ID: 905625928

View in Genome Browser
Species Human (GRCh38)
Location 1:39490937-39490959
Sequence TCCAGCTGGGCCAGAAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 370}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905625928_905625942 29 Left 905625928 1:39490937-39490959 CCAGAGCTTCTGGCCCAGCTGGA 0: 1
1: 0
2: 1
3: 31
4: 370
Right 905625942 1:39490989-39491011 TGGATCAGTACCGGGGACGCAGG 0: 1
1: 0
2: 1
3: 0
4: 46
905625928_905625943 30 Left 905625928 1:39490937-39490959 CCAGAGCTTCTGGCCCAGCTGGA 0: 1
1: 0
2: 1
3: 31
4: 370
Right 905625943 1:39490990-39491012 GGATCAGTACCGGGGACGCAGGG 0: 1
1: 0
2: 1
3: 2
4: 36
905625928_905625939 20 Left 905625928 1:39490937-39490959 CCAGAGCTTCTGGCCCAGCTGGA 0: 1
1: 0
2: 1
3: 31
4: 370
Right 905625939 1:39490980-39491002 CCGCAAAGCTGGATCAGTACCGG 0: 1
1: 1
2: 0
3: 3
4: 44
905625928_905625941 22 Left 905625928 1:39490937-39490959 CCAGAGCTTCTGGCCCAGCTGGA 0: 1
1: 0
2: 1
3: 31
4: 370
Right 905625941 1:39490982-39491004 GCAAAGCTGGATCAGTACCGGGG 0: 1
1: 0
2: 1
3: 4
4: 55
905625928_905625940 21 Left 905625928 1:39490937-39490959 CCAGAGCTTCTGGCCCAGCTGGA 0: 1
1: 0
2: 1
3: 31
4: 370
Right 905625940 1:39490981-39491003 CGCAAAGCTGGATCAGTACCGGG 0: 1
1: 0
2: 1
3: 4
4: 54
905625928_905625935 9 Left 905625928 1:39490937-39490959 CCAGAGCTTCTGGCCCAGCTGGA 0: 1
1: 0
2: 1
3: 31
4: 370
Right 905625935 1:39490969-39490991 CGGAGCCTCCTCCGCAAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905625928 Original CRISPR TCCAGCTGGGCCAGAAGCTC TGG (reversed) Intergenic
900240613 1:1615728-1615750 TCCCGCTGGCCCAGCAGCCCCGG + Intronic
900874406 1:5331253-5331275 TCCAGCTGGGGCAGAGGCCTGGG + Intergenic
902030508 1:13418679-13418701 GCCACCTGGACCAGATGCTCAGG + Exonic
902654138 1:17856147-17856169 ACCAGCTGGGGCAGGAGGTCTGG - Intergenic
903318820 1:22529391-22529413 ACCACCTGGGCCATGAGCTCTGG - Exonic
903481676 1:23657901-23657923 TCCAGGGGGCTCAGAAGCTCTGG + Intergenic
903659586 1:24968959-24968981 ACCAGCTGGCCAAGGAGCTCGGG + Intergenic
903905229 1:26680985-26681007 TCCAGCTGCTCCAGAGGCTGGGG + Intergenic
904302075 1:29560923-29560945 TCCAGCTTTGTCAGATGCTCAGG + Intergenic
904404204 1:30275419-30275441 TCTGGCTGGGCCTGAAGCCCGGG - Intergenic
904455213 1:30643353-30643375 TCCCGCTTGGTCAGATGCTCCGG - Intergenic
904910714 1:33932226-33932248 TCCACAGGGGCCTGAAGCTCAGG + Intronic
905625928 1:39490937-39490959 TCCAGCTGGGCCAGAAGCTCTGG - Intergenic
905670946 1:39789391-39789413 TTTAGCCGGGCCAGGAGCTCTGG + Intergenic
905976373 1:42177176-42177198 TCCAGGTGGTCCAGGAGCCCAGG - Exonic
906153340 1:43600346-43600368 GGGAGCTGGGCCAGAGGCTCAGG + Intronic
906154705 1:43607074-43607096 TCCTGCTGAGCCTGAGGCTCAGG - Intronic
907401709 1:54228670-54228692 CCCAGCTGAGCCAGGAGCTGAGG + Intronic
910366288 1:86468706-86468728 TTCAGCTGTGCCAGATGCTGGGG - Exonic
911059656 1:93736969-93736991 TCCTGTTGGATCAGAAGCTCTGG + Intronic
911144933 1:94542253-94542275 CCCACCTGGGGCAGAAGCTCGGG + Intergenic
912801228 1:112720792-112720814 TGCAGCAAGGCCAAAAGCTCAGG - Intronic
913107140 1:115625026-115625048 TCAGCCTGGGCCAGAAGCTCTGG + Intergenic
913391499 1:118318086-118318108 TTCAGCTATGCCAGGAGCTCTGG + Intergenic
915004368 1:152622994-152623016 TCCAGCTGTGCCCCAAGCTCTGG - Exonic
915119442 1:153619541-153619563 TCCAGCTGGGTCACTAGATCAGG + Intronic
915131267 1:153697324-153697346 CTCAGCTGGGCCAGGAGCCCTGG + Intergenic
916727227 1:167533899-167533921 TCCAGCAGGGCCAGCTGGTCTGG + Intronic
919751538 1:201040957-201040979 ACCAGCTTGGCCAGAGACTCTGG - Intronic
921575347 1:216829214-216829236 TCCAGGTGTGTCAGGAGCTCTGG - Intronic
