ID: 905611719

View in Genome Browser
Species Human (GRCh38)
Location 1:39358287-39358309
Sequence AGCAAGTTCTTTAGATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905611719 Original CRISPR AGCAAGTTCTTTAGATAGGA AGG (reversed) Intronic
904736430 1:32637724-32637746 AACACGTTCTATAGATTGGATGG + Intronic
905611719 1:39358287-39358309 AGCAAGTTCTTTAGATAGGAAGG - Intronic
906017918 1:42598989-42599011 AAGAAGTTCTTTAGAGAGAAGGG + Intronic
909698304 1:78491621-78491643 AGCGAGTTCGTTAGTTTGGAGGG + Intronic
911002865 1:93184521-93184543 ATCAAGTACTTTGGATAGTATGG + Intronic
912057900 1:105629562-105629584 AGCAAATTCTGTAGATAAGAAGG + Intergenic
912304744 1:108556037-108556059 TCCAACTTCTTCAGATAGGATGG - Intergenic
916051769 1:161041487-161041509 AGCATGTTCTTTTTAGAGGAGGG - Intronic
916644427 1:166768854-166768876 AGCAAATTCTTCAAACAGGAAGG - Intergenic
917826326 1:178824956-178824978 AGCAAGGTCTTTAGTTAAGGTGG + Intronic
917912180 1:179660827-179660849 AGGAAGTTCTTTGGACAGAAAGG - Intronic
918651643 1:186971812-186971834 ATAAAGTTCTTTTGATAGGAGGG + Intronic
919045416 1:192445401-192445423 AGGAAGTGCTTTAGTAAGGAAGG + Intergenic
922925859 1:229346160-229346182 AGAAAATTATTGAGATAGGATGG + Intergenic
924075719 1:240334069-240334091 ACCAATTTCTTTAAATATGATGG + Intronic
924508148 1:244705336-244705358 ACAAGGTTCTTTAGAAAGGAAGG + Intronic
1063737950 10:8782626-8782648 CGCCAGTACTATAGATAGGATGG + Intergenic
1066430595 10:35347523-35347545 AGCAAGTTCTTTATTTTGGGTGG + Intronic
1068832274 10:61509073-61509095 AGGAAGTTCTATAAATGGGAAGG + Intergenic
1069208780 10:65729681-65729703 AGCATGTTCTTCAGATTGAAGGG + Intergenic
1070535548 10:77374712-77374734 TGCAGTTTCTTTAGGTAGGAGGG + Intronic
1071895729 10:90064641-90064663 AGCAAGTTCTTCAGATGGGAAGG - Intergenic
1072141138 10:92590221-92590243 AGAATGTGCTTTAGATAGGGTGG + Intergenic
1072366666 10:94718030-94718052 ATAAATTTCTTTAGATAGTATGG + Intronic
1074665513 10:115718249-115718271 GGAAAGTGCTTTAGATAGAATGG - Intronic
1077355828 11:2116453-2116475 AGCAGGTTCATTAGATGTGATGG + Intergenic
1079370082 11:19845106-19845128 AGGAAGTTCTTTCGATAGACAGG + Intronic
1079635999 11:22741697-22741719 TTCAAGTGCTTTAAATAGGATGG - Intronic
1079913151 11:26335742-26335764 AGCAAGTCCTTTAAGGAGGAGGG - Intronic
1080275312 11:30497198-30497220 AGCAAGTTGTTTGGATAGAATGG + Intronic
1080904766 11:36531758-36531780 AGGAAGTTCTTTAAACAGAAAGG - Intronic
1086877846 11:92119145-92119167 AGGAAGTTCTTTAAACAGAAAGG - Intergenic
1087519379 11:99211477-99211499 AACAAGTTCTCTAGATCAGAAGG - Intronic
