ID: 905629105

View in Genome Browser
Species Human (GRCh38)
Location 1:39509017-39509039
Sequence CTGTGGGGACGCCCGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905629105_905629111 -6 Left 905629105 1:39509017-39509039 CCACAGCACGGGCGTCCCCACAG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 905629111 1:39509034-39509056 CCACAGAGCTGATGGGTTTGTGG 0: 1
1: 0
2: 1
3: 28
4: 256
905629105_905629112 -5 Left 905629105 1:39509017-39509039 CCACAGCACGGGCGTCCCCACAG 0: 1
1: 0
2: 1
3: 13
4: 145
Right 905629112 1:39509035-39509057 CACAGAGCTGATGGGTTTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905629105 Original CRISPR CTGTGGGGACGCCCGTGCTG TGG (reversed) Intronic
900421247 1:2556889-2556911 CTGTGGTGAGCCCAGTGCTGGGG - Intronic
901772250 1:11536398-11536420 CTGTGGCGATGACCGTGGTGAGG - Exonic
901818045 1:11806050-11806072 CTGTGGGCACGGCCATGTTGGGG - Intronic
904838458 1:33354773-33354795 CTGTGGGGTCGTCCGAGCTGTGG + Intronic
905629105 1:39509017-39509039 CTGTGGGGACGCCCGTGCTGTGG - Intronic
906917122 1:50023738-50023760 CTGTGGGGGCGGCCGATCTGGGG - Intronic
912978053 1:114347475-114347497 CTGCTGGGACCCCAGTGCTGTGG - Intergenic
915525761 1:156475350-156475372 CTGTGGGGGCCTCCGTGCTAAGG - Intronic
916740694 1:167644724-167644746 CTGTGGGGAGGCCCCTGCCTAGG + Intronic
917196986 1:172477179-172477201 CTGTGGGTACAACAGTGCTGTGG + Intergenic
917979357 1:180259667-180259689 CTCTGTGGATGCCCGTGCTGGGG + Intronic
919751585 1:201041190-201041212 GTGTGGGGACTCCTGTGCTGGGG + Intronic
920495293 1:206450488-206450510 CAGTGGGGACGCCAGGGGTGAGG + Intronic
922574006 1:226650582-226650604 TCGTGGGGACGCCCCTGCTCAGG + Intronic
923150830 1:231231836-231231858 CTGTGGGGACACCAGGGCTGAGG + Intronic
1063459063 10:6203943-6203965 CCATGGGGGCGCCCGTGCTGGGG + Intronic
1071368604 10:84927476-84927498 CTGTGGGTACGCCTGTGGTTTGG - Intergenic
1073592520 10:104770406-104770428 CTGTGGGGATGCCAGTTTTGTGG + Intronic
1076073652 10:127514324-127514346 CTGTGGGGAAGACCTTGCTCAGG + Intergenic
1077359471 11:2134309-2134331 CTTGGGGGACCCCCGTGATGGGG - Intronic
1078066658 11:8083206-8083228 CTGAGTGGACTCCGGTGCTGTGG + Intronic
1079472255 11:20789749-20789771 CTGTTGGGACACCCTGGCTGAGG - Intronic
1083817911 11:65147551-65147573 CTGTGGGGAGGCCCATGTAGAGG + Intergenic
1084068343 11:66718402-66718424 CTGTGGGGACGACTGTGCCTGGG - Intronic
1084363522 11:68684082-68684104 CTCTGGGGTCTCCAGTGCTGCGG + Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1089591937 11:119547207-119547229 CTGTTGGGACACCCTGGCTGTGG + Intergenic
1092917590 12:13202597-13202619 GGGTGGGGACTCCTGTGCTGAGG + Intronic
1094564874 12:31590632-31590654 CTGTGGGGACGCGCGGGAGGCGG - Intronic
1096215772 12:49796753-49796775 CTGTGGGGGCGCCTGGTCTGGGG + Exonic
1103377722 12:120469660-120469682 CTGCGGGGGGACCCGTGCTGAGG - Exonic
1103623770 12:122204099-122204121 CTGCGGGGACCCCCGGGCCGGGG - Intronic
1104127484 12:125861662-125861684 CTGCGGGGACGCCGGGGTTGGGG - Intergenic