922706429 1:227793117-227793139 TCCAGCTGGGGCAGCAACCCAGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
1062825414 10:564492-564514 TCCATCTTGGCCAGTAGCTGAGG + Intronic
1063435043 10:6022578-6022600 TCCTGCTGGGGAAGAGGCTCTGG - Intronic
1063695861 10:8334333-8334355 TCCAGCTACTCCAGAAGCTGAGG - Intergenic
1063960597 10:11302381-11302403 TCCCGCTGAGTCAGACGCTCTGG - Intronic
1064028387 10:11867506-11867528 CCCAGCTGGTCCAGAGGCTGAGG + Intronic
1065122314 10:22542031-22542053 TTCAGCTGGGCCAGAAACTGGGG + Exonic
1066306637 10:34150656-34150678 TCCAGCTGGGCCTCAGGCTTGGG + Intronic
1066456558 10:35577307-35577329 GCCAGCAGGGCCATATGCTCTGG - Intergenic
1067406531 10:46029002-46029024 TATAGCTGTGCCAGAATCTCAGG - Intronic
1067489959 10:46689301-46689323 TCCAGCTAGTCGAGAAGCTGAGG - Intergenic
1067604707 10:47651081-47651103 TCCAGCTAGTCGAGAAGCTGAGG + Intergenic
1068353862 10:55884554-55884576 TCCAGCTGGGCCAGGTGCAGTGG - Intergenic
1070789485 10:79180899-79180921 TCTAGCTGGAGCAGAAGCTGGGG - Intronic
1071041184 10:81309663-81309685 TCCATCTAGGCCAGAACCCCAGG + Intergenic
1071497935 10:86181291-86181313 TCCAGCTGCCCCTGAAGCTGTGG + Intronic
1071620261 10:87112516-87112538 TCCAGCTAGTCGAGAAGCTGAGG + Intronic
1071888533 10:89977355-89977377 CTCACCTGGGCCAGAGGCTCGGG + Intergenic
1073105012 10:101027563-101027585 ACCCACTGGACCAGAAGCTCTGG + Intronic
1073288937 10:102403893-102403915 CCCAGCTGGGCAAGAAGGGCCGG - Exonic
1073292742 10:102421407-102421429 TCCCGCTGCGCCAGCTGCTCCGG + Exonic
1073406783 10:103305384-103305406 TCCAGCTGGTCAAGAGGCTGAGG - Intronic
1073578086 10:104641586-104641608 CCCTGCTGGGGCAGCAGCTCTGG - Exonic
1073752080 10:106540195-106540217 CCCAGCTATTCCAGAAGCTCAGG + Intergenic
1074158605 10:110819013-110819035 GCCAGCTGGAGCAGAAGCTCAGG - Intronic
1074755473 10:116621219-116621241 CCCAGCTGGGTCAGGAGCCCGGG - Intronic
1075482661 10:122796034-122796056 TGGAGCTGGGCCAGGAGCTGAGG - Intergenic
1075737424 10:124672529-124672551 AACAGCTGGGACAGCAGCTCCGG - Intronic
1076723407 10:132402469-132402491 GCATGCTGGCCCAGAAGCTCAGG + Intronic
1077099381 11:815156-815178 TCCAGCTGCTCAAGAAGCTGAGG - Intergenic
1077182318 11:1222318-1222340 TCCAGCCAGGCCAGAGGCTCCGG - Intergenic
1077461765 11:2714345-2714367 GCCTGCTGGGCCACAGGCTCTGG + Intronic
1079378673 11:19917439-19917461 GCCACCTGGCCCAGAAACTCAGG - Intronic
1080744542 11:35097048-35097070 TGCCCCTTGGCCAGAAGCTCTGG + Intergenic
1080900287 11:36483422-36483444 ACCACCTGGGCCAGAAGCGGTGG + Intergenic
1081708307 11:45199686-45199708 GACAGCAGGGCCAGATGCTCAGG - Intronic
1082821379 11:57546512-57546534 TCCAGCTGGAGGAGAAGTTCTGG - Exonic
1083399489 11:62413940-62413962 TCCAGCTGGGGCAGTGGCTGGGG - Intronic
1083664529 11:64267347-64267369 GCCAGCTGGGCCAGCAGCTGTGG - Exonic
1083684824 11:64369828-64369850 CCCTGCTGCGCCAGCAGCTCGGG - Exonic
1083813250 11:65117223-65117245 TCCAGCTCCTCCAGAAGCTGCGG + Exonic
1083961713 11:66018337-66018359 GCCAGCTGGGCCAGGACATCTGG - Intronic
1084675122 11:70629689-70629711 GCCACCTGGGCCAGAGGCACGGG + Intronic
1084712347 11:70851796-70851818 TCCAACTGGACCCCAAGCTCTGG - Intronic
1084775192 11:71370236-71370258 TCCAGCTGAGGCAGATGCCCCGG - Intergenic
1085167066 11:74412054-74412076 ACCATCTTGGCCAGGAGCTCTGG + Intergenic
1085266667 11:75241521-75241543 TCCAGCGCGGCCAGCAGCGCGGG - Exonic
1085468113 11:76737951-76737973 TGCAGCTGGGACACAAGTTCTGG - Intergenic
1085642120 11:78199259-78199281 TGCCCCTGGGCCAGAAGCTTTGG - Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1086893771 11:92289007-92289029 GCAAGCAGGGCCTGAAGCTCAGG - Intergenic
1087030478 11:93699010-93699032 TCTAGCTAGACAAGAAGCTCGGG + Exonic
1088497468 11:110445666-110445688 TACAGCTGGGAAAGAAGCCCAGG - Intronic