1087613405 11:100461152-100461174 AGCCACTTCTTTACAAAGGAGGG - Intergenic
1087676436 11:101167458-101167480 AGGAAGTTCTTCAGAGAGAAGGG - Intergenic
1088201790 11:107344362-107344384 AGGAAGTTCTTTAAACAGAAAGG - Intronic
1090979674 11:131708197-131708219 AGGAAGTTCTTTATATATAAGGG - Intronic
1095304527 12:40624167-40624189 AGCAAGTGCTTTTGATAGATTGG + Intergenic
1098354348 12:69596884-69596906 AGTTAGGTCTTTGGATAGGAAGG + Intronic
1100197111 12:92259301-92259323 AGGAAGTTCTTTAAACAGAAAGG - Intergenic
1100661127 12:96700116-96700138 AGCAATTTCTTTACCTATGAGGG + Intronic
1103260439 12:119583797-119583819 AGCAAGGTACTTAGATAGAATGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1106263218 13:28086940-28086962 AGAAAGTTCTTCAGACAGGTGGG - Intronic
1107388758 13:39941697-39941719 AGAAAGTTCTTTTGACAGAAAGG + Intergenic
1109608225 13:64727775-64727797 AAAAAGTTCTTTATATATGATGG + Intergenic
1110972365 13:81781251-81781273 AGAAATTTCTTTAGTTGGGAGGG + Intergenic
1111221723 13:85213653-85213675 AGCAGTTTCAATAGATAGGATGG - Intergenic
1112268491 13:97947548-97947570 AGCAACTCATTTAGAGAGGAAGG - Intergenic
1112314207 13:98346749-98346771 AAAAAGTTCTTTTGATAGAATGG + Intronic
1112677016 13:101713744-101713766 AGGAAGTTTTTTAGTTAGGTAGG + Exonic
1115261169 14:31455869-31455891 GGTTAATTCTTTAGATAGGATGG + Intronic
1117563563 14:56970089-56970111 AGGTAGTACGTTAGATAGGATGG + Intergenic
1117872905 14:60219366-60219388 ACCAAGTTCTGTGGATAGCAGGG + Intergenic
1118806833 14:69245218-69245240 AGCATGTTATTTAGAAAGGTGGG + Intergenic
1118889247 14:69894281-69894303 AGGATGATGTTTAGATAGGAAGG - Intronic
1122525639 14:102381726-102381748 ATGAAGTTCTTTAGACAGAAGGG + Intronic
1123779071 15:23607499-23607521 AACAAGTTCTTTTGATTGGGTGG - Intronic
1124248019 15:28087388-28087410 AGGAAGTTCTCTAAATAGAAAGG + Intronic
1126718632 15:51551805-51551827 AGCTTATTCTTTAGAAAGGAAGG + Intronic
1127318990 15:57824398-57824420 AGCAATTTCTTTAGTCAGCAAGG - Intergenic
1131390072 15:92040600-92040622 AGCAGGTTCTTAGGAGAGGAAGG - Intronic
1137334862 16:47538301-47538323 AGCAGGTTGTTTACACAGGAAGG + Intronic
1137467832 16:48726965-48726987 AGGAAGTTCGTGAGAGAGGAGGG + Intergenic
1138316508 16:56074552-56074574 AGCAAGTTCTTAAGTTTGTATGG - Intergenic
1140919890 16:79527775-79527797 AGAAAGTTCTTTTCATAAGATGG + Intergenic
1143713680 17:8752272-8752294 AGGGAGATCTCTAGATAGGAAGG + Intergenic
1143935400 17:10479057-10479079 AGCAAGTTTTAAAGAGAGGAGGG + Intergenic
1146297925 17:31664599-31664621 AGGAAGTTCTTCAGATAGAAGGG + Intergenic
1146718527 17:35106502-35106524 AGCAAGGACTTTGGATAAGAGGG + Intronic
