ID: 905608827

View in Genome Browser
Species Human (GRCh38)
Location 1:39330737-39330759
Sequence TGGGATAAGCCCCAACATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905608827_905608831 -4 Left 905608827 1:39330737-39330759 CCTACATGTTGGGGCTTATCCCA 0: 1
1: 0
2: 0
3: 6
4: 107
Right 905608831 1:39330756-39330778 CCCATGCTGGGTTTTCCTTGTGG 0: 1
1: 0
2: 1
3: 16
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905608827 Original CRISPR TGGGATAAGCCCCAACATGT AGG (reversed) Intronic
902749041 1:18493878-18493900 CAGGATAAGCCCCAACTTGGAGG - Intergenic
904718324 1:32486301-32486323 TGGGCTAAGCCCCAATTTTTGGG - Exonic
905039063 1:34938163-34938185 TGGGCTAAGCCCCAATTTGGGGG + Intergenic
905608827 1:39330737-39330759 TGGGATAAGCCCCAACATGTAGG - Intronic
906487799 1:46245223-46245245 GGGGGTGAGCCCCAACATTTGGG - Intergenic
908934252 1:69355732-69355754 TGGGGTAAGCCCCAATTTGGGGG - Intergenic
912319098 1:108693228-108693250 CGGGAGAAGCACCAACAAGTTGG - Intronic
912631791 1:111252720-111252742 TGGGATAATCCCAAACATTGGGG + Intergenic
921668734 1:217903342-217903364 TGGAATAAGACAGAACATGTTGG - Intergenic
923202488 1:231725702-231725724 TGGGATAAGCCCCAGTTTGGGGG + Intronic
1066006313 10:31149335-31149357 TGGGAAAAGGCCCAAAGTGTGGG + Intergenic
1071713318 10:88070947-88070969 TGGGATAAGCCCCAAAGTGGAGG - Intergenic
1072986612 10:100146376-100146398 TGGGACAACCCCCAACTGGTAGG - Intergenic
1088181447 11:107117226-107117248 TGGGATAAGCCCCAATTTGGGGG - Intergenic
1088396070 11:109371105-109371127 TGGGATAATCCCCACCTCGTGGG - Intergenic
1088818989 11:113441190-113441212 TGCCATAAGCCCCAACTTATGGG + Intronic
1089161614 11:116442217-116442239 TGGGCTAAGCCCCAATTTTTGGG - Intergenic
1092926474 12:13276823-13276845 TGCAATAAGCCCCAAGATCTGGG + Intergenic
1096821722 12:54241239-54241261 TTGGGAAAGCCCCAACAGGTAGG + Exonic
1097921242 12:65076575-65076597 TGAGATAAGCACCAAGATTTTGG + Intronic
1099109730 12:78543314-78543336 TTTGCTAAGCCCCAACATCTTGG - Intergenic
1100229422 12:92592419-92592441 TGGGACATGCTCCAACATGATGG + Intergenic
1103841340 12:123867782-123867804 GAGCATAAGACCCAACATGTTGG - Intronic
1105822906 13:24095931-24095953 TGGATTTAGCCCCAACATCTAGG - Intronic
1112709750 13:102113926-102113948 TGAGGTGAGCCCCAACATGGTGG - Intronic
1114473473 14:22979359-22979381 TGGGATGGGCCCCAACAGGCAGG - Intronic
1114803381 14:25805256-25805278 TGGGATGAGCCAGAACATGAAGG - Intergenic
1117449637 14:55838365-55838387 TGGGGAAATCCCCAACATCTGGG + Intergenic
1118374829 14:65167574-65167596 TGGGCTAAGCCCCAATTTGGAGG + Intergenic
1119032672 14:71204784-71204806 TGGGTTAAGCCCCAACTTAGGGG - Intergenic
1120109181 14:80533103-80533125 TACTATAAGCCACAACATGTAGG + Intronic
1120874652 14:89364472-89364494 TGGGATCAGCACCAACAGGCAGG + Intronic
1121972905 14:98375206-98375228 GGGGATGAGCCCCAAGATATTGG + Intergenic
1126576975 15:50206852-50206874 TGTGCTAAGCCCAAACATTTTGG - Intronic
1131850539 15:96538654-96538676 TGGGATAAGCTTCAGCATGAGGG + Intergenic
1135534534 16:23283006-23283028 TAGGCTAAGCCCCAACTTGGGGG + Intronic
1142047726 16:87936444-87936466 TGGGAACAGACCCAAGATGTTGG - Exonic
1148908654 17:50927877-50927899 TGGAATGTGTCCCAACATGTAGG - Intergenic
1149270713 17:54974647-54974669 TGGGCTAAGCCCCAATTTGGGGG - Intronic
1149340787 17:55684099-55684121 TGGGATGGGCTTCAACATGTTGG - Intergenic
1150336063 17:64331740-64331762 GGGGATCTGCCCCAGCATGTGGG - Intronic
1153121056 18:1727875-1727897 TGGCATAAAACACAACATGTTGG + Intergenic
1153848352 18:9069896-9069918 TGGGATAAGCTGCAGCAGGTGGG + Intergenic
1157617071 18:48993253-48993275 AGGGATCAATCCCAACATGTTGG - Intergenic
1159827203 18:73228522-73228544 TGAGTTAAGACCCAACATCTAGG + Intronic