1089175875 11:116548496-116548518 TCCTGCAGGACCTGAAGCTCTGG + Intergenic
1091379563 12:47698-47720 TGGAGCTGGTCCACAAGCTCAGG + Intergenic
1094551575 12:31456796-31456818 TCCCTCTGGGCCAGATGCTGTGG + Intronic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1096390656 12:51226446-51226468 TCCAGCTGTGCCGGAGGCTGAGG - Intergenic
1097017925 12:56000369-56000391 ACCACCTGGGCCAGCAGCTGCGG - Intronic
1097293743 12:57941786-57941808 TTCCCCTGGGCCAGACGCTCGGG - Exonic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1099395153 12:82129247-82129269 TCCAGCTGTTCCATAAGCTGAGG + Intergenic
1100759080 12:97786348-97786370 ACCAGATGGGCAAGTAGCTCTGG - Intergenic
1101203680 12:102463780-102463802 TCCAGCTGTGCAAAGAGCTCTGG + Intronic
1101414996 12:104501220-104501242 CACAGCTGGGCCACAAGCCCAGG + Intronic
1101633890 12:106521423-106521445 TCCAGATGGGCCACTAACTCAGG - Intronic
1101951092 12:109175811-109175833 TTCCGCTGGTCCAGAAGCCCAGG + Intronic
1102217778 12:111173866-111173888 TCCTGCTGGGCCAGAGACTTTGG + Intronic
1102462318 12:113107505-113107527 TCCAGCTACTCCAGAAGCTGAGG + Intronic
1102661786 12:114535300-114535322 TTCAGCTGGGCCACAAGTACTGG - Intergenic
1103322090 12:120098169-120098191 TCCAGCTGGGCCGGGCGCGCCGG - Intronic
1103513752 12:121493156-121493178 TCCAGCTACTCCAGAAGCTGAGG - Intronic
1104252497 12:127108863-127108885 ACCAGCTGGTCCAGAGGCTGTGG + Intergenic
1104684719 12:130777409-130777431 TCCAGCTGGGTCTGAAGTTGAGG - Intergenic
1104904882 12:132207799-132207821 TTCAGCAGGGCCATTAGCTCAGG + Intronic
1104931920 12:132344289-132344311 TCCAGCTGTGCCCGAGGCCCTGG - Intergenic
1104995074 12:132649224-132649246 TCCAGCTGGGCCCTGAGGTCTGG - Intronic
1106374352 13:29170602-29170624 TCCAGCTGAGCCAGACCATCTGG + Intronic
1106522356 13:30509048-30509070 TCCAGCTGCTCCAGCAGCTGAGG - Intronic
1108358750 13:49650946-49650968 ACAAGCTGGGCCAGAACCCCCGG - Intergenic
1110682848 13:78336836-78336858 TCTATCTGGGCCAGAACCTAAGG - Intergenic
1112484571 13:99808968-99808990 TCCAGCTGTGCTAGATGCTCAGG - Intronic
1112595953 13:100806983-100807005 TCCAGCTACTCCAGAAGCTGAGG - Intergenic
1112783283 13:102925637-102925659 TCGAGCTGGGTCAGAGGCTTTGG + Intergenic
1113387193 13:109859612-109859634 TCCAGCTGCCCCTGCAGCTCAGG - Intergenic
1113640124 13:111951412-111951434 TCCTGCTGAGCCAGCAGCTAGGG + Intergenic
1113710150 13:112457766-112457788 ACCTGCTGGGCCGGAAGCTCTGG + Intergenic
1113786905 13:113006787-113006809 GCCTCCTGGGCCAGATGCTCGGG - Intronic
1113798036 13:113070054-113070076 TTCAGCTGGGCCAGGAGCCTGGG - Exonic
1114281168 14:21193315-21193337 TGCAGTGGGGCCAGCAGCTCCGG - Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1120514226 14:85451580-85451602 TACAGCTGGGGCAGATGTTCTGG - Intergenic
1121090492 14:91178279-91178301 TCCAGCTACTCCAGAGGCTCAGG - Intronic
1122136966 14:99638922-99638944 TCCAGCTGTGGCAGGAGCTCAGG + Intergenic
1122199704 14:100114914-100114936 TGCTGCTGGAACAGAAGCTCAGG - Intronic
1123098350 14:105776952-105776974 TCCAGCAGGGACAGAAGGGCGGG - Intergenic
1123107591 14:105849906-105849928 TCCAGCAGGGACAGAAGGGCGGG + Intergenic
1124389696 15:29242947-29242969 GCCAGCTGTGCTAGAATCTCAGG - Intronic
1125179916 15:36870890-36870912 TCCAGATGGGGCTGAAGATCGGG + Intergenic
1125512937 15:40302595-40302617 TGCTGCAGAGCCAGAAGCTCCGG - Exonic
1125577030 15:40763322-40763344 TCCAGCTGCGCGGGAAGCTCAGG + Intergenic
1125832428 15:42726319-42726341 GCCAGCTGGGCCAGACGCTGCGG - Exonic
1126050103 15:44677476-44677498 GCAAACTGGTCCAGAAGCTCAGG + Intronic
1126906630 15:53374999-53375021 TCCTGCTGAGTCAGAAACTCTGG - Intergenic
1127683012 15:61315845-61315867 ACCACCTGAGCCAGAAACTCCGG - Intergenic