1147393581 17:40123816-40123838 TGCAGCATCTTTAGATAGGAGGG + Intronic
1147871248 17:43589092-43589114 AGGAATTTCATCAGATAGGAAGG - Intergenic
1149395869 17:56243262-56243284 AGCAAAATCTTTAGATAAGGAGG - Intronic
1151096159 17:71501392-71501414 AGCAAGGTCATTAGATCAGAGGG + Intergenic
1151137005 17:71956521-71956543 AGCAATTTCTTTAGACATAAAGG - Intergenic
1152265845 17:79294229-79294251 AGCAAGTTCGTCAGATTAGATGG + Intronic
1153091672 18:1353414-1353436 AGCAAGTTCTTCAGACGGAAAGG + Intergenic
1153189986 18:2527441-2527463 TGAAAGTTCTTTTGAAAGGAAGG - Intergenic
1156279027 18:35614905-35614927 GGCAAGATCTTTAAATAGAAAGG + Intronic
1156314556 18:35956039-35956061 AGGAAGTTTTTCAGATAGAAAGG - Intergenic
1156576452 18:38322456-38322478 AGGAAGTTCATTAGAAATGATGG + Intergenic
1156817010 18:41323695-41323717 AACAAGTGCTTTAGATAATAGGG + Intergenic
1162445037 19:10717833-10717855 AGCAAGTTGTCAAGAGAGGAAGG - Intergenic
925154322 2:1638302-1638324 AGTAAGTTCCTGGGATAGGAAGG + Intronic
925281113 2:2685718-2685740 AGAAATTCCTTAAGATAGGAAGG - Intergenic
926046205 2:9711478-9711500 AGCAAGTTGATTAGATAGCAGGG + Intergenic
929046015 2:37791391-37791413 AGAAACTTCTTAAGAAAGGATGG - Intergenic
929806812 2:45153523-45153545 AGCCAGTTCCTTGGAGAGGAGGG - Intergenic
932505520 2:72226936-72226958 AGCAAATTTGTTAGATAGGTAGG + Intronic
935930865 2:108123584-108123606 AGCAAGGTCACTAGATACGAAGG + Intergenic
937761425 2:125608256-125608278 AGCAAATTCTTTGGCAAGGATGG - Intergenic
938754434 2:134366770-134366792 AGCAAGGTCTTAGGATAGGTGGG + Intronic
939144718 2:138398364-138398386 AGGAAGTTCTTTAGTCAGAAAGG + Intergenic
940445403 2:153771279-153771301 AACAAGATCTTTGTATAGGAAGG + Intergenic
940851349 2:158690628-158690650 AGCAAGTTCTTTGGAGAACATGG + Intergenic
943292968 2:186099113-186099135 AGAAAATGCTTTAGAAAGGAGGG - Intergenic
945503722 2:210611739-210611761 CGCATGTTCTTTAGAATGGAAGG - Intronic
947110796 2:226717241-226717263 AGCAAGTTCATTAGAAAAGTGGG - Intergenic
948491925 2:238319378-238319400 AGGAAGTTCTTCAGACAGGAGGG + Intergenic
1169007346 20:2219449-2219471 AGAAAGTTCTTTAAATAAAAAGG - Intergenic
1169568412 20:6880881-6880903 AGCAAAGTCTTGAGAGAGGAAGG + Intergenic
1170176568 20:13476583-13476605 TGCAAGTTTTTTTGATAGCAAGG + Intronic
1171112375 20:22495774-22495796 AGCAAGGTCTTTATTTGGGAGGG + Intergenic
1173074765 20:39807046-39807068 AGCATGTTCTTCAAATAGGCTGG - Intergenic
1178183416 21:30191051-30191073 AGCAAGATCTTTAGATTTGGAGG - Intergenic
1178241136 21:30901939-30901961 AGCAAGTTCTGGAGAAAGGTTGG + Intergenic
1178316230 21:31568901-31568923 AGCAGGGTCCTTAGATAGTAAGG + Intergenic
