ID: 905626360

View in Genome Browser
Species Human (GRCh38)
Location 1:39492436-39492458
Sequence GACGCGAACCACAGGGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 2, 1: 0, 2: 0, 3: 1, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905626352_905626360 6 Left 905626352 1:39492407-39492429 CCTGGCCGAACGGGGAATCACAG 0: 1
1: 1
2: 0
3: 2
4: 36
Right 905626360 1:39492436-39492458 GACGCGAACCACAGGGGAGTGGG 0: 2
1: 0
2: 0
3: 1
4: 48
905626345_905626360 24 Left 905626345 1:39492389-39492411 CCGCGGGCGGTGCCGGGCCCTGG 0: 1
1: 1
2: 2
3: 30
4: 263
Right 905626360 1:39492436-39492458 GACGCGAACCACAGGGGAGTGGG 0: 2
1: 0
2: 0
3: 1
4: 48
905626351_905626360 7 Left 905626351 1:39492406-39492428 CCCTGGCCGAACGGGGAATCACA 0: 1
1: 1
2: 0
3: 0
4: 42
Right 905626360 1:39492436-39492458 GACGCGAACCACAGGGGAGTGGG 0: 2
1: 0
2: 0
3: 1
4: 48
905626354_905626360 1 Left 905626354 1:39492412-39492434 CCGAACGGGGAATCACAGACGGT 0: 1
1: 1
2: 0
3: 3
4: 30
Right 905626360 1:39492436-39492458 GACGCGAACCACAGGGGAGTGGG 0: 2
1: 0
2: 0
3: 1
4: 48
905626350_905626360 12 Left 905626350 1:39492401-39492423 CCGGGCCCTGGCCGAACGGGGAA 0: 1
1: 1
2: 0
3: 5
4: 105
Right 905626360 1:39492436-39492458 GACGCGAACCACAGGGGAGTGGG 0: 2
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905626360 Original CRISPR GACGCGAACCACAGGGGAGT GGG Intronic
904998982 1:34653285-34653307 GACGTGCACCAGAGGAGAGTCGG - Intergenic
905425694 1:37882426-37882448 GACGAGAAGCACAGAGGAGAAGG + Intronic
905626360 1:39492436-39492458 GACGCGAACCACAGGGGAGTGGG + Intronic
905670536 1:39788019-39788041 GACGCGAACCACAGGGGAGTGGG - Intronic
905915642 1:41682492-41682514 GACACCAACCACAGGGTATTCGG - Intronic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
915798736 1:158765933-158765955 GATGAGAACCACAGTGAAGTGGG + Exonic
916428180 1:164701619-164701641 GACCATCACCACAGGGGAGTGGG - Intronic
920409524 1:205749137-205749159 AACGAGAACCACACGGGATTTGG + Intronic
1084426935 11:69089153-69089175 GACCCGAACAACAGTGCAGTCGG + Intronic
1091750501 12:3018945-3018967 GCCACGAAACCCAGGGGAGTCGG + Intronic
1092144218 12:6203499-6203521 GAGGCCAACCTCAGTGGAGTAGG + Intronic
1100454675 12:94740989-94741011 GAAGAAAACCACAGGGGAGGTGG + Intergenic
1108530169 13:51320986-51321008 GACACCAACCATAGGGGATTAGG + Intergenic
1113876077 13:113595563-113595585 ATCCCCAACCACAGGGGAGTGGG - Intronic
1114728509 14:24965191-24965213 GATGCAAACCAGAGGGGAATGGG + Intronic
1115619423 14:35126518-35126540 GAGGAGAACCACAGGGAAGAAGG + Intronic
1128644500 15:69365687-69365709 TACGCCAACCACAAGTGAGTTGG + Intronic
1131151433 15:90049714-90049736 GAGGAGAACCAGAGGGCAGTGGG - Intronic
1132910480 16:2308209-2308231 GATGGGAGCCACAGGGCAGTGGG - Intronic
1138423697 16:56916424-56916446 GGCTCACACCACAGGGGAGTAGG - Intergenic
1139307272 16:65997759-65997781 GATGAGAATCACAGTGGAGTTGG - Intergenic
1141413302 16:83851144-83851166 GAGACGAACCACAGGAGAGGAGG - Intergenic
1142695208 17:1629386-1629408 GACGGGAACCACCGGGGCGGGGG - Intergenic
927863903 2:26576761-26576783 GACAAGAACAACAGGGGTGTGGG - Intronic
934566214 2:95343032-95343054 GAGGAGAACCACAGTGGAGGTGG + Intronic
940595630 2:155788681-155788703 GACGTGAACCACCTGGGAGGCGG + Intergenic
946446639 2:219745787-219745809 GATGAGAACACCAGGGGAGTGGG + Intergenic
948174760 2:235934410-235934432 GACGCGAACCAGAGGGACGCCGG - Intronic
948993276 2:241565161-241565183 GATGCTGACCACAGGGGAGTGGG - Intronic
1172233398 20:33352461-33352483 GTCCCGCACCACAGTGGAGTTGG + Intergenic
1172903450 20:38351279-38351301 GAGGAAACCCACAGGGGAGTGGG + Intronic
1174173628 20:48631840-48631862 GAAGAGAACCCCAGGGGAGGAGG - Intronic
955769853 3:62375786-62375808 AACGGGATCCACAGGAGAGTCGG - Intergenic
966749528 3:183308912-183308934 AGCGCTAACCACAGGGGACTTGG + Intronic
967725777 3:192861243-192861265 AACCAGAACCACAGGGGACTTGG - Intronic
972329450 4:38051058-38051080 AACGCCAACAACAGAGGAGTGGG - Intronic
985689358 5:1298570-1298592 GAGACTAACCATAGGGGAGTGGG - Intergenic
995784879 5:115816944-115816966 GTCGCGAACCACAGCGGCGGAGG - Exonic
1006052942 6:31357326-31357348 GAAGTGAAACTCAGGGGAGTGGG + Intergenic
1006220256 6:32484053-32484075 GACGCGAGGCACAGGGGATATGG - Intergenic
1006828456 6:36954364-36954386 GACCCTACCCACAGAGGAGTGGG - Intronic
1015308483 6:131736972-131736994 GAGGAGAAACACAGGGGAGAAGG - Intronic
1019812076 7:3172149-3172171 AACGCCAAGCACAGGGGAGAGGG + Intronic
1024330659 7:48151580-48151602 GAGGAGAACCACAGAGAAGTGGG - Intergenic
1025811951 7:64881210-64881232 TCCGGGAGCCACAGGGGAGTGGG + Intronic
1031593522 7:123621833-123621855 GACACCAACTCCAGGGGAGTGGG - Intronic
1040615098 8:49027318-49027340 GACACCAACCACAGTGCAGTGGG - Intergenic
1051941519 9:22511308-22511330 GGCGTGAACCCCAGGGGAGGCGG - Intergenic
1061902884 9:133681891-133681913 GAGGGGAAACACAGGGGAGGTGG - Intronic
1191797411 X:65035246-65035268 GACGGGGACCATAGGAGAGTAGG + Intergenic