1128385000 15:67141376-67141398 TCCATCTTGGCCATAATCTCAGG - Intronic
1129157731 15:73729154-73729176 TCAACCTGGTCCAGAAGCCCTGG + Intergenic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1129850997 15:78793877-78793899 TACAGCTGGGACTGGAGCTCAGG - Intronic
1130197254 15:81792067-81792089 TCCAGCTGCTCCAGAGGCTGAGG + Intergenic
1132085887 15:98907955-98907977 CCCAGCTGAATCAGAAGCTCTGG + Intronic
1132659034 16:1053450-1053472 AACAGCTGGGCCGGAGGCTCGGG + Intergenic
1132721709 16:1319821-1319843 TCCAGCTGGGCCAGACTCAGGGG - Intronic
1133775795 16:8894230-8894252 TCCAGGTGGGCGTGTAGCTCAGG - Intronic
1134344187 16:13374059-13374081 GCCAACTTGGCCATAAGCTCTGG + Intergenic
1135052082 16:19201346-19201368 TTTAGCTGTGCCTGAAGCTCAGG - Intronic
1137294490 16:47077346-47077368 TTCAGCTGGGCCAGGAGCAGTGG + Intergenic
1138447942 16:57076530-57076552 TCCTCCTGGGCCAGGGGCTCTGG + Intronic
1138499414 16:57429893-57429915 TCCAGCTATGCCAGAGGCTGAGG - Intronic
1138693633 16:58791115-58791137 TCCAGCTGGCCCAGAAGCGCCGG + Intergenic
1139461454 16:67126073-67126095 TCCAGCTGGGCCAGTCTTTCTGG + Intronic
1140125212 16:72112631-72112653 TCCTGCTGGACCAGACTCTCTGG + Exonic
1140588765 16:76326397-76326419 CCCTGCTGGGCAAGATGCTCAGG - Intronic
1140743129 16:77959273-77959295 TCCATCTGGGTCAGAATCTTGGG + Intronic
1143078607 17:4365879-4365901 TCCAGCCGGCCCCGAAGGTCCGG + Intronic
1143641240 17:8198964-8198986 TCCAGCTGCTCCAGAGGCTGAGG + Intergenic
1144241956 17:13321368-13321390 TCCAGCTAATCCAGAAGCTGAGG - Intergenic
1144655007 17:17029699-17029721 TCCAGCTGTGCCTGAAGCTACGG - Intergenic
1145012486 17:19377887-19377909 TCCAACTTGGCCGGAAGCTGCGG + Exonic
1145858724 17:28188085-28188107 TCCAGCTACTCCAGAAGCTGAGG + Intronic
1146271720 17:31489297-31489319 TTCAGCTGGGCCAGGACCTGGGG - Intronic
1146533431 17:33629778-33629800 CCCAGTTCTGCCAGAAGCTCTGG + Intronic
1146634284 17:34492629-34492651 GCCAGCTGGGACTTAAGCTCAGG + Intergenic
1146794308 17:35770314-35770336 TGCAGGTGGGGCAGAAGGTCAGG + Intronic
1147142360 17:38466699-38466721 GCCAGCTGGGCCAGGAGGGCTGG + Exonic
1147146888 17:38490630-38490652 TCCAGCAGGTCCAGTAACTCAGG + Intronic
1147314589 17:39613573-39613595 CCCAGCTGGGCCAGAAACTTTGG + Intergenic
1147435596 17:40412078-40412100 TCCAGCTACTCCAGAAGCTGAGG + Intronic
1147550570 17:41438817-41438839 GTCAGCTGGGGGAGAAGCTCCGG - Exonic
1147583259 17:41638546-41638568 TCAAACTGGGGCAGAGGCTCAGG - Intergenic
1147667492 17:42157865-42157887 TCCAGCTACTCCAGAAGCTGAGG - Intronic
1148343639 17:46889186-46889208 TCCAGGGGGGCCAGATGGTCAGG + Intergenic
1148411647 17:47472377-47472399 CCCAGCTGCTCCAGAAGCTGAGG - Intergenic
1148879723 17:50716657-50716679 TCCAGCTACTCCAGAAGCTGAGG - Intergenic
1149493431 17:57101312-57101334 TCCAGCTGCTCCAGAGGCTGAGG - Intronic
1151431664 17:74067683-74067705 TCCAGCTGGCCAATGAGCTCAGG + Intergenic
1151555148 17:74842946-74842968 TCCCGCCGGGCCAGCTGCTCCGG + Exonic
1151757014 17:76080803-76080825 TGCAGCAAGGCCAGAGGCTCAGG + Intronic
1152527945 17:80900230-80900252 GCCACCTGAGCCAGCAGCTCTGG + Intronic
1152536243 17:80951762-80951784 TCCATCTGAACCAGAGGCTCTGG - Intronic
1152944077 17:83189520-83189542 TCCAGGCTGGCCAGGAGCTCTGG - Intergenic
1153935068 18:9914075-9914097 ACCCGCTGGGTCAGCAGCTCCGG - Exonic
1154176920 18:12092004-12092026 GCTAGATGGGCCAGAAGCCCAGG - Intergenic
1155072869 18:22331526-22331548 TCCAGCAGGGAGACAAGCTCTGG + Intergenic
1155154867 18:23149738-23149760 ACCCACTGGGTCAGAAGCTCTGG + Intronic
1155351443 18:24911467-24911489 TCCATCTGGGCCAGACCCTTAGG - Intergenic
1155437330 18:25826892-25826914 GCCTGCTGGAGCAGAAGCTCTGG + Intergenic
