 CTCACTCTGTTCTCCAGGCTGGG - Intergenic
998248436 5:140531549-140531571 CTCGCTCTTTTGTTCAGGCTTGG - Intronic
999102779 5:149040528-149040550 CTCAATTTTATCTGCAGGTTTGG - Intronic
1001268923 5:170296361-170296383 CTCATTTTCTTCTTCAGGTTGGG + Intronic
1002540968 5:179906675-179906697 CTCAGTGTTCCCTTCAGCTTCGG - Intronic
1003493433 6:6643007-6643029 CTCACTCTCCCCTCCAGGTGAGG - Intronic
1005688254 6:28276327-28276349 CTCAATCTTCTCTTTGGGCTTGG - Exonic
1006545205 6:34775102-34775124 CTCACTCTATTGTCCAGGTTGGG + Intergenic
1007398927 6:41592752-41592774 TTCTCTCTTCTCTTGAGGTCAGG + Intronic
1007649226 6:43407575-43407597 CTGAATCTTCTCTGAAGGTTAGG + Intergenic
1009942081 6:70301870-70301892 CTCACTCTTCAATCCAGCTTTGG - Intronic
1009993496 6:70873490-70873512 CTCAAGATTCTCTTCATGTTTGG + Intronic
1010989767 6:82467891-82467913 CTCACTCTGTCATTCAGGTTGGG + Intergenic
1011255844 6:85420045-85420067 CTCACTCTTCACTTCAGTTATGG + Intergenic
1014358257 6:120439046-120439068 TTCACTCTGTTCTTCAGATTAGG - Intergenic
1016130081 6:140457228-140457250 CTCATTCTTCTCTTCTAGTAAGG + Intergenic
1016975012 6:149799051-149799073 CTCACACTTCTCAGCAGTTTGGG + Intronic
1017115559 6:150973148-150973170 TTCACTCTTATCATCAGCTTTGG + Intronic
1017125324 6:151059239-151059261 CTCACTCTTTTCCCCAGGCTGGG + Intronic
1018222718 6:161597092-161597114 CTCACGCTTTTCTTCCTGTTTGG + Intronic
1018497288 6:164361763-164361785 TTCACTCTTCTCTGCAGGTGTGG + Intergenic
1018742752 6:166743230-166743252 CTCACTCTCCTTTTGAGGATGGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1019661510 7:2226692-2226714 CAGAATCTTCTCTTTAGGTTGGG + Intronic
1023170632 7:37387170-37387192 CTCAGACTTCTTTTCAGGATAGG - Intronic
1023373639 7:39535408-39535430 CTCTCCCTTTTCTTGAGGTTGGG - Intergenic
1024598282 7:50958153-50958175 TTCAGGCTGCTCTTCAGGTTTGG + Intergenic
1024930756 7:54664863-54664885 CTCACTCTCATATCCAGGTTAGG + Intergenic
1032148501 7:129406361-129406383 CTCTCTCCCCTCTTCAGGTGGGG + Exonic
1035429068 7:158804045-158804067 CTCACCCTTCTCAACAGTTTGGG - Intronic
1035429130 7:158804395-158804417 CTCACTTTTCTCAACAGTTTGGG - Intronic
1035429140 7:158804465-158804487 CTCACCCTTCTCGGCAGTTTGGG - Intronic
1035429144 7:158804500-158804522 CTCACTTTTCTCAGCAGTTTGGG - Intronic
1035429149 7:158804535-158804557 CTCACCCTTCTCGGCAGTTTGGG - Intronic
1038123310 8:24642517-24642539 CTGACTCTTCTCTGCATGGTGGG - Intergenic
1038280691 8:26161524-26161546 CTCAGTCTTTTCTGGAGGTTAGG - Intergenic
1039399059 8:37253165-37253187 CTCACTCTTCTCTTCTGGATAGG - Intergenic
1039990166 8:42481034-42481056 CTTATCCTTCTCTTGAGGTTTGG + Intronic
1040510048 8:48085216-48085238 CTCACTCTACCCTTCATATTAGG - Intergenic
1042746014 8:72106844-72106866 CTAACTCCTTTCTTCAGCTTTGG + Intronic
1043514295 8:80981894-80981916 CTCACTCTGCCATTCAGGCTGGG + Intronic
1043693200 8:83183535-83183557 CTCCTTCTTCTCTTCTAGTTAGG + Intergenic
1044417479 8:91952782-91952804 CTCACTCTTTTTCTCAGGCTGGG + Intergenic
1045068971 8:98480031-98480053 TTCTCTCTCCTCTTCAGATTGGG - Intronic
1045603341 8:103744692-103744714 CTGTCTCTCCTCTTCAGGTTAGG - Intronic
1047299000 8:123596830-123596852 CTCACTCCTCACTCCAGGTGGGG + Intergenic
1047529588 8:125663050-125663072 CTCACTCTACTATCCAGGCTGGG - Intergenic
1048616185 8:136077937-136077959 ATCACAGTTCTATTCAGGTTGGG + Intergenic
1049445430 8:142628438-142628460 CACCCTCCTTTCTTCAGGTTTGG + Intergenic
1049486866 8:142869779-142869801 GGCACTCTTCTCTGCAGGTCAGG - Intronic
1050992819 9:12174050-12174072 CTCACTGTTGTCTTCAGGTCTGG + Intergenic
1051393388 9:16590775-16590797 CTCACTCTTCCATCCAGGCTGGG - Intronic
1051561584 9:18447453-18447475 CTCCCTCTTCCCCACAGGTTTGG - Intergenic
1055320552 9:75079884-75079906 GGCACGCTTCTCCTCAGGTTGGG - Intronic
1055581336 9:77709934-77709956 CTCTCTCTGCTTTTCAGTTTTGG + Intergenic
1056151024 9:83788340-83788362 CTCTCTCTTCCCTTCATCTTGGG + Intronic
1056761038 9:89415136-89415158 ATCACTCTACTCTTCAGACTTGG + Intronic
1057174116 9:92983053-92983075 CTCACTCTGTTGCTCAGGTTGGG - Intronic
1057731017 9:97608150-97608172 CTCACTCTGTTGCTCAGGTTGGG - Intronic
1060032416 9:120226741-120226763 CTCACTCTAGACTTCTGGTTGGG - Intergenic
1060535481 9:124383525-124383547 CTCTCTCTGCCCTTTAGGTTTGG - Intronic
1061112493 9:128584670-128584692 CTGACTTTTCTCTTCATGGTTGG + Intronic
1062694962 9:137869423-137869445 TGCACTATTCTCATCAGGTTTGG - Intronic
1185850978 X:3486296-3486318 CTAACTCTTTTCTTCTGTTTTGG + Intergenic
1186766836 X:12779205-12779227 CTCACTCTTCTCTATTGGATAGG - Intergenic
1187305543 X:18092035-18092057 CTCCCTCTTCCCTGCAGATTAGG - Intergenic
1187358600 X:18602546-18602568 CTCACTAATCTCTTCCAGTTAGG - Intronic
1188812579 X:34669669-34669691 CTAGCCCTTCTTTTCAGGTTAGG + Intergenic
1194682110 X:96867186-96867208 CTCAGTATTCTTATCAGGTTGGG + Intronic
1196992274 X:121343737-121343759 CTCACACTTCTCTTTATGCTTGG + Intergenic
1197233899 X:124036914-124036936 CTCACTCTGTTGTCCAGGTTGGG + Intronic
1201276053 Y:12299898-12299920 CTGAGTCTTCTCTTGGGGTTGGG - Intergenic