1162662995 19:12184935-12184957 TGGGATAAGCCCCAATTTTAGGG - Intronic
927485572 2:23486342-23486364 AGGGATAAGCCCCAGCATCTCGG - Intronic
928130316 2:28644411-28644433 TGGGATAAGGCCCAGACTGTTGG + Intergenic
928346539 2:30502840-30502862 TGGGTTAAGCCCCAATTTGGGGG - Intronic
934719960 2:96567031-96567053 TGGGCTAAGCCCCAATTTGGTGG + Intergenic
937158976 2:119742183-119742205 GGGAATAAGCCCCAACATTTGGG - Intergenic
937413257 2:121694881-121694903 TTGGCTAAGACCCAAAATGTTGG + Intergenic
946467345 2:219923832-219923854 TGGGTTAGGCACCAACAGGTTGG + Intergenic
1169980379 20:11378129-11378151 TGGGCTAAGCCCCAATTTGGGGG - Intergenic
1170098273 20:12670890-12670912 TTGGATAACCCCCAAGATCTGGG + Intergenic
1173062067 20:39672144-39672166 TGGGTTAAGTCCCAAGAAGTGGG - Intergenic
1175003442 20:55655681-55655703 TGGGATAAACCAAGACATGTGGG - Intergenic
1175575742 20:60059067-60059089 TGGGATAAGACCCAGCGTGGGGG + Intronic
1181040560 22:20190529-20190551 TGGGAAATGCCACAACATGTGGG - Intergenic
1184612706 22:45615216-45615238 TGGGCTAAGCCCCAATTTGGGGG - Intergenic
949415291 3:3807286-3807308 TGGGACAACCCAGAACATGTGGG + Intronic
951825655 3:26865425-26865447 TGGGATAAGCTCCAACAACCAGG + Intergenic
953392017 3:42539450-42539472 TGGGAGGAGCCCCAAGAAGTTGG + Intergenic
954639167 3:52087897-52087919 CGGGATAGGCCCCAAGGTGTAGG + Intronic
955821050 3:62895905-62895927 TGGGCTAAGCCCCAATTTGGGGG - Intergenic
961422146 3:126814896-126814918 GGGGATAGCCCCCAACCTGTGGG + Intronic
962006498 3:131355147-131355169 TGGGAAAAGCCACAAAATTTTGG - Intergenic
965848546 3:172993066-172993088 GGGGATAAGCCCCAACCACTGGG - Intronic
981785164 4:148469100-148469122 TGGTATCAGTCCAAACATGTAGG - Intergenic
983647141 4:170003543-170003565 TGGGATAATCCTCGAAATGTTGG + Intronic
984717228 4:182936995-182937017 TGGGATGAACCCCAACAGGAAGG + Intergenic
989166756 5:38440091-38440113 TGGGATCTGCCCCAACATTCTGG - Intronic
991004332 5:61812937-61812959 TGGGCTAAGCCCCAATTTGGGGG - Intergenic
994322323 5:98407724-98407746 TGGGATAAGGGGCAGCATGTTGG - Intergenic
994919357 5:106023108-106023130 TAGAATAAGCCCCAACAAATGGG + Intergenic
1000927247 5:167209071-167209093 TGGTATAAGTCACACCATGTTGG + Intergenic
1006263045 6:32893409-32893431 TGGGAAAAGATCCAACGTGTAGG + Intergenic
1012264736 6:97128162-97128184 TGGGATATGACACAACAGGTTGG + Intronic
1014490905 6:122060695-122060717 TGGGCTAAGCCCCAATTTGGGGG - Intergenic
1015079235 6:129203354-129203376 TGGGGCAACCCCCAACATGCTGG + Intronic
1015816298 6:137214576-137214598 TTGGATAAGCCCCAACTTGGTGG - Intronic
1018928331 6:168222533-168222555 TGGGGTAAGCCCCAGCCTGAGGG - Intergenic
1024384461 7:48735853-48735875 TGGGACTAGCCCCATAATGTTGG + Intergenic
1028620479 7:92821431-92821453 TGTTTTAAGCCCCTACATGTTGG + Intronic
1035282423 7:157786406-157786428 TGGGAAAAGCCCCCAGAGGTGGG + Intronic
1039157682 8:34579913-34579935 TGGGCTAAGCTCCAATTTGTGGG + Intergenic
1040073292 8:43205315-43205337 TGGGTGAAGCCCCAAACTGTAGG - Intergenic
1049400208 8:142423116-142423138 TGGGATATGCAACAACATGGTGG + Intergenic
1051092890 9:13431082-13431104 TGAAAGAAGCCCCATCATGTGGG - Intergenic
1051781419 9:20692485-20692507 TGGTTTAAGCCACAAAATGTTGG - Intronic
1059235965 9:112760929-112760951 TGGGAAAAGCCCCAAGGTGAAGG + Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1186933591 X:14421980-14422002 TGGGATAGGGCCAAAAATGTTGG + Intergenic
1190642332 X:52492746-52492768 TCTGATAAGCCCCAGCGTGTTGG + Intergenic
1190645341 X:52520121-52520143 TCTGATAAGCCCCAGCGTGTTGG - Intronic
1191715341 X:64190346-64190368 CTGGATAAGCCCCAACCAGTTGG - Exonic
1197683888 X:129417510-129417532 AGGGATAAGCACCAACCTCTAGG + Intergenic
1199720289 X:150538615-150538637 TTTGAGAAGCCCCAGCATGTTGG + Intergenic