1157935181 18:51864591-51864613 AGCACCTGGGCCAGAAGCTGTGG - Intergenic
1160027473 18:75230315-75230337 TCCAGCAGGGACGGCAGCTCTGG - Intronic
1160408136 18:78656713-78656735 CCCAGCTGGGCCACATGCTATGG - Intergenic
1161454004 19:4361306-4361328 GCCAGCTGGGCGAGAAGTTGGGG + Exonic
1162926487 19:13932886-13932908 TCCAGGCCGGCCAGAGGCTCGGG + Exonic
1163756127 19:19107199-19107221 CCCAGCTGCTCCAGAAGCTGAGG + Intronic
1164182218 19:22829399-22829421 CCCAGCTACGCCAGAAGCTGAGG - Intergenic
1164467630 19:28501100-28501122 CCCAGCTGGGTCAGAGTCTCTGG - Intergenic
1165420905 19:35721408-35721430 TCCAGCTGAGCCTGAGCCTCGGG + Exonic
1165487623 19:36104951-36104973 TCCAGCAGGGCCTGCAGGTCTGG - Exonic
1166037022 19:40175962-40175984 GCCAGCTGGGTCAGAAGGGCTGG - Intergenic
1166982601 19:46639803-46639825 TCCACCGCGGCCAGAAGCTGGGG + Intergenic
1167564985 19:50250524-50250546 TCCAGCAGGGCCAGGAGTCCAGG - Exonic
1168293593 19:55368830-55368852 TCCAGCTCGGCCCGAGGGTCTGG + Exonic
1168712825 19:58511641-58511663 TCCACCTGGGCCTGAAGATCAGG - Exonic
925725200 2:6865355-6865377 TCCAGCGGTGCCAGCTGCTCAGG - Exonic
925802189 2:7612268-7612290 TCCAGCTGCTCCAGAGGCTGAGG + Intergenic
926678226 2:15644591-15644613 CCAGGCTGGGCCAGGAGCTCTGG - Intergenic
926699476 2:15793619-15793641 TACCTCTGGGCCAGGAGCTCTGG - Intergenic
927081115 2:19631479-19631501 TCCAGCTGTTCCTGAAGCTCAGG + Intergenic
928728777 2:34206670-34206692 TCCAGCTTGGCCACATGCACTGG + Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
929946542 2:46376693-46376715 GCCAGCTGGGCCAGCTCCTCGGG - Exonic
930107514 2:47651576-47651598 TCCAAGTGGGCCAGAACCACCGG - Intergenic
931541890 2:63338434-63338456 TCCAGCTACTCCAGAAGCTGAGG + Intronic
932283982 2:70517550-70517572 ACCAGCTGGACCAGAAGGTTGGG - Intronic
932323177 2:70836883-70836905 TCCATATGTGCAAGAAGCTCAGG + Intergenic
932418772 2:71589153-71589175 TCGAGCTGGGTCCCAAGCTCTGG - Intronic
932660057 2:73643976-73643998 AGCAGCTGGCCCAGAGGCTCTGG + Intergenic
932712457 2:74077288-74077310 ACCTGCTGGGTCAGAAACTCAGG - Intronic
934501300 2:94862049-94862071 ACCAGCATGGCCAGAAGCTCTGG - Intergenic
934613420 2:95756786-95756808 CCCAGCTGGGCAAGAACATCAGG + Intergenic
934647476 2:96067634-96067656 CCCAGCTGGGCAAGAACATCAGG - Intergenic
934840849 2:97623454-97623476 CCCAGCTGGGCAAGAACATCAGG - Intergenic
934845233 2:97658071-97658093 TCCGGCTGGAACAGCAGCTCGGG + Exonic
935922550 2:108031698-108031720 AGCAGCTGGGCCAGCAGCTGTGG + Intergenic
936284792 2:111173596-111173618 CCCAGCTGGGGCTGCAGCTCAGG - Intergenic
936564295 2:113571127-113571149 TGGAGCTGGTCCACAAGCTCAGG - Intergenic
937275816 2:120683389-120683411 CCCAGAGGGGCCAGAAGCTCCGG - Intergenic
937750622 2:125472484-125472506 TGTTTCTGGGCCAGAAGCTCTGG - Intergenic
938125131 2:128665561-128665583 ACCAGCTGCACCTGAAGCTCTGG - Intergenic
938486013 2:131709278-131709300 TCCAGCTGCTCCAGAGGCTGAGG - Intergenic
940003328 2:148988526-148988548 CGCTGCTGAGCCAGAAGCTCTGG - Intronic
942177217 2:173345722-173345744 TCCAGCTGCTCCAGAGGCTGAGG - Intergenic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
942388868 2:175471279-175471301 CCCAGCTGGTCCAGAGGCTGAGG - Intergenic
944850714 2:203716245-203716267 TTTAGCTGGGCCATAAGGTCTGG - Intronic
946073581 2:217054946-217054968 TTCAGATGGGCCAGAAGCCAGGG - Intergenic
947051476 2:226048714-226048736 TCCAGCAGGGTCAGAATCCCTGG - Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947713952 2:232330631-232330653 TCCAGCTCGGGCAGAGACTCTGG - Intronic
947919153 2:233854432-233854454 ACCAGCTGCTGCAGAAGCTCAGG - Exonic
947991952 2:234495599-234495621 TCCTGCAGGGCCAGAAGTTCAGG - Exonic
948127160 2:235572614-235572636 TTTAGCTGGGGCAGAAGCCCAGG - Intronic
