ID: 905620018

View in Genome Browser
Species Human (GRCh38)
Location 1:39437029-39437051
Sequence CCATTTACACAGCTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905620011_905620018 25 Left 905620011 1:39436981-39437003 CCATGTTACTTTTAAACTACAAG 0: 1
1: 0
2: 1
3: 25
4: 325
Right 905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905620018 Original CRISPR CCATTTACACAGCTGGTGGA GGG Intronic
901694981 1:11000630-11000652 ACATTTACACAACTTTTGGAGGG + Intergenic
901858098 1:12057107-12057129 CGATTTACACAGCTAGTAAATGG + Intergenic
902864218 1:19267689-19267711 GCGTTTACACAGCTGCTGGGGGG - Intergenic
902866440 1:19283120-19283142 GCGTTTACACAGCTGCTGGGGGG - Intronic
905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG + Intronic
907947630 1:59150179-59150201 CCAGTTCCACTGGTGGTGGAAGG - Intergenic
909343495 1:74557954-74557976 CCTTTTACACTGTTGGTGGGAGG + Intergenic
909549516 1:76882159-76882181 CCATTTGCAAAGTTGGTGGTTGG - Intronic
910226188 1:84938880-84938902 CCATTCACACAGCTGTCAGAGGG - Intronic
911133151 1:94411517-94411539 CCTTTTTCATTGCTGGTGGAAGG + Intergenic
915602203 1:156929487-156929509 TCATGTACAGAGGTGGTGGAGGG + Intronic
915663080 1:157419855-157419877 CCATGTCCTCAGATGGTGGAAGG - Intergenic
918194897 1:182212109-182212131 TCTTTTTCACAGCTTGTGGAAGG + Intergenic
921095434 1:211883417-211883439 CAACTTACACAGCTGTTGGAAGG - Intergenic
921808205 1:219479967-219479989 TCATTCACACAGGTGGTAGAAGG + Intergenic
923517061 1:234706923-234706945 CCTTTGACTCTGCTGGTGGAGGG - Intergenic
1064694889 10:17955187-17955209 CCATTTTCAGGGCTGGGGGAAGG + Intronic
1067731023 10:48811679-48811701 CCACTCACAGAGCTGATGGACGG + Exonic
1067907713 10:50310967-50310989 CCAGTTATACAGCTGCTGTAAGG - Intronic
1070983214 10:80666732-80666754 CCATTTACAAAGCTGCTGGCTGG + Intergenic
1071440320 10:85685270-85685292 ACATTTATATAGCTGGTGTATGG - Intronic
1071711915 10:88058282-88058304 CCATTTAAACAGTTGTTTGAGGG - Intergenic
1071988527 10:91076502-91076524 ACATTTACACAGCTGGTTGGAGG + Intergenic
1072655907 10:97330345-97330367 CCATTTGCAAAGCCTGTGGAGGG - Intergenic
1073056462 10:100706409-100706431 AAATTTACACAGCTAGTGAATGG - Intergenic
1074723628 10:116285319-116285341 CCATTTCAACATCTGGCGGAGGG + Intergenic
1078769591 11:14336110-14336132 CCATTGACACTGCTGGGAGAAGG - Intronic
1079477765 11:20849141-20849163 CCATTTAGACAGCATGTGGGTGG - Intronic
1081750638 11:45508363-45508385 GAGTTTACACAGCTGGTGAATGG - Intergenic
1081869599 11:46377296-46377318 CCATTTAGTTAACTGGTGGAGGG - Intronic
1082839405 11:57676858-57676880 CCATTTCTAAAGCTGGTGGGAGG + Intronic
1089353467 11:117834687-117834709 CAGGTTACACAGCTGGGGGATGG - Intronic
1091025536 11:132137741-132137763 GGATATAGACAGCTGGTGGATGG + Intronic
1091662298 12:2393464-2393486 AAAGTTACACAGCTAGTGGATGG - Intronic
1091722151 12:2821241-2821263 CCCTGTGCACAGCAGGTGGACGG - Exonic
1097519438 12:60648511-60648533 CCAGTTCCATAGCTGGTGGGGGG - Intergenic
1098471889 12:70854711-70854733 CCAGTCACACAGTTTGTGGATGG - Intronic