1178504031 21:33148750-33148772 AGCAAGTTGTTTAGGACGGAAGG + Intergenic
1179557986 21:42192904-42192926 ATCAAGTTCTTTACATGGAAAGG + Intergenic
1180114709 21:45693793-45693815 AGCAAGTTCTTTAGGTTGAAAGG + Intronic
1180761520 22:18212498-18212520 AGCAAGGTTTTCAGATATGAAGG + Intergenic
1180774147 22:18412112-18412134 AGCAAGGTTTTCAGATATGAAGG - Intergenic
1180944386 22:19682397-19682419 AGGAAGTTATTTAAATGGGAAGG + Intergenic
1181070259 22:20331120-20331142 AGCAAGGTTTTCAGATATGAAGG - Intergenic
1181193249 22:21159066-21159088 AGCAAGGTTTTCAGATATGAAGG - Intergenic
1181216195 22:21333535-21333557 AGCAAGGTTTTCAGATATGAAGG + Intergenic
1183412302 22:37662121-37662143 ACCAAGTTCTTAAAATAGGCAGG + Intronic
1183814648 22:40289535-40289557 AGGAAGTGCTTCAGAAAGGAGGG - Intronic
949965850 3:9355545-9355567 AGCAAGCTATTTAGATAGCCAGG - Intronic
951707192 3:25555230-25555252 AGCAAGTGTTTTAGATATCAGGG - Intronic
954576515 3:51679281-51679303 ACCCAGTTCTTTAAATAGGTGGG + Intronic
955602800 3:60666235-60666257 AGAAAGTTCTTTAAACAGAAAGG - Intronic
955774561 3:62419405-62419427 AGTAAGTTCCTTTGAGAGGATGG - Intronic
957822959 3:85401601-85401623 AGCAAGTTCTTAAAATGGCATGG - Intronic
959809565 3:110599904-110599926 AGCAAGTTTTGAAGATAGAATGG - Intergenic
962045133 3:131750786-131750808 ACAAAGTTCTTTAAATAGAAAGG - Intronic
962098149 3:132313736-132313758 TACAAGTTCTGAAGATAGGAGGG - Intergenic
962463630 3:135637313-135637335 AGCAAGGTCCTTGGATAGGTTGG - Intergenic
963012327 3:140782447-140782469 AGGAAGATCTTTAAACAGGAAGG + Intergenic
963910455 3:150813038-150813060 AGCAACTTCTTTTACTAGGAGGG + Intergenic
964015879 3:151945872-151945894 AGGAAGGTTTTTAGATAGAAGGG - Intergenic
964735997 3:159917802-159917824 ATCAAGTTCTTAAGAAATGATGG - Intergenic
967276754 3:187783492-187783514 AGCATTTTCTTTAGATTGTAAGG - Intergenic
968434885 4:579328-579350 AGTAAAGTCTTCAGATAGGAGGG + Intergenic
969885637 4:10212953-10212975 AAGAAGTTCTTTAGCTAGGGTGG + Intergenic
971144281 4:23960145-23960167 AGCCTCTACTTTAGATAGGAAGG + Intergenic
972117091 4:35650126-35650148 TGCAAGTTATTTAGAAAGCAGGG + Intergenic
973661756 4:53114687-53114709 AGGAAGTTCTTCAGATTGAAGGG + Intronic
973837233 4:54822284-54822306 AGAATGTTCTATAGTTAGGATGG + Intergenic
976251726 4:83059153-83059175 TGGAAGCTCTTTAGATATGAAGG + Intronic
976437790 4:85038535-85038557 ACCAAGATGTTTAGAAAGGAAGG - Intergenic
977178833 4:93847784-93847806 CGCAATTTCTTTAGAAAGAAAGG - Intergenic
977782194 4:100993690-100993712 ATCAAGTTGTTTGGATAGAAAGG + Intergenic
982734873 4:158995529-158995551 AGCATGGTCTTTAGATTGTATGG - Intronic
