ID: 905611853

View in Genome Browser
Species Human (GRCh38)
Location 1:39359622-39359644
Sequence CTTGGCTACATCTTGAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905611853_905611857 27 Left 905611853 1:39359622-39359644 CCATGCTTCAAGATGTAGCCAAG 0: 1
1: 0
2: 1
3: 13
4: 124
Right 905611857 1:39359672-39359694 ACAATATATCGTATACAGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 91
905611853_905611856 23 Left 905611853 1:39359622-39359644 CCATGCTTCAAGATGTAGCCAAG 0: 1
1: 0
2: 1
3: 13
4: 124
Right 905611856 1:39359668-39359690 AATAACAATATATCGTATACAGG 0: 1
1: 0
2: 4
3: 42
4: 487
905611853_905611858 28 Left 905611853 1:39359622-39359644 CCATGCTTCAAGATGTAGCCAAG 0: 1
1: 0
2: 1
3: 13
4: 124
Right 905611858 1:39359673-39359695 CAATATATCGTATACAGGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905611853 Original CRISPR CTTGGCTACATCTTGAAGCA TGG (reversed) Intronic
901144109 1:7053661-7053683 CTTGGCCACTTCTCGAAGCAGGG + Intronic
901315637 1:8305917-8305939 CTTAGCTACATTTAGAAACATGG - Intergenic
901982304 1:13046114-13046136 CTGGGCAACATGTTGAAGCCTGG + Intronic
902800598 1:18827192-18827214 CTTGGCCACATCTTGCTACAAGG - Intergenic
904558767 1:31382911-31382933 CTTGGCTACATCTACATGCAAGG + Intergenic
904821809 1:33250178-33250200 GTTGGCTACATCTTGGGGCCAGG - Intergenic
905611853 1:39359622-39359644 CTTGGCTACATCTTGAAGCATGG - Intronic
907172844 1:52487143-52487165 CTTTGCTAAGTCTTCAAGCAAGG - Intronic
907693166 1:56691461-56691483 TTTGACTACATCTGTAAGCATGG + Exonic
909361678 1:74767243-74767265 CTTGCCTTCATCCTGAAGGAAGG - Intergenic
909541812 1:76800187-76800209 TTTGGCTAAATTTTGATGCATGG + Intergenic
910273701 1:85425372-85425394 CATGGCTAGCTCTAGAAGCAGGG - Intronic
910286155 1:85556387-85556409 TTTGGGTACATTTTCAAGCAAGG - Intronic
914830828 1:151169745-151169767 CCTGGCCACATCTGGAAACAGGG + Exonic
917754036 1:178081401-178081423 CTTGGCAACAGCGTGAAGAAAGG + Intergenic
918328685 1:183434900-183434922 TTTTCCTAAATCTTGAAGCATGG - Intergenic
921967829 1:221110331-221110353 CTTGGATAGATATTGAAGAATGG + Intergenic
923476460 1:234336347-234336369 CTTAGCTAAATGTTGAAGGAGGG + Intergenic
924212899 1:241788863-241788885 CTTTACTGCATCTTGAAGCTTGG - Intronic
1064745321 10:18472826-18472848 GGTAGCTACATTTTGAAGCAAGG - Intronic
1065105864 10:22383847-22383869 CTTGGCTAGATCTTGGGGAAAGG - Intronic
1066293169 10:34032127-34032149 ATTGGATTCTTCTTGAAGCATGG + Intergenic
1067690051 10:48496057-48496079 CTTGGCTGCATCCTGTAGCTTGG - Intronic
1068351534 10:55852745-55852767 CTGGGCTACATTCTGAAGAAAGG + Intergenic
1069226327 10:65949681-65949703 GTTGGTTCCATCTTGAAGCAAGG + Intronic
