ID: 905611926

View in Genome Browser
Species Human (GRCh38)
Location 1:39360544-39360566
Sequence GTTCAATGTAGGACTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905611922_905611926 19 Left 905611922 1:39360502-39360524 CCTTCTATTGGTCTTAATGTCAA 0: 1
1: 0
2: 1
3: 10
4: 107
Right 905611926 1:39360544-39360566 GTTCAATGTAGGACTGGGCATGG 0: 1
1: 0
2: 0
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905611926 Original CRISPR GTTCAATGTAGGACTGGGCA TGG Intronic
900795483 1:4705725-4705747 GTTCTAAGGAGGACTGGTCAGGG - Intronic
901907170 1:12423428-12423450 GTTCACTGTGGGACTAGGTAGGG - Intronic
903743627 1:25572675-25572697 GGTTGATGGAGGACTGGGCATGG - Intergenic
905611926 1:39360544-39360566 GTTCAATGTAGGACTGGGCATGG + Intronic
905891160 1:41519207-41519229 GTTCAGGGAAGGCCTGGGCAAGG + Intronic
909558200 1:76979634-76979656 CTGTAATGTAAGACTGGGCATGG + Intronic
910622751 1:89273946-89273968 CTTCCATGAGGGACTGGGCACGG + Intergenic
910985870 1:93004034-93004056 TTTAAATTTAGGGCTGGGCATGG - Intergenic
911640806 1:100286697-100286719 GTTTAAAGTAGACCTGGGCAAGG - Intronic
914838838 1:151230930-151230952 GTTAATTTTAGGGCTGGGCATGG + Intronic
915016597 1:152739907-152739929 GAACAATGTAGGACTAGGCCAGG - Intronic
915794967 1:158720504-158720526 GTTCAGTGTGGTTCTGGGCATGG - Intergenic
916044614 1:160990090-160990112 GTTCCATGTCAGACTGGGCGTGG + Intergenic
916346308 1:163795593-163795615 GTTGAATGAAGGACTGGAAAGGG - Intergenic
916952112 1:169790911-169790933 TTTCCATGAAGGGCTGGGCAGGG + Intronic
919824976 1:201497058-201497080 TTTAAATGCAGGGCTGGGCATGG + Intronic
920416012 1:205799818-205799840 GTCCAATGTTGGCCTGGGAAAGG + Exonic
920672474 1:208015159-208015181 GCTCAAGGTTGGGCTGGGCATGG - Intergenic
923383158 1:233441696-233441718 GGTCGAGGGAGGACTGGGCAAGG - Intergenic
1064046060 10:12016730-12016752 CTGCAATGTAGGGCCGGGCACGG + Intronic
1065448521 10:25828696-25828718 GTTTAAGGGAGGGCTGGGCACGG - Intergenic
1067804311 10:49382551-49382573 GCCCAATCTAGGCCTGGGCAAGG - Intronic
1068565264 10:58567902-58567924 CTTCAATGTTGGAAAGGGCATGG + Intronic
1069043442 10:63718342-63718364 GTTCAAGGTAATACTGGTCAGGG - Intergenic
1070070501 10:73084602-73084624 ATTCAATCTTGGTCTGGGCACGG - Intronic
1070350120 10:75583756-75583778 GTGCAATGTGAGACTGGGGAAGG - Intronic
1072460357 10:95612699-95612721 GTTCAAATTAGGTCTGGGGAGGG + Intronic
1072588656 10:96806237-96806259 TTTCAATCTGGGACTGAGCATGG - Intergenic
1074712451 10:116188611-116188633 GGTCAATGTTGGGCCGGGCACGG + Intronic
1075564402 10:123493064-123493086 GTCCAAGGCTGGACTGGGCATGG + Intergenic
1075827596 10:125373059-125373081 GTGCCAAGTAGGGCTGGGCATGG + Intergenic
1076748594 10:132528059-132528081 GTTCAAAGCAGGGCTGGGCAGGG + Intergenic
1078052721 11:7981041-7981063 GGTCAATGATGGACTGGGCGTGG - Intronic
1081414113 11:42792873-42792895 TTTCAATGTAGGAATTAGCAGGG + Intergenic
1081571229 11:44292507-44292529 GTACAAACTAGGACTGGGCATGG - Intronic
1081778113 11:45690952-45690974 GTCCAAGTTAGGCCTGGGCATGG - Intergenic