983867492 4:172786396-172786418 ACCAAGTTCCTAAAATAGGAAGG - Intronic
984776895 4:183489571-183489593 ATGAAGTTCTTTAGACAGAAGGG - Intergenic
986203832 5:5604266-5604288 AGTAATTACTTTAGAAAGGAAGG - Intergenic
988152699 5:27406678-27406700 AGCAAGTTCTTTTGAATTGATGG + Intergenic
988220504 5:28340105-28340127 AGCAACTTATTAAGAGAGGAGGG + Intergenic
989577460 5:43001325-43001347 AGCAAGGTCTCAAGATAGGAGGG - Intergenic
989814096 5:45714400-45714422 AGTAAGTTCTTCTGGTAGGAAGG + Intergenic
991949610 5:71934540-71934562 AGGAAGTTCTTCAGATTGAAGGG - Intergenic
992033537 5:72748488-72748510 TGTAAGTTCTTTAGAGAGAAGGG + Intergenic
992581767 5:78185215-78185237 AGGAAGCTCTTTAGACAGAAAGG + Intronic
993605584 5:89986996-89987018 AGCACATTCTTTAAAAAGGAAGG - Intergenic
993649850 5:90506815-90506837 AGGAAGTTCTCTTGATAGCAAGG - Intronic
993735103 5:91466930-91466952 AGCCAGTTGTTTAGAAAAGATGG + Intergenic
994031006 5:95142911-95142933 AGCTAGTGCTTTAAATATGATGG + Intronic
995404453 5:111778868-111778890 AGCAAGTTCTTTGGTTACCAAGG + Intronic
996432518 5:123397627-123397649 ACCAAGTTCTTTATATAGTGGGG + Intronic
999823409 5:155250974-155250996 AGTAAGTACTTCAGCTAGGAAGG - Intergenic
1000118876 5:158178090-158178112 AGCAAGTGCTTTACAGATGAGGG - Intergenic
1001899539 5:175414045-175414067 AAAAAGTTCTTTAAATAGAAAGG - Intergenic
1004528883 6:16435519-16435541 AGGAAGGTATTTAGACAGGAGGG + Intronic
1006479434 6:34279977-34279999 GGCCTGTTCTTTAGAGAGGAAGG + Exonic
1009471801 6:64035345-64035367 AGAAAATTCTTTAGATGTGATGG + Intronic
1010736953 6:79453791-79453813 AGCAAGTAATTTAGAAAGAAAGG - Intergenic
1012021115 6:93920819-93920841 AGCAAGTGCTCTAGATAGTGAGG + Intergenic
1013255411 6:108380037-108380059 ACCAAGATCTTTACACAGGAGGG + Intronic
1014897966 6:126926973-126926995 AGGAAGTTCTGTAGGTTGGATGG + Intergenic
1015726640 6:136306144-136306166 AGCAAGTTCTCCAGTAAGGAGGG + Intergenic
1015958132 6:138619527-138619549 AGCAGGTTCTTTAATTAGGTGGG - Intronic
1016600143 6:145849053-145849075 AGCAAGTTCTTTTTATCTGAGGG + Intergenic
1017046266 6:150349732-150349754 AGCAAGTTCATGAGCTTGGAAGG - Intergenic
1018692249 6:166356314-166356336 AGCATGCTATTTAGATAGGTTGG + Intergenic
1019169242 6:170122141-170122163 AGGAAGTACTTTAGACAGAAAGG - Intergenic
1020367752 7:7398649-7398671 AGATAGCTGTTTAGATAGGAGGG - Intronic
1023544430 7:41303250-41303272 AGAAAGTTCTTCAGACAGAAGGG - Intergenic
1024947980 7:54831085-54831107 AGAAGGTTATTCAGATAGGATGG - Intergenic
1026489769 7:70852581-70852603 GGCAATTTCTTAAGATAAGATGG + Intergenic
1026950474 7:74343270-74343292 AACAAGTTCCTTGGACAGGATGG - Intronic
