ID: 905637347

View in Genome Browser
Species Human (GRCh38)
Location 1:39563608-39563630
Sequence CCTCACCTGCAGAGGCTGTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905637344_905637347 2 Left 905637344 1:39563583-39563605 CCTTTTAAGCATTCTGTCTGGTG 0: 1
1: 0
2: 2
3: 30
4: 201
Right 905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG 0: 1
1: 0
2: 2
3: 18
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905637347 Original CRISPR CCTCACCTGCAGAGGCTGTA TGG Exonic
900464497 1:2818451-2818473 CCTGCCCTGCAGGGGCTGCAGGG + Intergenic
900622737 1:3594873-3594895 CCTCAGCTTCAGTGGGTGTAAGG - Intronic
901568839 1:10142690-10142712 CATTCCCTGCAGAGGCTCTAGGG + Intronic
902058297 1:13620429-13620451 CCTCACCTACAGATGCTCTGTGG - Intergenic
902407277 1:16191668-16191690 CCTGCTCTGCAGAGACTGTAGGG - Intergenic
903500572 1:23798111-23798133 TCTCACCTCCAGAAGCTGGATGG + Exonic
904834181 1:33324346-33324368 CTCCACCTGCAGAGGGTGTAGGG + Exonic
904865923 1:33578791-33578813 CCTCACCAGGGGTGGCTGTAAGG - Intronic
905309028 1:37036879-37036901 TCCCAGCTGCAGAGGCTGTGGGG + Intergenic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
905627541 1:39498679-39498701 CTTGGCCTGCAGAGGCTGTGGGG + Intronic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
905668883 1:39778429-39778451 CTTGGCCTGCAGAGGCTGTGGGG - Intronic
905898203 1:41562823-41562845 CCCAACCTGCAGAGGCTTTGAGG - Intronic
911541584 1:99163969-99163991 CCTCACCAGCTGTGGCTGAAAGG + Intergenic
912117996 1:106431608-106431630 TCTCACCTACAGAATCTGTAAGG - Intergenic
914998242 1:152563528-152563550 ACTCACCTCCAGAGGCTGAGAGG + Intronic
917983312 1:180288503-180288525 ACTCACAGGCAGAGGCTGAAAGG + Exonic
919006764 1:191908936-191908958 CCTAAATTGCAGAGGATGTATGG - Intergenic
921206440 1:212853550-212853572 CCTGATCAGCAGAGGCTATATGG - Intergenic
922803674 1:228375199-228375221 CCACTCCTGCATAGGCTGGAGGG - Intronic
922823722 1:228502669-228502691 CTACAGCTGCAGAGGCTGTCTGG + Intergenic
923846394 1:237737420-237737442 CCTCACCTGCGTAGTGTGTATGG + Intronic
924273788 1:242363963-242363985 CCTCTCCTTCAGAGACTGCAAGG - Intronic
1064011280 10:11738411-11738433 ACTCTTCTGCAGAGGCTGTCCGG + Intergenic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1067087696 10:43251607-43251629 CCTCACCTCCAGACGCAGTCAGG + Intronic
1067831171 10:49611797-49611819 CCACACCTGCAGTGGCTGTACGG + Exonic
1068818373 10:61344495-61344517 CCTGACCTGCAGAAACTGCAAGG - Intergenic
1070306213 10:75240665-75240687 CCTCATCTGGAGAGGCTGAATGG + Intergenic
1072037575 10:91577602-91577624 TACCACCTGCAGATGCTGTAGGG - Intergenic
1073219087 10:101854638-101854660 CCTTACCTCCAGAGGCTTCAGGG - Intronic
1073368445 10:102965001-102965023 CCTCCCCTCCAGAGGATGCAAGG + Intronic
1074248132 10:111714528-111714550 TCTCACCTGCTGCAGCTGTAGGG - Intergenic
1075670155 10:124258946-124258968 CCTGACCTGCAGAAACTGTGTGG - Intergenic
1076122842 10:127950076-127950098 CCTCACCTGTAGGGGCTGCTGGG - Intronic
1076481288 10:130786727-130786749 CCTCAAATGCGGAGTCTGTAGGG - Intergenic
1076924711 10:133476502-133476524 TTTCACCTGCAGAGGCTGTGAGG - Intergenic
1077396588 11:2326787-2326809 CCTCTGCCGCAGGGGCTGTAGGG - Intergenic
1078519800 11:12053727-12053749 CCTCACCTGGAGGGGCTGTGGGG + Intergenic
1080652920 11:34236825-34236847 CCCAAGCTGCAGAGGCTGTCTGG - Intronic
1081687862 11:45055141-45055163 CAGCCCCTGCAGAGCCTGTAAGG - Intergenic
1082957500 11:58885812-58885834 GGTCACCTGCAGGGGCTGAAAGG + Intronic
1082964151 11:58948236-58948258 GGTCACCTGCAGGGGCTGAAAGG + Intronic
1082973092 11:59043877-59043899 GGTCACCTGCAGGGGCTGAATGG + Intergenic