1099951640 12:89310653-89310675 CCATGTGCCCAGCTGGTTGATGG - Intergenic
1100571156 12:95844143-95844165 ACAGTTACACAGGTGGTAGATGG + Intergenic
1102905618 12:116672884-116672906 ACTTCTACACTGCTGGTGGAAGG - Intergenic
1103013465 12:117475920-117475942 CCACTCACACAGCTGTTGGAAGG - Intronic
1104428415 12:128696697-128696719 CCATTTCCACATATGGTGTAAGG - Intronic
1104463850 12:128974960-128974982 TCATCTTCACTGCTGGTGGAGGG - Intronic
1105616510 13:22019337-22019359 TCATTCACATAGGTGGTGGAGGG + Intergenic
1105817559 13:24051042-24051064 ACAGCTACCCAGCTGGTGGATGG - Intronic
1106433146 13:29701407-29701429 ACATGTACACAGCTGGTGGGAGG + Intergenic
1106700212 13:32221200-32221222 ACATTTACAGAGCTGGTGGAGGG - Intronic
1106704159 13:32262731-32262753 GCATGAACACTGCTGGTGGATGG + Intronic
1106920589 13:34559109-34559131 CCATCTCCTCAGCTGCTGGAGGG - Intergenic
1107682600 13:42866970-42866992 CCATCTACTCAGCAGGTTGAGGG - Intergenic
1108238922 13:48441211-48441233 CCATGTCCTCAGATGGTGGAAGG + Intronic
1112092479 13:96095925-96095947 CCATAGATACAGCTGCTGGATGG + Intronic
1112238153 13:97654732-97654754 GCATTTATACACCTGGTAGAGGG - Intergenic
1114133034 14:19815278-19815300 GCTTTTACACTGTTGGTGGAAGG - Intronic
1114267854 14:21083141-21083163 CTATTTCCACAGCTGGTAAATGG + Intronic
1114309625 14:21455288-21455310 GCATTTATACAGCTGCTGCAGGG + Intronic
1114754447 14:25243983-25244005 CTGTTTACAAAGCTGTTGGAGGG - Intergenic
1116731446 14:48627671-48627693 TGATTTACACAGCTGCTGAAAGG + Intergenic
1117258347 14:54003225-54003247 CCATCTGCTCAGCTAGTGGAAGG - Intergenic
1117582417 14:57165471-57165493 TCTTTCACACAGTTGGTGGAAGG + Intergenic
1120535862 14:85693994-85694016 AAACTTACACAACTGGTGGAAGG - Intergenic
1121698353 14:95931511-95931533 CAAATTCCACAGCTGGTGAATGG + Intergenic
1123576123 15:21671090-21671112 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1123612744 15:22113564-22113586 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1129477922 15:75798971-75798993 CCAGCTACACAGGAGGTGGACGG + Intergenic
1130246265 15:82252446-82252468 CCATATAATCACCTGGTGGAGGG + Intronic
1130454368 15:84090514-84090536 CCATATAATCACCTGGTGGAGGG - Intergenic
1132373455 15:101313223-101313245 CCATTTACAGAGCTGCTGAGGGG - Intronic
1202984991 15_KI270727v1_random:405335-405357 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1132977759 16:2719206-2719228 CCATGTGCACAGGAGGTGGAAGG - Intronic
1133421650 16:5651628-5651650 GAATTCACACAGCTGATGGAGGG - Intergenic
1135625925 16:23994912-23994934 CCATTGTCATAGCTTGTGGAAGG - Intronic
1137852915 16:51764041-51764063 CCAGTTACACAGCTGGTTCGAGG + Intergenic
1143906968 17:10216607-10216629 CCATTTGCAAAGCTGGAGGAGGG + Intergenic
1149034833 17:52122066-52122088 CCATTAACACAGCTTGGAGAGGG + Intronic
1151329804 17:73400083-73400105 CCATCTACGCAGCAGGTGGAGGG + Intronic
1152306630 17:79524740-79524762 CCATTTACAAACCTGCTGCACGG - Intergenic
1153166701 18:2269739-2269761 CAAGTCACACAGCTGGTGCATGG + Intergenic