1028446785 7:90933592-90933614 AGTAACTTCTTTATATAGAATGG + Intronic
1028895494 7:96036677-96036699 AGGCACTTCTTTAGATTGGATGG - Intronic
1029865403 7:103622359-103622381 TGCATGTTCTTAGGATAGGATGG - Intronic
1030384498 7:108851415-108851437 AGCAAGTTTTGTCTATAGGAGGG + Intergenic
1031393029 7:121239112-121239134 AACAACTTCTTTCAATAGGAGGG - Intronic
1031840058 7:126726807-126726829 AGAATTTTCTTTAGATTGGAAGG - Intronic
1033105756 7:138521092-138521114 AGCATATTCTTTAAATATGAAGG + Intronic
1035495911 7:159325961-159325983 AGCAAGCTCCTTAGATGTGAGGG - Intergenic
1036956708 8:13195399-13195421 AGCTATTTATTTATATAGGAAGG - Intronic
1038556022 8:28517095-28517117 TGAAAGTTCTTTAGACAGAAGGG - Intronic
1038842590 8:31199371-31199393 AGGAAGTTCTTTAAACAGAAAGG - Intergenic
1039724384 8:40199867-40199889 AGGAAATTCTTTAGGAAGGAGGG - Intergenic
1041633730 8:60118590-60118612 AGCAAGTACTCTAGACAGGGTGG + Intergenic
1041835387 8:62207373-62207395 AGCAAGGTTTTTAGATATGAAGG - Intergenic
1042302331 8:67298419-67298441 AGCAAGTTCTATAGATGGATGGG + Intronic
1042600720 8:70496788-70496810 AGTAAGTTCTTTAGATTGCAAGG - Intergenic
1043321304 8:78989917-78989939 ATCAAATTCTTTAGATAAAAAGG + Intergenic
1047992486 8:130300745-130300767 ATCCAGTTGTTTAGAAAGGAGGG - Intronic
1048570455 8:135650357-135650379 AGCATGCTCTTTAGAGAGGGTGG - Intronic
1050235493 9:3574852-3574874 AGAAACCTGTTTAGATAGGATGG + Intergenic
1051531877 9:18113122-18113144 AGTAAGTCATTTAGATACGATGG + Intergenic
1051749409 9:20325681-20325703 AGCAAGTTCTTGAGAACGGTGGG - Intergenic
1052042972 9:23761318-23761340 AGCACGTTCTTGGGATAGAAGGG - Intronic
1052078121 9:24170324-24170346 AGCAAATACTTTAGATTGGGTGG + Intergenic
1052493978 9:29203178-29203200 AAAAAGTTCTTTAGAAAGAAGGG + Intergenic
1056050522 9:82763734-82763756 GGCAAGTTCTTTGCATAGAAAGG + Intergenic
1056621079 9:88215301-88215323 GGCAGGTTCTGTAGATAGGGAGG - Intergenic
1060377972 9:123135491-123135513 AGCAAGGTATTTAGAAAAGATGG - Intronic
1186326051 X:8477784-8477806 AGAAAGCTCTTCAGGTAGGATGG - Intergenic
1189857591 X:45238788-45238810 AGCAAGTTCTTTCTAGAGGGAGG + Intergenic
1189948392 X:46203704-46203726 AGGAAGTTCTGAAGATGGGATGG + Intergenic
1195662121 X:107389368-107389390 AACAAGTTCTTTAGTTGGGCTGG - Intergenic
1196116743 X:112006996-112007018 AGCTAGTCCTGAAGATAGGAAGG + Intronic
1196761149 X:119202157-119202179 AGCAGGATATTTAGATAGGTTGG + Intergenic
1196996931 X:121394418-121394440 AGCTGCTTCTTCAGATAGGAAGG + Intergenic
1197184278 X:123569620-123569642 ATCACATTCTTTAGATGGGAAGG - Intergenic
1197334154 X:125191493-125191515 ATAAAGTTCATTACATAGGATGG + Intergenic