ID: 905634616

View in Genome Browser
Species Human (GRCh38)
Location 1:39541652-39541674
Sequence TCAAACACACAGGACCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905634616_905634620 28 Left 905634616 1:39541652-39541674 CCTACCTGGTCCTGTGTGTTTGA No data
Right 905634620 1:39541703-39541725 CTTGTAGATGGACTTACCCCTGG No data
905634616_905634619 16 Left 905634616 1:39541652-39541674 CCTACCTGGTCCTGTGTGTTTGA No data
Right 905634619 1:39541691-39541713 ATCAAATTTCTTCTTGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905634616 Original CRISPR TCAAACACACAGGACCAGGT AGG (reversed) Intergenic
No off target data available for this crispr