1083438857 11:62662784-62662806 ATTAAATGTAGGAATGGGGATGG - Intronic
1083995200 11:66268324-66268346 GCTCAATTTAGGGCTGGGCTTGG - Intergenic
1084474134 11:69379081-69379103 GGTCACTGTGGGACAGGGCATGG + Intergenic
1085296437 11:75434277-75434299 GTCCAATGTAGGGCTGGGAGTGG - Intergenic
1088338132 11:108731339-108731361 GTTCAAAAAAGGGCTGGGCATGG - Intronic
1088404996 11:109465293-109465315 GTTCATTGTAGAACTGGGACAGG + Intergenic
1089488299 11:118864268-118864290 GTTCAGTTTTGGGCTGGGCATGG - Intergenic
1089571505 11:119414205-119414227 GTTCAAGGTGAGCCTGGGCAAGG - Intergenic
1092917790 12:13203753-13203775 GTTCAAAGTAGCACAGAGCAGGG - Intronic
1093170736 12:15857444-15857466 GTTCATTGTGGGGCCGGGCACGG - Intronic
1096242989 12:49969201-49969223 GCTCAAGGGATGACTGGGCATGG - Intronic
1097914217 12:65003147-65003169 CTTCAATCTCGGGCTGGGCATGG + Intergenic
1099937198 12:89140857-89140879 GTTCAATTTAGGAATGTTCAGGG - Intergenic
1102931569 12:116866264-116866286 CTTGAAGGAAGGACTGGGCATGG + Intronic
1108040945 13:46338764-46338786 GTTCAAGGAAGGGCTGGGCGCGG + Intergenic
1110680768 13:78309356-78309378 GTTCAATGTATACCTGGGAAGGG - Intergenic
1110695442 13:78482669-78482691 GTTAAATGAAGGGCGGGGCAGGG + Intergenic
1110795653 13:79634470-79634492 GTTGAATGCATGACTGGGCCAGG + Intergenic
1116241055 14:42343458-42343480 ATTCAATGTAGGTCTTAGCATGG - Intergenic
1118389830 14:65287011-65287033 GTTCCAAGTATGACTGGGCAAGG + Intergenic
1121679041 14:95777342-95777364 GTGCAAGGTAGGCCTGGGCTGGG - Intergenic
1122619498 14:103046939-103046961 ATTCAATGTAAGGCTGGGCGCGG - Intronic
1125284220 15:38074448-38074470 ATTCAATGTAGTACTTGGCGTGG + Intergenic
1127339283 15:58023799-58023821 GCTCAAAATAGGGCTGGGCAGGG + Intronic
1129835155 15:78699640-78699662 GATCAATTCAGGGCTGGGCACGG - Intronic
1130298588 15:82663971-82663993 GTTCACTGAAGGAGTGGGAAAGG + Exonic
1130851666 15:87800750-87800772 GCTCATTCCAGGACTGGGCAGGG - Intergenic
1131096553 15:89658565-89658587 ATTAAATGTAGGGCTGGGCCAGG + Intergenic
1133103826 16:3494493-3494515 TGTCAAGGCAGGACTGGGCACGG - Intronic
1135495320 16:22946590-22946612 GTAGAAAGTAGGACTGGGAAGGG + Intergenic
1136536187 16:30901181-30901203 GATAAATGTGGGGCTGGGCACGG - Intronic
1137992968 16:53178664-53178686 GTTCAAGATAAGCCTGGGCAAGG - Intronic
1156522705 18:37735336-37735358 GATCCTTGGAGGACTGGGCAGGG - Intergenic
1156870255 18:41937459-41937481 AGTCAGTGTCGGACTGGGCAGGG + Intergenic
1158227779 18:55218462-55218484 GAACAATGAAGAACTGGGCAGGG - Intergenic
1159457694 18:68682094-68682116 GATCTATGTAGGACAGGGCTGGG - Intronic
1165045799 19:33104037-33104059 TTTCAATCCAAGACTGGGCATGG + Intronic
1165770409 19:38376641-38376663 GTGCAATGTGGGAATGGGTAGGG - Intronic
1167014951 19:46835113-46835135 GTTCAGAGTGGGACTGGGGATGG - Intergenic
1167228739 19:48267993-48268015 GTAAAATGTATGGCTGGGCATGG - Intronic
926956388 2:18305881-18305903 GTAGAAGGTAGGACTGGGCCTGG + Intronic
928565218 2:32538638-32538660 GTACAGTGTATGGCTGGGCATGG + Intronic