1104921903 12:132295005-132295027 GTGTGGAGACGCCCGGCCTGCGG + Intronic
1107560480 13:41553012-41553034 CTGTGAGCACACCCGAGCTGAGG - Intergenic
1113646161 13:111998068-111998090 CTGGGGAGAGGCCCGGGCTGTGG - Intergenic
1113927843 13:113951276-113951298 CCGTGGGGGCCCCGGTGCTGAGG - Intergenic
1113933592 13:113981568-113981590 GGGTGGGGCCGCCCGTGCTCAGG - Intronic
1121123705 14:91392691-91392713 GTGAGGGGCCGCCCTTGCTGGGG - Intronic
1122202458 14:100130813-100130835 CTCCGGAGACGCCCGTGCTGCGG - Intronic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1123117305 14:105900509-105900531 CTGTGGGGCTCCGCGTGCTGGGG + Intergenic
1123434444 15:20244856-20244878 CTGTGGGGGTGCCTGTGCCGCGG - Intergenic
1124235109 15:27983605-27983627 CTGTGGGGAAGGCAGTGCTGGGG + Intronic
1128245406 15:66129174-66129196 CTGTGAGGACCCCCTTGTTGGGG - Intronic
1129925171 15:79357622-79357644 CTGGGAGGACTGCCGTGCTGGGG + Intronic
1129983505 15:79896532-79896554 CCGTGGGGATGACGGTGCTGTGG - Intronic
1132317689 15:100901793-100901815 CTGTGGGGATGCCCTGGCTGGGG + Intronic
1132570155 16:641005-641027 CTGGGGGGATCCCTGTGCTGGGG - Intronic
1132570204 16:641115-641137 CTGGGGGGATCCCTGTGCTGGGG - Intronic
1132570302 16:641395-641417 CTGGGGGGATCCCTGTGCTGGGG - Intronic
1132907564 16:2290758-2290780 CTCTGGGGACACCTGTGCAGGGG - Intronic
1133090514 16:3400783-3400805 GTCTGGGGACGCCCGGCCTGAGG + Intronic
1133166973 16:3954723-3954745 CTGTGTGGACTCCAGTGTTGCGG - Intronic
1134135879 16:11676080-11676102 CTGTGACCACGCCCGTGGTGGGG - Exonic
1135354312 16:21757007-21757029 CTGCGCGGACGCCCGAGATGTGG + Intronic
1135452803 16:22573147-22573169 CTGCGCGGACGCCCGAGATGTGG + Intergenic
1136850170 16:33606247-33606269 CTGTGGGGGTGCCTGTGCCGCGG + Intergenic
1137555963 16:49470522-49470544 TTTTGGGGACCCCAGTGCTGAGG - Intergenic
1138496603 16:57412772-57412794 CTGTAGGGACGCCCATGCTGTGG + Intronic
1140894233 16:79311066-79311088 CAGAGGGGAGGCCAGTGCTGAGG - Intergenic
1141999888 16:87658253-87658275 CTGCCGGGACGCCTGAGCTGGGG - Intronic
1142187712 16:88702293-88702315 CTGTGGGGACAGCTGAGCTGCGG + Intronic
1142214581 16:88824366-88824388 CTGTGGTGATGCCAATGCTGCGG + Intronic
1203111783 16_KI270728v1_random:1454700-1454722 CTGTGGGGGTGCCTGTGCCGCGG + Intergenic
1143016990 17:3896189-3896211 CTGTGTGGAGGGCCCTGCTGTGG - Intergenic
1146058594 17:29593202-29593224 CTGTGGGGACCCGGGGGCTGCGG + Intronic
1147557968 17:41491635-41491657 CTGTGAGGAAGCCATTGCTGGGG - Intronic
1147716903 17:42514602-42514624 CTGTGGCAATGCCGGTGCTGGGG - Intronic
1148845783 17:50529009-50529031 CTGTTGGGACGGTCCTGCTGGGG - Exonic
1150463231 17:65370667-65370689 CTCTGGGGAGACTCGTGCTGAGG - Intergenic
1151572951 17:74936252-74936274 CTGTCTGGACGCCCGGTCTGGGG + Intronic
1151965106 17:77427148-77427170 ATGTGGGGCCGCCTGTGCAGAGG + Intronic
1152504360 17:80737955-80737977 CTTTGGGGATGGCCGTTCTGTGG - Intronic
1152595475 17:81235777-81235799 CTGAGGGGACGGCAGTGCGGGGG - Intronic
