ID: 905630500

View in Genome Browser
Species Human (GRCh38)
Location 1:39515511-39515533
Sequence TTGAACTCCCTCACCTCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905630500_905630510 27 Left 905630500 1:39515511-39515533 CCCCGAGAGGTGAGGGAGTTCAA 0: 2
1: 0
2: 0
3: 4
4: 87
Right 905630510 1:39515561-39515583 CATCCGGGCAGACTTCGCCCTGG 0: 2
1: 0
2: 1
3: 9
4: 72
905630500_905630506 11 Left 905630500 1:39515511-39515533 CCCCGAGAGGTGAGGGAGTTCAA 0: 2
1: 0
2: 0
3: 4
4: 87
Right 905630506 1:39515545-39515567 TCCTTTTGGAGCGCGCCATCCGG 0: 2
1: 0
2: 0
3: 1
4: 29
905630500_905630504 -3 Left 905630500 1:39515511-39515533 CCCCGAGAGGTGAGGGAGTTCAA 0: 2
1: 0
2: 0
3: 4
4: 87
Right 905630504 1:39515531-39515553 CAACGGCGACCACTTCCTTTTGG 0: 2
1: 0
2: 1
3: 1
4: 31
905630500_905630508 12 Left 905630500 1:39515511-39515533 CCCCGAGAGGTGAGGGAGTTCAA 0: 2
1: 0
2: 0
3: 4
4: 87
Right 905630508 1:39515546-39515568 CCTTTTGGAGCGCGCCATCCGGG 0: 2
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905630500 Original CRISPR TTGAACTCCCTCACCTCTCG GGG (reversed) Intronic
900627037 1:3613080-3613102 GTGAACTAGCTCACCTCTTGGGG - Intergenic
900643736 1:3699330-3699352 TCAAACTCCCTGATCTCTCGTGG - Intronic
901926075 1:12567083-12567105 GTGACCTCCTTCACCTCCCGGGG + Intergenic
904521776 1:31101339-31101361 TTGCACACCCTGACCTCTCCTGG - Intergenic
905630500 1:39515511-39515533 TTGAACTCCCTCACCTCTCGGGG - Intronic
905667261 1:39770678-39770700 TTGAACTCCCTCACCTCTCGGGG + Exonic
906917340 1:50024939-50024961 TTGAACTCTCTCACATTTCCTGG + Intergenic
907845415 1:58201461-58201483 TTCAACTGCCTCACCCCACGGGG + Intronic
922675507 1:227546793-227546815 CCCAACTTCCTCACCTCTCGAGG - Intergenic
923861636 1:237897643-237897665 TTGAACTACCCCACCTCACCAGG - Intergenic
1063961956 10:11314177-11314199 ATGAACTCCTTGACCTCTCTCGG + Exonic
1066978574 10:42390988-42391010 GGAAACTCCCTCACCTCTCCAGG - Intergenic
1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG + Intronic
1068587588 10:58816610-58816632 TTGTCCTCCCTCACCTCTTTGGG + Intronic
1072284429 10:93899421-93899443 TTGAACTCCCTACCCTCCCTGGG + Intronic
1073105460 10:101030134-101030156 CTGAGCTCCCTCTCCTCCCGAGG - Exonic
1078792385 11:14557632-14557654 ATGAATTCCCTCACCCCTCTAGG - Intronic
1086810444 11:91303268-91303290 TGAAACTCCCTCCCCTCTGGTGG - Intergenic
1097736129 12:63183022-63183044 TTGAACTCCCTCATTTCTAGAGG - Intergenic
1103681502 12:122697621-122697643 TTGAGCTCCCTTCCCTTTCGAGG - Intergenic
1103683234 12:122711052-122711074 TTGAGCTCCCTTCCCTTTCGAGG - Intergenic
1103979197 12:124725473-124725495 CTGCACTCCGTCACCTCTCCGGG + Intergenic
1105209968 13:18251983-18252005 TTTAAGTCCCTCACCCCCCGAGG + Intergenic
1129356645 15:74996136-74996158 TTGACTTCCCTCACCTCCCTCGG + Intronic
1132774038 16:1581970-1581992 TTGAACGCCCCCACCTCTTCAGG - Intronic
1148351035 17:46942483-46942505 TTAATCTCCCACACTTCTCGTGG + Intronic
1150897748 17:69233982-69234004 ATGAACTACCTCACCTGTCCAGG - Intronic
1151003755 17:70409769-70409791 TTTAACTCACTCACCTTTAGTGG + Intergenic
1155461781 18:26091136-26091158 TTGACCTCCCTCCCCTCTCCGGG - Intronic
1164173762 19:22749843-22749865 TTAAACTTCCTCACCACTTGTGG + Intergenic
1164941980 19:32257704-32257726 TTGAACGCCTTCACCTGTCCAGG - Intergenic
1167753155 19:51393125-51393147 TAGAACTCCCCCAACTCTCAAGG - Intergenic
931438343 2:62268326-62268348 TTTAACTCTCTCACCCCTAGTGG - Intergenic
931937869 2:67218304-67218326 TTGAATTCACTTGCCTCTCGTGG - Intergenic
939493452 2:142902674-142902696 TTAAACTTCCTCACCACTTGTGG - Intronic
941440068 2:165523627-165523649 TTGATTTCCCTCACATCTTGTGG + Intronic
946352010 2:219161278-219161300 TTGAAACCCCTCACCTATCTTGG + Intronic
947235103 2:227933223-227933245 TTGAATTCCCTGACCACACGTGG - Intergenic
1170598470 20:17822980-17823002 TTGAAGTCTCTCACCTCTTTGGG - Intergenic