1153328851 18:3851236-3851258 AAATTTACGCAGCAGGTGGAGGG + Intronic
1155901519 18:31396713-31396735 CAATTTACCCAGGTGGTGAATGG + Intronic
1157987304 18:52452726-52452748 CCATTTACACACTTGGTTAAAGG + Intronic
1159036909 18:63286286-63286308 CCTTTTACACAGTTGGGGGCAGG + Intronic
1160939310 19:1612807-1612829 GCAGTTACACAGCTGGTGTCAGG + Intronic
1160939341 19:1613005-1613027 GCAGTTACACAGCTGGTGTCAGG + Intronic
1162771850 19:12953898-12953920 CCAATTACAAGGCTGGTGGGGGG - Exonic
1163600358 19:18245529-18245551 CCATTTTAACAGCCGGGGGAAGG - Intronic
1164632117 19:29768730-29768752 TCATGTACACATCTGGAGGAAGG + Intergenic
1166937483 19:46343198-46343220 CCATTTACCCCGTTTGTGGAAGG + Exonic
1167979766 19:53264592-53264614 ACATTTACACAGCTGGGAGATGG + Intergenic
926371792 2:12186052-12186074 CAAGATACACGGCTGGTGGATGG + Intergenic
926571742 2:14536777-14536799 TCATTTACACCTCTGGTGAATGG + Intergenic
926839192 2:17059601-17059623 TCATTTAGACAGCTGGTCTAAGG + Intergenic
927633223 2:24792674-24792696 CGATTTACACACCTGGTGCCTGG + Intronic
927694641 2:25231466-25231488 AAATTCACACAGCTGGTGGCCGG - Exonic
928262063 2:29776991-29777013 CCAATTACAGAGCTAGTTGATGG - Intronic
931746136 2:65293521-65293543 CCATTTAAATAGCTGATGCAGGG - Intergenic
933980082 2:87542111-87542133 CCATTTACACAGCAGTTTGCAGG + Intergenic
934853381 2:97714934-97714956 CCAGTCACACAGCTGGTGAGTGG - Intronic
935213139 2:100955429-100955451 CCCGGGACACAGCTGGTGGAGGG + Intronic
935472844 2:103480263-103480285 GCATTTACCCAGGTAGTGGATGG - Intergenic
935572028 2:104671679-104671701 ACATTTGCACAGTTGGTGAATGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936313744 2:111408680-111408702 CCATTTACACAGCAGTTTGCAGG - Intergenic
937064895 2:119010532-119010554 ACAGTTACACAGCTGGTAGGAGG + Intergenic
937601174 2:123735280-123735302 CCATTGAAGCATCTGGTGGATGG + Intergenic
940136294 2:150439833-150439855 GCACTGACACAGCTGGGGGATGG - Intergenic
942458280 2:176152288-176152310 CCATTTTCAGAGCAGGGGGAAGG + Intronic
942990993 2:182202530-182202552 CCAGTCACACAGCTGGTACATGG + Intronic
943375789 2:187075174-187075196 ACACTTGCACAGCTGGAGGATGG - Intergenic
944337505 2:198554075-198554097 CAATTCACACACCTGTTGGAGGG + Intronic
944749548 2:202694667-202694689 CCTGTTACAAAGCTGGTGGTTGG + Intronic
945102662 2:206275487-206275509 ACATTTACACAACTGTTGCACGG - Intronic
948851899 2:240712369-240712391 CCGGTCACACCGCTGGTGGAAGG + Intergenic
1171132683 20:22668329-22668351 CCATTAAGATAGGTGGTGGAGGG - Intergenic
1176380025 21:6107767-6107789 CCATTTAAGCAGCCCGTGGAAGG + Intergenic
1176815082 21:13592169-13592191 CCTTTTACACTGTTGGTGGGAGG + Intergenic
1177251638 21:18599080-18599102 CAATTTACACTGTTGGTGGGAGG - Intergenic
1178293010 21:31385737-31385759 CGTTTTAAACAGCTGGTGTAGGG - Intronic
1178491304 21:33053887-33053909 CCAGTCACACTGCTGGTAGATGG - Intergenic
1178592727 21:33924975-33924997 CAAGTCACACAGCTGGTGAAGGG - Intergenic
1179743449 21:43430471-43430493 CCATTTAAGCAGCCCGTGGAAGG - Intergenic