1073963743 10:108964150-108964172 CTCTACTACATCTTGCAGCAAGG + Intergenic
1074485664 10:113875659-113875681 CTTTTCTCCATCTTCAAGCAGGG + Intronic
1074956672 10:118397436-118397458 CTTTGTGACATCTTAAAGCACGG + Intergenic
1079555222 11:21752063-21752085 CTTGGCAAAAACTTGATGCATGG - Intergenic
1085376407 11:76066399-76066421 AATGCCTACATCTTGAAGTAGGG - Intronic
1086637773 11:89111000-89111022 CTTGGTCAAATCTTGAAGCATGG - Intergenic
1088362901 11:109009753-109009775 CTTACTTAGATCTTGAAGCAAGG + Intergenic
1088718818 11:112573981-112574003 CTTGTCTCCATTTTGTAGCATGG - Intergenic
1090577131 11:128117379-128117401 CTTGGCTTTATCTTTAAGCAAGG - Intergenic
1092100065 12:5875809-5875831 CTAGGCTACATCTAGAATGACGG + Intronic
1093264658 12:16988778-16988800 ATTGGCTACATCTAAATGCAAGG - Intergenic
1093718124 12:22407182-22407204 GATGGCTACCTCTTGAATCAAGG - Intronic
1094214487 12:27925955-27925977 CTTAGCTAGATGTTGAAACAAGG + Intergenic
1097795311 12:63855337-63855359 CATGGCCACATCTTGCTGCAAGG + Intronic
1103117229 12:118346333-118346355 TTTGGCAACATCTTAAAACAGGG + Intronic
1113685538 13:112280141-112280163 CCTGGCTCCATCCTGAAGGAAGG - Intergenic
1113686667 13:112286530-112286552 CCTGGCTCCATCCTGAAGGAAGG - Intergenic
1113687298 13:112290168-112290190 CCTGGCTCCATCCTGAAGGAAGG - Intergenic
1115050741 14:29059634-29059656 CTTGCTTACATCTTGATACATGG - Intergenic
1117765628 14:59079382-59079404 CATGGCCACATCTAGATGCAAGG + Intergenic
1117966917 14:61215850-61215872 ATTGGATACAGCTTGAAGAATGG - Intronic
1132534592 16:471784-471806 CCTGGCTGCATCTGGGAGCAGGG - Intronic
1133076606 16:3285131-3285153 ATTGGCTCCAGCTTGAAGCTCGG - Exonic
1134202521 16:12210668-12210690 CTTGGCTACAACCTGAAGCAAGG - Intronic
1135004813 16:18810625-18810647 CTTGACTAGATCTTGAAGGTCGG + Intronic
1140256603 16:73342370-73342392 CATGGCTACATACTGAAGCATGG + Intergenic
1203144262 16_KI270728v1_random:1789972-1789994 CTTTGCTAAATCTGAAAGCAGGG + Intergenic
1143534615 17:7529735-7529757 CTTCATTACTTCTTGAAGCATGG + Intergenic
1145971643 17:28959766-28959788 CCTGGCTACACCCTGGAGCAGGG - Exonic
1146750399 17:35373508-35373530 CTGGGCTAGACCCTGAAGCACGG + Intronic
1154349989 18:13574804-13574826 TTTGGCTACAGCTTGGAACATGG - Intronic
1155094084 18:22539176-22539198 CTTGTTTACTTCTTAAAGCAGGG + Intergenic
1155622812 18:27799934-27799956 GTTGGCTACTTATTGAATCAAGG - Intergenic
1155739370 18:29268201-29268223 ATTGGCTATTTCTTTAAGCATGG + Intergenic
1157075014 18:44455983-44456005 CATTTCTACTTCTTGAAGCATGG + Intergenic
1162384063 19:10350746-10350768 CTTGGTTTCATCCTGGAGCAGGG + Exonic
1163693483 19:18750454-18750476 CTTGGCTCCAATTTGAAGCCGGG + Intronic
1167835012 19:52061222-52061244 CTTGGCTACATCCTCAACCATGG + Intronic