935371096 2:102347623-102347645 GCTCCATGCAGGACTGGGAAAGG - Intronic
936093798 2:109516961-109516983 GTACACTGGAGGACTGGGCTGGG - Intergenic
937908526 2:127064378-127064400 GTTCATTGTGGAAGTGGGCAGGG - Intronic
939923663 2:148147528-148147550 GTTCAGTTTGGGGCTGGGCATGG - Intronic
947037936 2:225880964-225880986 GTAGACTATAGGACTGGGCATGG - Intergenic
947621042 2:231591279-231591301 GTTGAATGAGGGACTGGGCATGG - Intergenic
1169220926 20:3822307-3822329 GTTCAATGAAGGCCTGGGGCTGG - Intronic
1172836985 20:37879323-37879345 GTTCAATGTGGGAGTGGGGCAGG - Intergenic
1175578593 20:60081065-60081087 CTCCAAAGTAGGAATGGGCAAGG + Intergenic
1178307686 21:31504052-31504074 GTTCACTGTAAGGTTGGGCAGGG - Intronic
1179399306 21:41069500-41069522 GTAAATTGTAGGGCTGGGCATGG + Intergenic
1179479317 21:41667609-41667631 TTTCATTGCAAGACTGGGCATGG + Intergenic
1183450136 22:37889339-37889361 ATTCAATTTAGGGCTGGGCACGG - Exonic
949694759 3:6681456-6681478 GTCCAAAGTATGGCTGGGCATGG - Intergenic
951150809 3:19287872-19287894 GTCGAATGTGGGGCTGGGCATGG - Intronic
951992994 3:28696757-28696779 GTTCCATGTTGGAGTGGGGAGGG + Intergenic
954211882 3:49102403-49102425 GTTCAAGGTAGGGATGGGCATGG - Exonic
954609856 3:51938619-51938641 GTTGATTGTTTGACTGGGCATGG - Intronic
955195857 3:56804173-56804195 GATCATTTTAGGGCTGGGCATGG - Intronic
956936873 3:74112476-74112498 GTTCAATGAAGGACTGTCAAAGG - Intergenic
958801227 3:98758127-98758149 GTTAAAATTAGGACCGGGCACGG - Intronic
961096609 3:124162030-124162052 GTTCAATGTAGAACTGCCCATGG + Intronic
962588822 3:136868204-136868226 TTACAATGTAAGGCTGGGCATGG - Intronic
963899743 3:150722661-150722683 GATAGATGTAGGGCTGGGCATGG - Intergenic
967759250 3:193205129-193205151 AATCAATATAGGAGTGGGCATGG + Intergenic
969030112 4:4205060-4205082 GCACCATGTAGGACTGGGCGCGG - Intronic
971867602 4:32192339-32192361 CTTCAATATAGGAATGGGCGTGG - Intergenic
974771171 4:66415622-66415644 GTTCACAGTAGGACTGGGAGAGG - Intergenic
976148922 4:82073248-82073270 GGCCAATATAGGACTGAGCAAGG - Intergenic
976205378 4:82619012-82619034 GGTCAAAGCAGGACTGGGCCAGG + Intergenic
983291470 4:165812141-165812163 TTTAAATGCAGGGCTGGGCATGG - Intergenic
987791670 5:22576222-22576244 CTTCAAAGCAGGACTGCGCATGG - Intronic
988191247 5:27938223-27938245 TTTGGATGTAGGACAGGGCAAGG + Intergenic
991480982 5:67079474-67079496 CTGAATTGTAGGACTGGGCATGG + Intronic
992674037 5:79087887-79087909 GTGAAATGTAAGGCTGGGCATGG + Intronic
992837503 5:80654969-80654991 GTTCTGTCTGGGACTGGGCAGGG + Exonic
997328030 5:133038155-133038177 GTTCCATGTATGGCTGGGCATGG + Intergenic
998248630 5:140533306-140533328 GCTCAGTGTGGGACCGGGCACGG + Intronic
1002555110 5:180031194-180031216 ATTAAATTTAGGGCTGGGCACGG + Intronic
1004391196 6:15211127-15211149 TAAAAATGTAGGACTGGGCATGG - Intergenic
1005977707 6:30812793-30812815 GCTCCATGTAGGGCTGGGCGCGG - Intergenic
1011045819 6:83081395-83081417 GTTGGTTGTAGGGCTGGGCATGG - Intronic
1013499325 6:110732203-110732225 ATTCAAGGTAGGGCCGGGCATGG + Intronic
