ID: 905621822

View in Genome Browser
Species Human (GRCh38)
Location 1:39454947-39454969
Sequence AACGGCCTTGTCAGAACTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905621817_905621822 21 Left 905621817 1:39454903-39454925 CCACAGGTCCTGACATGGGCTAA 0: 1
1: 0
2: 0
3: 15
4: 111
Right 905621822 1:39454947-39454969 AACGGCCTTGTCAGAACTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 65
905621818_905621822 13 Left 905621818 1:39454911-39454933 CCTGACATGGGCTAAGCAGCACC 0: 1
1: 1
2: 0
3: 3
4: 92
Right 905621822 1:39454947-39454969 AACGGCCTTGTCAGAACTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 65
905621820_905621822 -8 Left 905621820 1:39454932-39454954 CCAGCAGCGTCTTGAAACGGCCT 0: 1
1: 0
2: 0
3: 1
4: 36
Right 905621822 1:39454947-39454969 AACGGCCTTGTCAGAACTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905621822 Original CRISPR AACGGCCTTGTCAGAACTGG TGG Exonic
904463403 1:30693623-30693645 ATGGGCTTTGTCAGGACTGGTGG - Intergenic
905621822 1:39454947-39454969 AACGGCCTTGTCAGAACTGGTGG + Exonic
910093737 1:83496109-83496131 AGAGGCCAAGTCAGAACTGGGGG - Intergenic
912020363 1:105101640-105101662 AACTGCCTTGTCATCTCTGGTGG + Intergenic
916575870 1:166066002-166066024 AACGTGCTTGTTAGAACTGAGGG - Intronic
916850842 1:168702057-168702079 AAAGCCCTTATGAGAACTGGGGG - Intronic
918597388 1:186307947-186307969 AGCGGGCTTGTCAGAGGTGGTGG - Exonic
920285835 1:204878908-204878930 AGAGGCCTGGCCAGAACTGGTGG + Intronic
1065225558 10:23540087-23540109 AACAGCTTAGTCTGAACTGGAGG + Intergenic
1074985873 10:118659026-118659048 AGCCTCCTTGCCAGAACTGGAGG - Intergenic
1080119905 11:28665052-28665074 AAAGGCTTTCTCAGAACTGGGGG + Intergenic
1081259251 11:40938188-40938210 AAAGGAACTGTCAGAACTGGAGG - Intronic
1081776809 11:45681352-45681374 GATGGCATTGTCAGTACTGGGGG + Intergenic
1084496083 11:69504465-69504487 CACTCCCTTGTCACAACTGGAGG - Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1091104798 11:132908649-132908671 AACTGTCTGGTGAGAACTGGTGG - Intronic
1092967107 12:13654824-13654846 AATGGGCTTTGCAGAACTGGAGG - Intronic
1093720513 12:22437093-22437115 AACCTCCTAGTCAGAACTTGGGG + Intergenic
1108549837 13:51532901-51532923 AACGGCATTCTCTGAACTTGTGG - Intergenic
1109838108 13:67885907-67885929 AAGGGAGTTGTCAGAACTGAAGG - Intergenic
1111063703 13:83061064-83061086 TAAGCCTTTGTCAGAACTGGAGG - Intergenic
1112300022 13:98221531-98221553 AACGAGCTTGGCAGAAATGGAGG - Intronic
1117386490 14:55219014-55219036 AAGGTACTTGTCAAAACTGGAGG - Intergenic
1122844801 14:104487107-104487129 GTCGTCCTTGGCAGAACTGGAGG + Intronic
1137802796 16:51276503-51276525 AACAGCCTTGTCCCAGCTGGAGG - Intergenic
1140891192 16:79286752-79286774 TACGGCCATGTGAGAACGGGTGG - Intergenic
1141122594 16:81372205-81372227 AACGGGCTTGTCAGTACATGGGG - Intronic
1142341007 16:89522667-89522689 GACGCCCTTCCCAGAACTGGAGG + Intronic
1143588709 17:7866689-7866711 AAGGGACTTGACATAACTGGAGG - Intronic