948820096 2:240538415-240538437 AGCACCTGGGCCAGAAGCTGCGG + Intronic
948824749 2:240568717-240568739 TGCAGCTGGGCCTGGAGCTGCGG + Exonic
948894665 2:240922533-240922555 TCCAGCCGGGCCTGCAGCTGGGG - Exonic
1168975851 20:1965391-1965413 CCCAGCTCTGCCTGAAGCTCTGG - Intergenic
1168997939 20:2146594-2146616 TCCAGCTGAGCCAGGAGGCCTGG - Exonic
1169236359 20:3933168-3933190 TCCAGCCGGGCCAGAAGTATGGG + Exonic
1170827500 20:19809169-19809191 CACAGCTGGGGCAGAAGATCAGG + Intergenic
1172484684 20:35291185-35291207 TGCAGCTGGGCCTGAAGCAGGGG - Intronic
1173696899 20:45024877-45024899 TCCAGATGGGCTACAATCTCTGG - Intronic
1174228063 20:49020923-49020945 CCCAGCTCAGCCATAAGCTCAGG + Intronic
1175157648 20:56982733-56982755 TCCAGCTTGGCCACATGCTGGGG + Intergenic
1175321808 20:58093405-58093427 ACCTGCTGGATCAGAAGCTCTGG - Intergenic
1175954765 20:62603624-62603646 TCGAGCTGGGGCAGAAGGCCTGG + Intergenic
1176108533 20:63400756-63400778 TCCAGCGGGACCACCAGCTCTGG + Intergenic
1178589409 21:33896520-33896542 CCCAGCTGGGCCACACGATCTGG + Exonic
1178894590 21:36548308-36548330 CCCGGCTGGGCCATGAGCTCTGG + Intronic
1178966574 21:37125146-37125168 TCCAGCTGGATCTGAAGCTAAGG + Intronic
1179211818 21:39331225-39331247 TCCAGCTACTCCAGAAGCTGAGG + Intergenic
1179474201 21:41632947-41632969 TCCAGCTGGGCCTGGTGCCCAGG - Intergenic
1179954292 21:44729570-44729592 CCCCGCTGGGCCACAGGCTCAGG + Intergenic
1180088708 21:45523152-45523174 AACAGCTGGGCCAGGAGTTCAGG - Intronic
1181038068 22:20179376-20179398 TCCAGGTGGGCCTCAAGCCCAGG - Intergenic
1181047803 22:20223848-20223870 TCCAGCTGGGCCCCAGGCTCAGG + Intergenic
1181348382 22:22237505-22237527 TGTAGCTGGGCCAGGAGCTATGG + Intergenic
1182231050 22:28837777-28837799 TCCTGCTAGGCTTGAAGCTCTGG + Intergenic
1182327624 22:29525688-29525710 TCCAGATGGACCAGAAGTCCTGG - Intronic
1182550770 22:31099756-31099778 TCCAGCTGGAGGAGAAGTTCTGG - Exonic
1183189411 22:36312191-36312213 TCCAGCAGGGCCAGAATGCCCGG + Exonic
1183391375 22:37547162-37547184 GCCGGCTGGGCCAGCAGCTGTGG - Intergenic
1183467474 22:37986924-37986946 TCCTGCTGGGGCAGAGGCCCAGG - Intronic
1185016719 22:48347542-48347564 TCCATCTCGGCGAGATGCTCAGG + Intergenic
949718522 3:6961690-6961712 TGCAGCTGGGCCAGTAGATTTGG - Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
950543454 3:13625588-13625610 AGCTGCTTGGCCAGAAGCTCTGG + Intronic
952164121 3:30727788-30727810 ACCAACTGGATCAGAAGCTCTGG - Exonic
952341939 3:32454415-32454437 TCCGGCTGGCTCAGGAGCTCAGG - Exonic
952942951 3:38457086-38457108 CCCAGCTGCGCCAGAGGCTGAGG + Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
953927878 3:46991574-46991596 TCAAGCAGGGCACGAAGCTCTGG - Exonic
954709012 3:52495776-52495798 TCCGTCTGGGCCAGAAGGGCAGG - Intronic
955189641 3:56748369-56748391 TCCAGCTGAGCAAGTAGCTTTGG - Intronic
958492760 3:94798519-94798541 TGCACCTGGCCCAGAAACTCTGG - Intergenic
958549648 3:95595706-95595728 ACCACCTGGGCCAGCAGCTGCGG - Intergenic
960141983 3:114159713-114159735 TCCAGGTGGCCCAAAAGCTGGGG - Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961550555 3:127668465-127668487 TCCACCAGGGCCAGGAGCTGTGG - Exonic
962210687 3:133475051-133475073 TCCAGCAGGGACTGGAGCTCAGG - Exonic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
962928085 3:140013282-140013304 CCCATATGGGCCTGAAGCTCTGG + Intronic
963043638 3:141087034-141087056 GGCAGCTGGCCCTGAAGCTCTGG - Intronic
963900108 3:150725694-150725716 TCCGGCTGTGCTGGAAGCTCTGG - Intergenic
964703475 3:159593895-159593917 CCTAGCTGAGCCAGGAGCTCTGG - Intronic
966973936 3:185069089-185069111 TCCAGGTGGGGCAGAAGCCTGGG - Intergenic
967831331 3:193922579-193922601 TCCTGCTGGGCCTGAGGCTTTGG - Intergenic