1181821371 22:25478278-25478300 CCACTCACACAGCTGCTGGCTGG - Intergenic
1183341522 22:37284376-37284398 CCATTTGCACAGCTGGGTCAGGG - Intronic
1184325326 22:43778616-43778638 CCATATGCAAAGCTGGTGGCTGG + Intronic
949562227 3:5213659-5213681 CCATTTACATAGCTGTTGTCAGG + Intronic
952005581 3:28838766-28838788 TCATTCTCACAGCTGTTGGAGGG + Intergenic
953573482 3:44093013-44093035 CCTTCTACACAGCTGGGGAAGGG + Intergenic
955821883 3:62905246-62905268 CCAGTCACACAGCTTGTGAATGG + Intergenic
958140750 3:89559381-89559403 CCATGTACAAATCTGGTGTAAGG - Intergenic
959546231 3:107599635-107599657 CCATCTAAGCAGCTGCTGGACGG - Intronic
962157289 3:132961418-132961440 CCTTTTACACTGTTGGTGGGAGG + Intergenic
962392757 3:134986554-134986576 CCATTTACGCATCTGGAGGATGG + Intronic
962512994 3:136120965-136120987 GCACATACACTGCTGGTGGATGG + Intronic
962854009 3:139328392-139328414 CCATTCCCACCGCTGCTGGAGGG + Intronic
963511010 3:146249486-146249508 TCATTTACACATCTGGTAGTAGG + Intronic
967887508 3:194343081-194343103 CTCTTTGCACAGTTGGTGGAGGG + Intronic
968721301 4:2207761-2207783 CCTAGTACACTGCTGGTGGAAGG + Intronic
970261522 4:14229967-14229989 CCATCTACTCAGCTTGTAGATGG + Intergenic
971052402 4:22876003-22876025 AAAGTGACACAGCTGGTGGATGG + Intergenic
972055651 4:34798865-34798887 TCATTCACACAGCTGGTTGTTGG + Intergenic
975556358 4:75669711-75669733 CCATTGACTCAGCTTGTGGATGG - Intronic
976219061 4:82741468-82741490 TCACTCACACAGCTGGTGGTTGG - Intronic
983567063 4:169164495-169164517 CCAAGTACACAGCAGGTGGTGGG + Intronic
985124318 4:186676772-186676794 GAATGCACACAGCTGGTGGAAGG + Intronic
986433822 5:7708559-7708581 CAAATTACACAGCTGGTAAATGG + Intronic
990869829 5:60419051-60419073 CCACTAACACAGCTGCTGGAGGG + Intronic
992071981 5:73156647-73156669 CCATTTACATAGCTAGTGATTGG + Intergenic
993467233 5:88264467-88264489 GCTTTTACACTGCTGGTGGGAGG + Intronic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
997802744 5:136882882-136882904 CCATTTTCACAGAAGGTGGATGG + Intergenic
999742360 5:154566017-154566039 CCATTTGCACAGCTGGTTCCTGG - Intergenic
1001301757 5:170538616-170538638 CCAAGGACACAGCTGGTGCAAGG - Intronic
1001642394 5:173253606-173253628 CCATTTTCACAACTGAAGGAAGG - Intergenic
1004282413 6:14292315-14292337 CTATTTACACAGGTGGTAGCAGG - Intergenic
1004548393 6:16621900-16621922 ACATTTACCCAGCTTGTGGGTGG - Intronic
1004638827 6:17494452-17494474 CCATGTAGACATCTGGAGGAAGG - Intronic
1004806689 6:19210779-19210801 GCATTCACACTGCTGGGGGAGGG + Intergenic
1005411316 6:25550195-25550217 CCATCTTCACAGATGTTGGAAGG + Intronic
1006729710 6:36227765-36227787 CAAATTACACACCTGGTGGGTGG + Intronic
1006829261 6:36958922-36958944 GCAGTCACACAGCTGGTGAATGG + Intronic
1008033015 6:46718184-46718206 TCCTTTACACAGCTCCTGGAGGG + Intronic
1010446116 6:75950554-75950576 CAATTCACACAGCTGGTGAGTGG - Exonic
1010882977 6:81202077-81202099 CCATTCTCACATCTGGAGGATGG - Intergenic
1012198550 6:96376303-96376325 ACTCTTACACTGCTGGTGGAAGG + Intergenic
1012235876 6:96814528-96814550 CCAATCACACAGCTGGTGGGAGG + Intronic