1150208556 17:63428240-63428262 AAGGGCTTCGTCACAACTGGAGG + Intergenic
1153823854 18:8856702-8856724 TACGCCTTTGTCAGAAATGGAGG + Intergenic
1167982957 19:53291197-53291219 ATCGGCCTTGTCCCAACGGGAGG + Exonic
1168694679 19:58397546-58397568 AGCGTCCTTGCCAGCACTGGAGG + Intergenic
925901531 2:8512633-8512655 AAAGGCCCTGCCAGAACTGCAGG - Intergenic
927208179 2:20623125-20623147 AAAGGCCTGGGGAGAACTGGGGG + Intronic
932300486 2:70663575-70663597 AACATCCGTGTCAGCACTGGTGG + Exonic
941341299 2:164308494-164308516 AACAGCATAGTCGGAACTGGAGG + Intergenic
947982336 2:234421074-234421096 AGCCGCCTTGCCGGAACTGGAGG - Intergenic
1170316408 20:15045799-15045821 AATGGCCTTGTTATAACTGAGGG + Intronic
1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG + Intergenic
1176665687 21:9685430-9685452 AAGGGGCTTGTCAGATCTCGTGG + Intergenic
1179735763 21:43391016-43391038 AATGGCCTTGTGAGGACTGGAGG - Intergenic
1183849253 22:40570273-40570295 AATGTCCTTTTAAGAACTGGGGG + Intronic
952791319 3:37202897-37202919 AAGGGTCTTGTCAGAACAGGAGG - Intergenic
955353566 3:58211673-58211695 AAAGGTCTTGTAAGAACTGTAGG + Intronic
958806975 3:98823177-98823199 AAAGGGCTTTTTAGAACTGGTGG - Intronic
961305896 3:125959021-125959043 AACAGCCCTGCCAGCACTGGCGG + Intergenic
963003319 3:140703617-140703639 AATGGCCTTGGCAGGACTTGTGG + Intergenic
984300823 4:177915272-177915294 AAAGGACTTGTTAGAAATGGAGG - Intronic
985247550 4:187993141-187993163 AATGGCCAGGTCAGAACAGGAGG - Intergenic
988934862 5:36071704-36071726 AACAGGGTTGCCAGAACTGGTGG + Intergenic
989641682 5:43589157-43589179 ATCAGCCTCCTCAGAACTGGGGG - Intergenic
991445992 5:66700432-66700454 ATTAACCTTGTCAGAACTGGTGG + Intronic
999316305 5:150586146-150586168 CTCGGCCTTGGCAGACCTGGTGG + Intergenic
1002068135 5:176662727-176662749 AACAGCCTTGGCAGGGCTGGGGG - Intergenic
1003280622 6:4688136-4688158 AAAGGCCTTTTCAGACCTGCAGG + Intergenic
1006445775 6:34079006-34079028 AAAGGCCTAGTGAGAGCTGGAGG - Intronic
1006824347 6:36923420-36923442 AACCGCTTTCTCAGAACTGTAGG + Exonic
1008058662 6:46973732-46973754 AAGGTCCTTCTCTGAACTGGTGG + Intergenic
1022388365 7:29922741-29922763 AATGGCCTTGGCAGGAATGGTGG + Intronic
1025613806 7:63100972-63100994 AGCGCCCCTGTCAGGACTGGGGG - Intergenic
1026914552 7:74112064-74112086 CAGGGCCTTCCCAGAACTGGAGG + Intronic
1034559133 7:151868556-151868578 AACGACGTTGACAGAACTGTGGG + Intronic
1049431690 8:142568292-142568314 GACGGCCTTGTGAGGACTCGGGG + Intergenic
1056497616 9:87175463-87175485 AAGGGCTTTGTAAGAAGTGGTGG + Intergenic
1057478793 9:95427538-95427560 AACAGTCATATCAGAACTGGAGG + Intergenic
1057813074 9:98272880-98272902 AACCTCATGGTCAGAACTGGAGG + Intergenic
1203660416 Un_KI270753v1:36331-36353 AAGGGGCTTGTCAGATCTCGTGG - Intergenic
1186804359 X:13125230-13125252 AAAGGCTTTGTCAGAAGAGGAGG + Intergenic
1190323847 X:49194434-49194456 TGGGGCCTTGTCAGAAATGGGGG - Intronic