1082977487 11:59087442-59087464 GGTCACCTGCAGGGGCTGAATGG + Intergenic
1084564313 11:69920651-69920673 CCTCAGCTGCTGGGGCTGCAGGG + Intergenic
1086161053 11:83722543-83722565 CCTCACCTCCAGAGGCGGGGTGG + Intronic
1088626088 11:111731686-111731708 CCACACTGGCAGAGGCTGGAAGG + Intronic
1088754871 11:112877619-112877641 CCTCATCTGCCAAGGATGTAGGG + Intergenic
1088841783 11:113633548-113633570 CCTCAACTACAGTGGCTGTGTGG + Intergenic
1088979449 11:114848733-114848755 CTACACCTGCATAGCCTGTATGG + Intergenic
1089310593 11:117555857-117555879 CCTCTCCTGCAGAGTATGGAGGG + Intronic
1090319636 11:125831103-125831125 CCTCAATTACAGAGGATGTATGG - Intergenic
1090332649 11:125943763-125943785 CCTCACCTCCCGAGGCAGCAGGG + Intergenic
1094828097 12:34287565-34287587 CCTTTCCAGCAGATGCTGTATGG + Intergenic
1094833617 12:34312051-34312073 CCTCCCCAGCAGAACCTGTATGG - Intergenic
1095310612 12:40692921-40692943 CCTCCCCTGCCGAGGCGATATGG - Intronic
1097307420 12:58084975-58084997 GCTCACATGCAGAGGCCATATGG + Intergenic
1097453767 12:59769311-59769333 CCTCACCTGCAGTGTCTCTGAGG + Intronic
1097622509 12:61957717-61957739 ACTCACCTGCAGAGGAGATACGG - Intronic
1099323524 12:81181285-81181307 TCTCACCTGGAGAAGCTGTATGG + Intronic
1100478916 12:94959405-94959427 CCCCACCTGGGGAGGCTGGAGGG - Intronic
1101407719 12:104443363-104443385 CCTCTCCTCCAGAGGCTGTGGGG - Intergenic
1102034105 12:109761214-109761236 CCCCACCCCCAGATGCTGTAAGG + Intronic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1106317648 13:28609135-28609157 CCTCACCTGCCAAGGCCGAAAGG - Intergenic
1106462224 13:29981169-29981191 CTGCAGCTGCAGAGGCTGGATGG - Intergenic
1106589874 13:31089947-31089969 CCTCACCTGCAGAGGAATCAAGG - Intergenic
1110360740 13:74621937-74621959 CCACACTTGCAGAGTCAGTAGGG + Intergenic
1110367918 13:74708545-74708567 CATTCCCTGCAGAGGCTCTATGG - Intergenic
1113747732 13:112756632-112756654 CCTCACCTGGAGAGCCTGGACGG + Intronic
1113961608 13:114129412-114129434 CCTCACCTGCAAGAGCTGGAAGG + Intronic
1114307494 14:21437188-21437210 CTTTACCTGCAGTGGCTGTGGGG + Intronic
1114553835 14:23550377-23550399 CCTCTCCTTCAGAGTCTGTCTGG - Intronic
1116226950 14:42164984-42165006 CCTGACCTGCAGAGCCCCTATGG + Intergenic
1121605515 14:95237313-95237335 CGGCACCTGCAGAGGCTGGGAGG + Intronic
1124368568 15:29090624-29090646 GCTCACCTGCTGGGGCTGTGAGG + Intronic
1126901432 15:53318713-53318735 CCTCTCCTGTAGATGCAGTATGG - Intergenic
1129144366 15:73633495-73633517 CCGCCCCTGCAGAGGCTGATTGG + Intronic
1129342980 15:74898131-74898153 CCTCAGCTGCAGAGGAGGAAAGG + Exonic
1130395177 15:83495050-83495072 TTCCACCTGCAGAGGGTGTATGG + Intronic
1133531475 16:6659018-6659040 CATCACTTGGAGTGGCTGTATGG + Intronic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1141778113 16:86137963-86137985 CCTGACCTGCAAAGGATGGAGGG + Intergenic
1142050735 16:87956584-87956606 CTTCTCCTGCAGGGGCTGAAGGG - Intronic
1145910657 17:28540284-28540306 CCGCCCCAGCAGAGGCTGGAAGG + Intronic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1146734092 17:35222468-35222490 CCCCACCTGCAGAGGCCACATGG + Intergenic
1146906806 17:36623157-36623179 GCTCCCCGGCAGAGGCTGCAGGG - Intergenic
1146992046 17:37283261-37283283 ACTCACCTGCATTGGCTTTAAGG + Exonic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1151215849 17:72575857-72575879 ACTCACTTGCAGAGGCAGGAGGG + Intergenic
1151990322 17:77570409-77570431 CCTGCCCTGCAAAGGCTGTGTGG + Intergenic
1152029860 17:77835347-77835369 CCTCACATACATAGGCAGTAAGG - Intergenic
1152877257 17:82793933-82793955 CCTCATCTGCAGAGTCGGCATGG + Intronic