1171291116 20:23983673-23983695 TTTAAGTCCCTCACCACCCGAGG + Intergenic
1172236247 20:33377481-33377503 TTCAGCTTCCTCACCTCTCTTGG + Intronic
1172307156 20:33888958-33888980 GGGGACTCCCTCACCTCTTGTGG + Intergenic
1173217715 20:41101728-41101750 TTCTACTTCCTCACCTCTCTTGG + Intronic
1173473863 20:43344734-43344756 TTGAACTCCATAATCTCTCCTGG + Intergenic
1173850672 20:46216011-46216033 TTGGATTCCCTTATCTCTCGGGG + Intronic
1180766292 22:18347420-18347442 TTTAAGTCCCTCACCCCCCGAGG - Intergenic
1180780021 22:18514958-18514980 TTTAAGTCCCTCACCCCCCGAGG + Intergenic
1180812737 22:18772279-18772301 TTTAAGTCCCTCACCCCCCGAGG + Intergenic
1181198895 22:21206527-21206549 TTTAAGTCCCTCACCCCCCGAGG + Intergenic
1181648545 22:24246642-24246664 TTTAAGTCCCTCACCCCCCGAGG + Intergenic
1181702825 22:24630360-24630382 TTTAAGTCCCTCACCCCCCGAGG - Intergenic
1182578793 22:31291425-31291447 TGGGCCTCCCTCTCCTCTCGTGG + Intronic
1184280557 22:43435182-43435204 TTGAACTTCTTCACCTCGCTCGG - Exonic
1184430618 22:44439870-44439892 TCAGCCTCCCTCACCTCTCGTGG + Intergenic
1184729611 22:46365413-46365435 TGGGACTCCCTCACCTCCCAGGG - Intronic
1203227910 22_KI270731v1_random:88310-88332 TTTAAGTCCCTCACCCCCCGAGG - Intergenic
952391749 3:32886427-32886449 TTGCACTTCCTGACCTCTTGTGG + Intronic
954909358 3:54090027-54090049 TTGACCTGCCTCACCTCTGTGGG - Intergenic
958657298 3:97018765-97018787 TTCTACTCCTTCACCTCTTGTGG - Intronic
960277670 3:115745833-115745855 TTAAACTTCCTCACCACTTGTGG + Intergenic
961596784 3:128024107-128024129 TTGAACTTCCCCACATCTTGTGG + Intergenic
964745362 3:160007274-160007296 TTGAACTCAGTCACCTGTCAAGG + Intergenic
965054590 3:163697134-163697156 TTAAACTTCCTCACCACTTGTGG - Intergenic
968946523 4:3667378-3667400 TTGAGCTTCCTCACATCTCAGGG - Intergenic
969593845 4:8137099-8137121 TTGAACTCTCACACTTCTGGAGG - Intronic
969663148 4:8542129-8542151 TTGAGCACCCGCACCTCTCCCGG - Intergenic
979966057 4:127077579-127077601 GGGAACTCCCTCCCCTCTCCAGG - Intergenic
984640318 4:182157759-182157781 TGGAACGCCCTTACCTCTCCTGG - Intronic
986403487 5:7402137-7402159 TTGAATGCCCTCAGCTCTTGTGG - Intronic
986828647 5:11550588-11550610 TTAAACTTCCTCAGCTCTTGAGG + Intronic
987920686 5:24276537-24276559 TTGAACTCCTTGACCTCAAGTGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
989795628 5:45467762-45467784 TTGAATTCCCTCAACTTTGGGGG + Intronic
990892494 5:60663788-60663810 TTAAACTTCCTCACCACTTGTGG + Intronic
990962076 5:61404668-61404690 GTGAAATCCCTCTCCTCTCTTGG - Intronic
999039237 5:148388647-148388669 TAAAACTTCCTCACCTCTCTCGG + Intronic
1011076991 6:83448161-83448183 TTAAACTTCCTCACCACTTGTGG + Intergenic
1011189571 6:84715466-84715488 TTAAACTTCCTCACCACTTGTGG - Intronic
1012217110 6:96600846-96600868 TTGAACTCCCTGCCCACTCAAGG - Intronic
1012620979 6:101343685-101343707 CTGGACTCCCTCACCTGTAGAGG + Intergenic
1013369600 6:109457199-109457221 CTGAATTCCCTCGCCTCTCCTGG - Intergenic
1016712353 6:147188525-147188547 CTGAAGTCACTCACCTCTCCAGG - Intergenic
1018830841 6:167442325-167442347 CTCAACTCCCTCTCCTCCCGGGG + Intergenic
1019299576 7:296424-296446 TTGAACTCCCCCAACTCTCCTGG + Intergenic
1020937319 7:14483845-14483867 TTGTTCTCCATCACCTCTGGAGG + Intronic
1021934066 7:25612904-25612926 TGTAGCTCCCTCACCTCTCTTGG + Intergenic
1024386434 7:48757184-48757206 TAGAACTCCATCAGCTCTCTTGG + Intergenic
1028151771 7:87381776-87381798 TTCAAATGCCTCACCTCTTGAGG - Intronic
1043539719 8:81246560-81246582 TTAAACTACATCACCTCTCTGGG + Intergenic
1043860039 8:85305472-85305494 CTGAACTACCTGACCTCTTGAGG - Intergenic
1057717275 9:97504483-97504505 TTTAACTCTCTCCCCTCTCCTGG - Intronic
1188009807 X:25043654-25043676 TTGCTCTACCTCACCTCTCAGGG + Intergenic
1189613828 X:42764796-42764818 GGAAACTCCCTCACCTCTCTGGG + Intergenic