1012541946 6:100371598-100371620 CCACTTACACTTCTGGTGTATGG - Intergenic
1015811159 6:137163517-137163539 CCATTTGCACTGTTGGAGGAAGG - Intronic
1017608343 6:156157151-156157173 CATTTTACACATATGGTGGATGG - Intergenic
1021352042 7:19605804-19605826 GCACTTTCACTGCTGGTGGATGG - Intergenic
1021870060 7:24996872-24996894 GCTTTTACACAGTTGGTGGGAGG - Intergenic
1021910601 7:25382510-25382532 CCCAATACACAGCTGTTGGAGGG + Intergenic
1023144905 7:37140916-37140938 ACTTTTACACTGTTGGTGGAAGG + Intronic
1023360554 7:39410883-39410905 CCAGTCTCACAGCTGGTGGATGG - Intronic
1026416312 7:70184385-70184407 CCATTTCCAGAGAAGGTGGAGGG - Intronic
1027701318 7:81473179-81473201 CCATTTTTACTGCTGGTGCAGGG - Intergenic
1030170671 7:106599531-106599553 CTATTTACACAGGTGCTGGCAGG - Intergenic
1033163252 7:139015889-139015911 CCATTCCCACAGGAGGTGGATGG + Intergenic
1035041933 7:155935450-155935472 CCAGTTCCACAGCTTCTGGATGG - Intergenic
1035691824 8:1564323-1564345 CCAGTTTCACAGATGGTGGATGG + Intronic
1036538158 8:9672760-9672782 CCATTAACACAGATAGTTGATGG + Intronic
1038684945 8:29707895-29707917 CCCTTGATACAGCTGGGGGAGGG + Intergenic
1039859977 8:41448659-41448681 CCGGTCACACAGCTAGTGGATGG - Intergenic
1047179435 8:122573160-122573182 TCAATCACACAGCTGGTGCATGG + Intergenic
1047812102 8:128422100-128422122 GCATTTAAACTGATGGTGGAAGG + Intergenic
1048842597 8:138578805-138578827 CCACTTACTCAGCAGGTGGGAGG - Intergenic
1049030668 8:140035042-140035064 CTGTATACACAGCTGGAGGAGGG + Intronic
1051666691 9:19472773-19472795 CCAATTACACAGCTGATTGGAGG - Intergenic
1052381110 9:27772015-27772037 CCATAGAGACAGCTGGAGGATGG - Intergenic
1052850796 9:33377304-33377326 GAATTGACACAGCTGGTGAAGGG - Intergenic
1053310741 9:37017696-37017718 CCACTTACATAGCTGGCGGGCGG + Intronic
1055187471 9:73474094-73474116 CCATTTCCTCATCTGGTAGACGG + Intergenic
1055199747 9:73646153-73646175 CCATTTCAACAGCTGGTGCCAGG - Intergenic
1056149141 9:83766842-83766864 CCTTTTAAACACCTGGTGGCTGG + Intronic
1056237490 9:84609652-84609674 CTATGTATGCAGCTGGTGGATGG + Intergenic
1060559775 9:124533482-124533504 CCCTTTGCACAGCTAGGGGAGGG - Intronic
1203532277 Un_GL000213v1:157261-157283 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1186325435 X:8471653-8471675 CCATTTACAAAATTGGTGGGCGG + Intergenic
1186478978 X:9881206-9881228 CCATTTACTCTGCTGGTTGTGGG + Intronic
1190071385 X:47282639-47282661 CCCCTTACACAGCTTGTGTAAGG + Intergenic
1198280667 X:135138817-135138839 CCATTTAGAGACATGGTGGAGGG + Intergenic
1198290292 X:135233697-135233719 CCATTTAGAGACATGGTGGAGGG - Intergenic
1198496100 X:137195108-137195130 CCAGTCACACATCTGGTAGATGG - Intergenic
1198535046 X:137576810-137576832 CTATTTACACATCTGATGAATGG + Intronic
1199616585 X:149660613-149660635 CCAGTAAGACAGCTCGTGGAAGG + Intergenic
1199626056 X:149742635-149742657 CCAGTAAGACAGCTCGTGGAAGG - Intergenic
1201303374 Y:12529496-12529518 CCATTTTCTCTGCTGGTGGTGGG + Intergenic
1202113805 Y:21451045-21451067 CCATTGCCACAGTTAGTGGAAGG + Intergenic