1152879795 17:82808441-82808463 GTGGGGGGAGGCCCCTGCTGTGG + Intronic
1155182495 18:23359948-23359970 CTGTGGTGGGGCCCATGCTGAGG + Intronic
1156119133 18:33820662-33820684 CTGTGGGGACCCCCTCTCTGGGG - Intergenic
1156303224 18:35853648-35853670 CAGTGGGGACATCCATGCTGTGG + Intergenic
1159867544 18:73724107-73724129 CTGTGAGGACCACCTTGCTGTGG - Intergenic
1160251825 18:77210030-77210052 CTGTGGGGAAGCCGGTGCCACGG + Intergenic
1160658591 19:287809-287831 CCTTGGGGAGGCCCGTGCGGAGG - Intronic
1160839033 19:1137706-1137728 CTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839087 19:1137831-1137853 CTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839164 19:1138010-1138032 CTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839230 19:1138162-1138184 CTGGGGGGAGGCTCGGGCTGGGG + Intronic
1161081503 19:2312812-2312834 TTCTGGGGACGGCCGTGGTGGGG - Intronic
1161420407 19:4173426-4173448 CTGTGGGGTCGCCCCCACTGCGG + Intergenic
1161617837 19:5282023-5282045 TTCTGGGGACGCCCAGGCTGCGG - Intronic
1163579218 19:18128436-18128458 CTCTGGGGACTCAGGTGCTGGGG - Exonic
1163640217 19:18457860-18457882 CTGTGGGGATGCCCAGGTTGTGG + Intronic
1165030673 19:32995978-32996000 CTGTGGGGGTGCCTGTGCCGCGG - Intronic
1168291142 19:55358321-55358343 CTGCTGGGACGCCCTGGCTGTGG + Exonic
1168636754 19:58002739-58002761 CTGTGGGGCCGCCGTAGCTGCGG - Exonic
925892568 2:8447661-8447683 CTGTGGGGACCCCTGGGCTCTGG - Intergenic
927690426 2:25204361-25204383 CTTTGGGGACGCCAGGGCTCCGG + Intergenic
933695067 2:85211654-85211676 ATGTGGGGTCTCCCCTGCTGTGG - Intronic
934563643 2:95326597-95326619 CGGTGGGAACGCCCATGGTGGGG + Intronic
935072949 2:99711900-99711922 CTGAGGAGTCGCCCGGGCTGTGG - Intronic
936427544 2:112434052-112434074 CTGGTGGGGCGCCCGAGCTGGGG + Intronic
938468352 2:131537052-131537074 CTGTGAGGACGGGCGTGCGGTGG - Intergenic
939344803 2:140950373-140950395 CTGTGGGGACGGGAGTGATGAGG - Exonic
940458217 2:153929250-153929272 CTGGGGTGATGCCAGTGCTGTGG - Intronic
944244314 2:197516097-197516119 CGGAGGGGACGGCAGTGCTGAGG + Exonic
944957238 2:204825997-204826019 CTTTGGAGACTCCCGTGCAGTGG - Intronic
947595450 2:231408859-231408881 CTGTGGGAAGACCTGTGCTGAGG - Intergenic
949010532 2:241675942-241675964 CACTGGGGACCCCCGTGGTGGGG - Exonic
1169209083 20:3755695-3755717 CTCTGGGGAAGCAGGTGCTGGGG - Intronic
1169356756 20:4913174-4913196 ATGTGGGGGTGCCCCTGCTGAGG - Intronic
1175595345 20:60226771-60226793 CTGCCGGGAAGGCCGTGCTGGGG - Intergenic
1175891211 20:62316835-62316857 CAGTGGGGGCGCTCCTGCTGGGG + Intronic
1176293880 21:5060312-5060334 GTCTGGGGACTCCCGTGCTGCGG + Intergenic
1176412923 21:6458464-6458486 CGATGGGGAAGCCAGTGCTGTGG - Intergenic
1178484587 21:33010596-33010618 CAGTGGGGATGCCCGTTCTCTGG - Intergenic
1178861771 21:36295766-36295788 CTGCGGGGGCAGCCGTGCTGAGG - Intergenic
1178910332 21:36668794-36668816 CTTTGGGGAGGCCTGTCCTGGGG + Intergenic
1179247261 21:39644838-39644860 CCCTGGGGAGGCCAGTGCTGGGG - Intronic
1179688416 21:43066786-43066808 CGATGGGGAAGCCAGTGCTGTGG - Intronic