1168667754 19:58217392-58217414 TTTGGCTACACCTGGGAGCAGGG + Intergenic
926964841 2:18398582-18398604 CATGGCTGCATCTGGAAACAAGG + Intergenic
928844855 2:35658440-35658462 CTTTGCTTCTTCTTGAAGCCAGG - Intergenic
930715522 2:54590619-54590641 CTTGGCTGGATCTTAAAGGAAGG + Intronic
930742347 2:54844424-54844446 CTTGGCTGCATCTTAAATCATGG + Intronic
938897469 2:135766460-135766482 CTTGACTGGATCTTGAATCAAGG - Intronic
943965799 2:194330157-194330179 CTTAGCTATATCTAAAAGCATGG - Intergenic
946942950 2:224789236-224789258 CTTGGTAACATCATGAAGAAAGG - Intronic
948454329 2:238097727-238097749 CGTGGGGACATCCTGAAGCAAGG - Intronic
1169996996 20:11569514-11569536 CTTTACTACATCTTGAATCTGGG - Intergenic
1170136820 20:13083758-13083780 CTTTGCTCCATCTTGAAGAATGG - Intronic
1173919216 20:46731342-46731364 CTTGGCTACACCTATATGCAGGG + Intronic
1174036217 20:47669885-47669907 CTGTGCCACATATTGAAGCAAGG + Intronic
1176878008 21:14153546-14153568 CTTGGTTGCATATTGAAACATGG - Intronic
1178621360 21:34179690-34179712 CTTGGCTTTCTCTTCAAGCAAGG + Intergenic
1179285110 21:39970592-39970614 CTTGGTAAAATTTTGAAGCAAGG + Intergenic
1180861938 22:19088372-19088394 CTGAGCTACACCTTGAAGGATGG + Intronic
949117938 3:350947-350969 TTTGGCTACATCGTGCAACAGGG + Intronic
949167017 3:954991-955013 TTTGACTGAATCTTGAAGCAAGG + Intergenic
950540860 3:13611818-13611840 CCTGGCTACATCTAGCTGCAAGG + Intronic
951691313 3:25399356-25399378 CATGGCTACTCCTTGATGCAAGG - Intronic
954612318 3:51952094-51952116 CTTGGCTACAACTTGAATTTGGG - Intergenic
963030596 3:140970972-140970994 CTCGGTTACAGCTTGATGCAAGG + Exonic
963084062 3:141420581-141420603 CTTGGCTTCATCTTTAAAGAAGG - Intronic
966679385 3:182625326-182625348 CTTGGCTACCTCTAGCTGCAAGG - Intergenic
968790583 4:2658473-2658495 CTTGGCTTCATCTGGAAACTTGG + Intronic
968986826 4:3880201-3880223 CTTGGGTGCATCTTGAAGGAAGG - Intergenic
969676030 4:8614854-8614876 CAGGGCTTCATCTTGAAGAAGGG + Intronic
972197447 4:36671358-36671380 CTAGGCTAGATCTTGGAACAGGG + Intergenic
972575238 4:40345359-40345381 CTTGGCAACATAGTGAGGCATGG + Intronic
981070249 4:140527996-140528018 CTTGGCCCCAGCTTGAAGTAAGG - Intronic
981849441 4:149211996-149212018 CTTGGGTATATATTGAGGCATGG - Intergenic
983393892 4:167168871-167168893 CTAGGCTACACATAGAAGCAGGG - Intronic
984043039 4:174760890-174760912 CTTGTCTACATATACAAGCATGG + Intronic
984144500 4:176044492-176044514 CCTGGCTACATCTTCTTGCAGGG - Intergenic
985987307 5:3526967-3526989 GCTGGCTGCATTTTGAAGCAGGG - Intergenic
988028887 5:25737415-25737437 TTTGGCTAAATCTAGAAGAAAGG + Intergenic
989652215 5:43704331-43704353 CTTGGCATCACCTAGAAGCATGG - Exonic