968130470 3:196190138-196190160 CCAAGCTGGGCCAGCAGCCCAGG + Intergenic
968452305 4:681380-681402 TCCGGCTGGGACAGACGCTCAGG - Intronic
968515559 4:1014162-1014184 TCCCGCTGGGTCATAAGTTCTGG + Intronic
968898418 4:3418671-3418693 CACAGCATGGCCAGAAGCTCAGG - Intronic
969196632 4:5568522-5568544 TCCAGCAGGGCCAGCAGCTGAGG + Exonic
969364659 4:6687195-6687217 TGCAGCAGGGGCAGAAGCTGTGG - Intergenic
971112113 4:23598907-23598929 TCCAGCTATTCCAGAGGCTCAGG - Intergenic
972636525 4:40889090-40889112 GACAGCTGGGCCAGATGCTTTGG - Intronic
973912118 4:55592035-55592057 TCCAGCTGGGCCCGAAGCCAAGG - Intronic
974188013 4:58465257-58465279 TGCAGCCGGGCCAGCAGCTGCGG + Intergenic
975682502 4:76890505-76890527 TCCAGCTACTCCAGAAGCTGAGG + Intergenic
976397828 4:84575770-84575792 TCCAGCTACTCCAGAAGCTGAGG + Intergenic
979311294 4:119206707-119206729 TGCAGCTGGGGCAGAAGGTCAGG + Intronic
980897677 4:138875414-138875436 CCCAGCTGTGCCAGAGGCTGAGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
982097062 4:151933027-151933049 CCAAGGTGGGCCATAAGCTCAGG - Intergenic
982515450 4:156342027-156342049 TACAACAGGGCCAGAAACTCAGG - Intergenic
983151207 4:164283585-164283607 TCTGGCAGTGCCAGAAGCTCAGG + Intronic
983831914 4:172338718-172338740 TACAGCTGAGCAAGGAGCTCAGG - Intronic
985625303 5:982503-982525 TGCAGCTGGGCCTGGAGCTGGGG - Intergenic
985664530 5:1175169-1175191 TCCTGCAGCTCCAGAAGCTCTGG - Intergenic
986519043 5:8594381-8594403 TCCCCCTGGGCCAGAAGAGCAGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
987211993 5:15692965-15692987 TCCAACTGGTTCAGAGGCTCAGG - Intronic
987216131 5:15739186-15739208 TCCAGCTGGGCCTGAGGGACAGG + Intronic
988564890 5:32312891-32312913 TCCAGCTGGGGCAGCAGCGGCGG + Exonic
988715539 5:33823600-33823622 GCCAGCTGGGCCAGAGTCACTGG - Intronic
989777606 5:45227665-45227687 ACCAACTGAGCCAGAATCTCTGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
997226866 5:132215449-132215471 TCCGCCTGGGCCTGCAGCTCGGG - Intronic
997381271 5:133440126-133440148 TCCAGCTGGGCGAGTAGTACAGG + Intronic
998232017 5:140366960-140366982 TCCAGCTGGGGCAGCAACTGGGG + Intronic
998463393 5:142325319-142325341 TGCAGCTGGGCCAGCTGCGCGGG + Intronic
999308342 5:150535258-150535280 TCCAGCTGGGACTTAAACTCAGG + Intronic
1000244816 5:159440574-159440596 TCGACCTGGTCCAGAAGTTCAGG - Intergenic
1001780609 5:174365856-174365878 CCCAGCTGAGCCTGAACCTCTGG + Intergenic
1002106150 5:176880261-176880283 TCCAGCTCAGGCAGGAGCTCTGG - Exonic
1002183415 5:177442943-177442965 TCCAGCTGGGCCAGGGGAGCAGG - Intergenic
1002315589 5:178341238-178341260 CCCAGCTAGTCCAGAAGCTGAGG - Intronic
1002926104 6:1606563-1606585 TCCACCTGGCCCAGGAGCTGGGG - Intergenic
1003236051 6:4295916-4295938 TCCTGCTGAACCAGAAACTCTGG + Intergenic
1003873223 6:10417514-10417536 TCCGGCGGGGCCAGAACCCCGGG + Intronic
1005309670 6:24547527-24547549 CAAAGCTGGGACAGAAGCTCGGG - Intronic
1006429652 6:33988017-33988039 TCCAGCTGATCCCGAAGCTCTGG - Intergenic
1006519596 6:34563577-34563599 TCCAGCTTGCTCAGAAACTCAGG + Intergenic
1006805983 6:36789470-36789492 ACCAGCTGGGCTAGAAGCTTGGG + Intronic
1007211732 6:40197802-40197824 TCCAGAGGGGCAAGAAGCTATGG + Intergenic
1007221603 6:40283174-40283196 ACCAGCTGGGCTGGAAGTTCTGG + Intergenic
1007301881 6:40873899-40873921 CCAAGATGGGCAAGAAGCTCAGG - Intergenic
1010878478 6:81138534-81138556 GACCACTGGGCCAGAAGCTCTGG - Intergenic
1013279771 6:108624883-108624905 TCCAGCTACTCCAGAGGCTCAGG - Intronic
1013980155 6:116120679-116120701 GCCAGCTGGGCCAGGAGGACCGG + Exonic
1015438849 6:133223856-133223878 TCCAGCTGGTCCAAATGCTGTGG - Intergenic
1015665725 6:135626357-135626379 TCCAGCTGACCCAGAAGCCCAGG + Intergenic