1015752300 6:136572545-136572567 TTTCAGTTTAGGGCTGGGCATGG - Intronic
1016956805 6:149634659-149634681 TATCAAAGTAGGGCTGGGCATGG - Intronic
1018129769 6:160717959-160717981 ATTCATTGTAGGGCTGGGCACGG + Intronic
1018602166 6:165556166-165556188 GTTATATGCAGGACTGGGCTGGG + Intronic
1020771891 7:12404959-12404981 GTTCAAGGTTGGCCTAGGCATGG + Intergenic
1025872308 7:65446590-65446612 GTTAAATTTAGGACTGTGTAGGG + Intergenic
1028783876 7:94769683-94769705 ATTCACTGTTGGACAGGGCAGGG + Intergenic
1029090672 7:98045724-98045746 CTTCAATGTAGGAATGTGGAGGG - Intergenic
1029297541 7:99553327-99553349 CTTCAGTGTAGGAATGGGGACGG - Intronic
1031297525 7:120021500-120021522 GTTGAAAGTGGGACTGGGGATGG - Intergenic
1032253569 7:130278911-130278933 GTCCATTGTAGGCCTGGCCAGGG - Intronic
1033535707 7:142310017-142310039 GTTGAATGTAGGACTTGCTAGGG + Intergenic
1034684346 7:152956948-152956970 CTTGAATGTTGGGCTGGGCATGG + Intergenic
1036651169 8:10645034-10645056 CTGTAATGTAGGATTGGGCATGG + Intronic
1036710713 8:11076799-11076821 ATTCAAGGTAGCAGTGGGCACGG - Intronic
1045203982 8:100017270-100017292 TTTCAATAAAGGACTGGGCATGG - Intronic
1045253931 8:100503426-100503448 GTTCAGTGCAGGGCTGGGGAAGG - Intergenic
1047094676 8:121611132-121611154 ATACATTTTAGGACTGGGCATGG - Intergenic
1048783678 8:138028143-138028165 GTTCACTGTGGGACAGTGCATGG + Intergenic
1049629700 8:143646867-143646889 GTTCAACGTCTGCCTGGGCAAGG - Intronic
1051344322 9:16138832-16138854 GTGCACTGGAGGACTGGGCTGGG + Intergenic
1052810431 9:33053652-33053674 ATTCAATGTAGTACTTGGCATGG + Intronic
1053261371 9:36668059-36668081 GTAAAATGCAGGTCTGGGCATGG - Intronic
1053318602 9:37075157-37075179 GGTAAATGAAGGCCTGGGCACGG - Intergenic
1053322748 9:37114859-37114881 GGTAAATGAAGGCCTGGGCATGG - Intergenic
1053412641 9:37925540-37925562 GTTTTATTTAGGCCTGGGCAGGG - Intronic
1055135344 9:72823136-72823158 TTTCAATGGAGTACTGGGAAGGG + Intronic
1055260913 9:74432604-74432626 ATTCAAAGCAGGACTTGGCAGGG + Intergenic
1055471632 9:76617695-76617717 GTTCATTTCAGGGCTGGGCATGG - Intronic
1059205013 9:112456447-112456469 TTACAATGAAGGACTGGGGAAGG - Intronic
1061640524 9:131951264-131951286 GTACTATGAAGGACAGGGCAAGG - Intronic
1185879139 X:3725022-3725044 TTTGAATGTAGGGCTGGGGAAGG + Intergenic
1186365648 X:8890537-8890559 GATCATTGTAGGAATTGGCAGGG - Intergenic
1186884130 X:13895851-13895873 CTTAAATATGGGACTGGGCATGG + Intronic
1189863212 X:45294671-45294693 GCTCCGTGTAGGATTGGGCAAGG - Intergenic
1190038253 X:47047126-47047148 GTTCAAGATAAGCCTGGGCACGG + Intronic
1190855107 X:54286620-54286642 ATTCAATCAAGGGCTGGGCATGG + Intronic
1192948330 X:75989382-75989404 GTTCAGGGTAGGACTCTGCAAGG - Intergenic
1193019554 X:76776784-76776806 GTTCAACGTAGCATTGGCCAGGG - Intergenic
1196326000 X:114403504-114403526 GTTAAATGTAGAAATGGGAAAGG - Intergenic
1198438161 X:136636860-136636882 GTTCAAGGCAGGACTGGAAAAGG - Intergenic
1198941447 X:141961277-141961299 GCTCATTTTAGGACTGGGCTAGG - Intergenic
1199039692 X:143097727-143097749 AATCAAACTAGGACTGGGCACGG - Intergenic