991971043 5:72141914-72141936 CTTCCCTGCATCTTGGAGCAAGG + Intronic
993697541 5:91079636-91079658 CTTGGCTACATTGTAAATCAGGG - Intronic
996992186 5:129648794-129648816 CTAGGCTAGATTCTGAAGCAAGG + Exonic
998679676 5:144453079-144453101 GTTGGCAACATCTTGGGGCATGG + Intronic
1000615577 5:163422310-163422332 CTTGGCTACTTCATAAAACATGG - Intergenic
1002357583 5:178643094-178643116 CTTCTTTACATCTTCAAGCATGG + Intergenic
1003904828 6:10689558-10689580 CCTGGCCACATCTTGCTGCAAGG - Intronic
1007838285 6:44694606-44694628 ATTTGTTAAATCTTGAAGCATGG + Intergenic
1013241145 6:108246938-108246960 CTTAGCTATATCATAAAGCATGG + Intronic
1017496684 6:154989766-154989788 CTTGGCTAGATCTTGAGGCGTGG + Intronic
1021271086 7:18586828-18586850 CATGGCTACATTTTGAAGTATGG + Intronic
1023708918 7:42970970-42970992 CCTGGGTACATCTTCAACCATGG + Intergenic
1024144851 7:46503597-46503619 CTTGGCTCCATCATTTAGCATGG - Intergenic
1026931553 7:74225610-74225632 CAAGGCCACATCTTGAAGTAAGG + Intronic
1027255746 7:76429707-76429729 ATGGGCTACAGCTTGCAGCATGG + Intronic
1028747582 7:94345423-94345445 TCTGGCTACATCTTAAAGCAGGG - Intergenic
1030224452 7:107133604-107133626 CTTGGCTTCATCTTCAACCTTGG + Intronic
1030464267 7:109879988-109880010 CTTGGCTAGATCCAGTAGCAAGG + Intergenic
1031887657 7:127257805-127257827 CTTGACTCCATCTGGATGCAAGG - Intergenic
1031985178 7:128159607-128159629 CATGGCTACATCCTGATGCCTGG + Intergenic
1036120760 8:6014637-6014659 CGTGGCTACATCCAAAAGCATGG - Intergenic
1038995709 8:32920740-32920762 CTTAGCTCCATCTTGTAGCTGGG + Intergenic
1044899946 8:96933701-96933723 ATTGGCTCCATCTTGCAACATGG - Intronic
1047001365 8:120576020-120576042 CTAGGATACATCTTTAAGCTCGG + Intronic
1051266708 9:15316272-15316294 ATGGGCTACATCTGGAAGCCAGG - Intergenic
1051425869 9:16930904-16930926 CTCAGCTACATCTTTAAGGAGGG + Intergenic
1051688916 9:19688121-19688143 CTTGTATAAATCTTGAAGTAAGG + Intronic
1052874978 9:33552285-33552307 TTTGGCTACATAGTGAAGGAAGG - Intronic
1053501041 9:38592041-38592063 TTTGGCTACATAGTGAAGGAAGG + Intergenic
1055729958 9:79270376-79270398 CTGAGCTATATCTTGAAGGATGG + Intergenic
1056372834 9:85974576-85974598 CTTATCTAAATCTTGCAGCACGG + Intronic
1058598068 9:106637427-106637449 CTTGTCTATATCTTGAGGCTTGG - Intergenic
1060960119 9:127674826-127674848 CTTGCCTGCATCATGAAGCGGGG + Intronic
1061385996 9:130289672-130289694 CTGGGCTCCACATTGAAGCACGG - Intronic
1062004332 9:134231765-134231787 CTTGGCTGCTCCCTGAAGCAGGG + Intergenic
1191792543 X:64986314-64986336 CCAGGCCACATCTTGAAACATGG - Intronic
1193027290 X:76858210-76858232 CTTGGCTCCCTCTGGAAACAGGG - Intergenic
1195708741 X:107757558-107757580 ATGGGCTACATCTGGAAACAAGG - Intronic