1017155454 6:151318825-151318847 TCCAGCTACTCCAGAGGCTCAGG + Intronic
1018363532 6:163096333-163096355 ACCAGCTGGGCAGGAGGCTCAGG + Intronic
1020032651 7:4943689-4943711 TCCAGAAGGGCTACAAGCTCAGG - Intronic
1021548404 7:21842434-21842456 TGGACCTTGGCCAGAAGCTCAGG - Intronic
1022259762 7:28692651-28692673 TCCAGCTACTCCAGAAGCTGAGG + Intronic
1023844717 7:44114127-44114149 TCCAGCTGGGTCTCAAACTCAGG - Exonic
1023989074 7:45117417-45117439 TCCAGCTGGGACAGAGCCCCGGG - Intergenic
1026118722 7:67518230-67518252 ACCAGGTGGGCCAGAAGTTAGGG - Intergenic
1026133272 7:67637403-67637425 TCGCGCTGGGCTAGAAGGTCGGG + Intergenic
1028364492 7:90011691-90011713 TGGAGCTGGGCCTGAAGCCCTGG + Intergenic
1029320531 7:99755086-99755108 CCCAGCTAGTCCAGAAGCTAAGG - Intergenic
1029639180 7:101807901-101807923 TCCAGCTACGCCAGAGGCTGAGG + Intergenic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035431953 7:158829297-158829319 GCCAGCTGCGCCAGCAGCCCGGG + Exonic
1036615180 8:10382241-10382263 TCCAGCAGGCCCAGCAGCCCAGG + Intronic
1037813779 8:22101573-22101595 AACAGCTGGGTCATAAGCTCTGG + Intronic
1038781717 8:30573874-30573896 TCCAGCTGAGTCTGAAGCCCAGG - Intergenic
1038854950 8:31320970-31320992 ACAAGCTGGGCCAGCATCTCAGG + Intergenic
1039190620 8:34970061-34970083 TCCAGCTACTCCAGAAGCTGAGG - Intergenic
1042210843 8:66378669-66378691 TCCTGCGGGGGCAGGAGCTCAGG - Intergenic
1042336023 8:67630859-67630881 ACCACCTGGGCCAGCAGCTGCGG + Intronic
1044128229 8:88485203-88485225 TCTAGCTGGGCCCAAAGCTATGG - Intergenic
1045438692 8:102189120-102189142 CCCAGCTGAGTCAGAAGCCCTGG - Intergenic
1045560001 8:103252269-103252291 TGCAGGTGGACCACAAGCTCAGG + Intergenic
1047401629 8:124553339-124553361 TCCAGATGGGCCAGAAGAGCGGG - Exonic
1049358290 8:142199472-142199494 TCCTGCTGGGCCTGTGGCTCTGG + Intergenic
1049776457 8:144408089-144408111 GGCAGATGGGTCAGAAGCTCAGG - Intronic
1049888226 9:42977-42999 TGGAGCTGGTCCACAAGCTCAGG + Intergenic
1049912876 9:286534-286556 TGCAGCTTGCCCAGGAGCTCGGG + Exonic
1051039682 9:12792126-12792148 TTCATATGGGTCAGAAGCTCTGG - Intronic
1051725732 9:20086814-20086836 TTCAGCTGTTCCAGATGCTCTGG - Intergenic
1055609245 9:78004535-78004557 TCAAGCTTGGGGAGAAGCTCTGG - Intronic
1057056328 9:91964085-91964107 TCCTGCTGACACAGAAGCTCAGG + Intergenic
1057092397 9:92270678-92270700 TCCAGCTACTCCAGAAGCTGAGG + Intronic
1060223198 9:121775086-121775108 TCCAGCTGTGGCAGCTGCTCTGG + Intronic
1060347360 9:122828491-122828513 TCCCTTTGGGCCAGCAGCTCCGG + Exonic
1060792841 9:126497564-126497586 TGTAGCTGGGCCTGGAGCTCAGG - Intronic
1060925888 9:127454816-127454838 TCCCTCTGGGCCTCAAGCTCTGG + Intronic
1061815561 9:133192492-133192514 TTGAGCTGGGCCAGGAGCTCCGG + Intergenic
1062004500 9:134232358-134232380 TCCAAATGGGCCATGAGCTCAGG - Intergenic
1062134691 9:134918968-134918990 CCCGCCTGGGCCAGTAGCTCAGG - Intergenic
1062482955 9:136760842-136760864 TCCAGGTGGGCCTGAAGTTTTGG - Intronic
1062627437 9:137449657-137449679 TCCAGCTGTTCCAGAACCTCAGG - Exonic
1062707709 9:137954416-137954438 CCCAGCGAGGACAGAAGCTCAGG + Intronic
1185648709 X:1633145-1633167 TCCAGGTGGGGCTGGAGCTCTGG + Exonic
1186154608 X:6712264-6712286 TCCAGCTGCTCCAGAGGCTGAGG - Intergenic
1187675073 X:21708207-21708229 CCCTGCTGGGGCAGAAACTCTGG + Intronic
1187911001 X:24111147-24111169 TCCAGCTAGTCCAGAGGCTGAGG + Intergenic
1197277513 X:124497093-124497115 GCCATCAGGGCCAGAAGCTAAGG + Exonic
1200215982 X:154368502-154368524 TCCAGCTGGCCCAGAATCCAGGG + Intronic
1200391849 X:155953206-155953228 TCACCCTGGGCCTGAAGCTCAGG - Intergenic
1201853519 Y:18515673-18515695 TCCAGATAGGCGAGATGCTCAGG - Intergenic
1201879802 Y:18804711-18804733 TCCAGATAGGCGAGATGCTCAGG + Intronic