1179863379 21:44203336-44203358 GTCTGGGGACTCCCGTGCTGCGG - Intergenic
1179947335 21:44687166-44687188 CTCTGGGGAAACGCGTGCTGGGG - Intronic
1179961211 21:44767861-44767883 CAGTGGGGACGGCCGTCCTGAGG + Intergenic
1180099346 21:45577211-45577233 CTGTGCAGACACCCCTGCTGAGG + Intergenic
1182152997 22:28043601-28043623 CTGTGGGAACCCCTGGGCTGTGG - Intronic
1184251935 22:43265582-43265604 CAGTGGGGGCTCCCGTGCTGGGG - Intronic
1184889861 22:47373079-47373101 ACGTGGGGACGCCGGCGCTGTGG - Intergenic
1185029837 22:48436412-48436434 TTGGGGAGACGCCCCTGCTGGGG + Intergenic
950456204 3:13094186-13094208 CAGTGGAGAAGCCGGTGCTGTGG + Intergenic
968629167 4:1641367-1641389 CAGCGGGGACCCCCGTGATGGGG - Exonic
968893164 4:3383164-3383186 TTGAGGGGACAACCGTGCTGTGG + Intronic
969534070 4:7745351-7745373 CTGTGGGGACGCTGCTTCTGAGG + Intergenic
984196633 4:176665265-176665287 CTTTGGGGACACCCCTGCTCTGG - Intergenic
985658786 5:1145319-1145341 CTGTGGGGACACAGCTGCTGGGG + Intergenic
1001534443 5:172488755-172488777 CAGTGGGGAGGCCCATGTTGGGG + Intergenic
1001859481 5:175040938-175040960 CTGTGGGGTCCCTGGTGCTGAGG + Intergenic
1002101710 5:176861149-176861171 CTGTGAGGATGACCGAGCTGAGG + Intronic
1002170537 5:177371839-177371861 CTGGGGGGACCCTCATGCTGTGG + Intronic
1002473904 5:179453258-179453280 CTCTGGGGGTGCACGTGCTGGGG - Intergenic
1003049509 6:2766418-2766440 CTGTGGGGGCCGCCGGGCTGCGG + Exonic
1005253416 6:23972945-23972967 CAGTGGGGACGCTCGTGATGTGG + Intergenic
1006239497 6:32665098-32665120 CTGCGGGGGCGGCCGGGCTGGGG - Intronic
1017758362 6:157548999-157549021 CTGTGAGGATGCCAGTGCTTGGG + Intronic
1018199000 6:161378349-161378371 ATGGGGGGATGCCCGAGCTGGGG - Intronic
1018576344 6:165264049-165264071 CTGTGTGCAGGCCAGTGCTGGGG - Intergenic
1018996470 6:168714142-168714164 CTGTGGTCACGCCCATGCAGGGG + Intergenic
1029268975 7:99365103-99365125 CTGAGGCGCTGCCCGTGCTGTGG + Intronic
1034171326 7:149065546-149065568 CTGTGGGGAAGCCCTGGCCGGGG - Intergenic
1035609350 8:949591-949613 CAGCGGGGAGGCCCGTCCTGGGG - Intergenic
1038566472 8:28623262-28623284 CCGTGGGTAAGCCCGTGCCGTGG + Intronic
1042901422 8:73732211-73732233 CGATGGGGAGGCCCATGCTGTGG - Intronic
1045251302 8:100485363-100485385 CTTTGGGGACAACCATGCTGAGG - Intergenic
1047293821 8:123553426-123553448 CTCTGGGCTCGCCCTTGCTGTGG - Intergenic
1048929149 8:139297154-139297176 CTGGGGGCACCCCGGTGCTGAGG + Intergenic
1049361229 8:142213281-142213303 CTGTGCGGACTCCGGGGCTGGGG + Intronic
1049525899 8:143126858-143126880 CTGGGAAGATGCCCGTGCTGGGG + Intergenic
1056216281 9:84408651-84408673 CTGCTGGGACGGCCCTGCTGGGG - Intergenic
1060661066 9:125405545-125405567 CTCTGGGGGCGCAGGTGCTGGGG + Intergenic
1062480028 9:136746833-136746855 CTGTGGGGGTAGCCGTGCTGGGG - Intronic
1062494259 9:136824203-136824225 CTGTGGCGAGGCTCCTGCTGTGG + Intronic
1190261709 X:48801851-48801873 CTGTGGGGACGCGAGCGCTCAGG - Intronic
1192198795 X:69050413-69050435 CTGTGTGGAGGCCATTGCTGGGG - Intergenic