1152959303 18:68964-68986 CCACACCTGCAGTGACTTTAAGG - Intronic
1153345611 18:4021965-4021987 CCTCAACTGCAGTAACTGTAAGG + Intronic
1154083701 18:11281602-11281624 CCTCACCTCCAGAAGGTGTAGGG - Intergenic
1157493932 18:48142249-48142271 CCTGTCCTGCAGGGGCTGGAAGG + Intronic
1161602604 19:5193650-5193672 CTTCACCTGCGCAGCCTGTAAGG - Intronic
1161801448 19:6418696-6418718 CCTCACCTGCAGCTGCTTAATGG + Exonic
1162202672 19:9032468-9032490 GCTCCCCAGCAGAAGCTGTATGG + Intergenic
1162967080 19:14161115-14161137 CCCCACCTGCAGAACCTGCAGGG - Intronic
1163129800 19:15265348-15265370 ACTCACCTTCACAGGCTGTGGGG + Exonic
1166258749 19:41623699-41623721 CCTCACCTGCTGGGGGTTTATGG - Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166743132 19:45126182-45126204 CCTTCCCTGCAGAGCCTGTGAGG + Intronic
1167577771 19:50325944-50325966 GCGCAGCTGCAGAGGCTGGACGG + Intronic
1167926448 19:52825019-52825041 CCTGAAATGCAGAGGCTGCAGGG + Intronic
1168353413 19:55688733-55688755 CTTGGCCTGCAGAGGTTGTAGGG + Intronic
1168380239 19:55914063-55914085 CCTCACCAGCTGAAGCTGTCTGG - Intronic
925255703 2:2485251-2485273 CCTCTCCTGGAGAGGCTGGAGGG + Intergenic
926196836 2:10769108-10769130 CCTCCCCTGTGGAGGCTGCACGG + Intronic
927870455 2:26619760-26619782 CCTCAGTCGCAGAGTCTGTAGGG - Intronic
927870490 2:26619928-26619950 CCTCAGTTGCGGAGTCTGTAGGG - Intronic
927870509 2:26620012-26620034 CCTCAGTCGCAGAGTCTGTAGGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930703586 2:54483495-54483517 CCTCACGTGGAGAGGCTGTCTGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932633968 2:73371730-73371752 CCTGCCCTGCAGAGGTTGCAAGG - Intergenic
933818034 2:86084339-86084361 CCTGAGAGGCAGAGGCTGTAGGG + Intronic
937256759 2:120561189-120561211 CCTCAGCTGCAAAGGCTGCAAGG + Intergenic
937350189 2:121155675-121155697 ACTCACCTGCAGAGGCTCCCAGG - Intergenic
938244941 2:129769093-129769115 GCTCACCTGCAGAGGCTGACGGG - Intergenic
938763608 2:134445850-134445872 CCTGGGCTGCAGAGGCTGTCTGG + Intronic
940050537 2:149458096-149458118 CCATACCAGCAGAGGCTGAATGG + Intronic
943897135 2:193378489-193378511 CTTCACCTGCAGAAGATGTAAGG + Intergenic
944400457 2:199320056-199320078 CCTCTTCTGCAGATTCTGTAGGG - Intronic
945185256 2:207133669-207133691 ACACAGGTGCAGAGGCTGTAGGG - Intronic
946310449 2:218880182-218880204 ACACACCTGCAGGGGCTGGAGGG - Intergenic
946419438 2:219556707-219556729 CTTCACCAGCAGTGGCTCTAAGG + Exonic
946849358 2:223890045-223890067 CCTCATATACAGAGGCTGTGTGG - Intronic
948182124 2:235990334-235990356 CCTGACCCACAGAGGCTGCAGGG - Intronic
948378033 2:237534955-237534977 CCTAGACTTCAGAGGCTGTAGGG - Intronic
948760084 2:240184905-240184927 CCCCACCCGCAGAGGCAGCAAGG + Intergenic
948890339 2:240904350-240904372 CGTCACCTGCAGAGGCCACAGGG + Intergenic
1168747803 20:259069-259091 ACCCACCTGCACTGGCTGTATGG - Exonic
1168875722 20:1171031-1171053 CCTCACCTAGAGAGGATGTGAGG - Intronic
1172878658 20:38182470-38182492 CCTCAACTGCAGGGGCTGGAAGG + Intergenic
1173131108 20:40394415-40394437 CCTCCTCTGCAGATGCTCTATGG + Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1174484408 20:50852104-50852126 CCTCACCTGAAGAGTCGGAATGG - Intronic
1174858820 20:54070769-54070791 CCTCACCTACTGAGGCTGCCGGG + Intergenic
1175667467 20:60872542-60872564 GCTCACTTTCAGAGGCAGTAGGG - Intergenic
1175816998 20:61888367-61888389 CCTCCCTTGCAGCGGCTGGACGG - Intronic
1176192354 20:63818031-63818053 GCTCACCTACAGAGACTGCACGG + Intronic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1178082538 21:29079802-29079824 CCTAACCTGGAGAGACTTTAAGG - Intronic
1178809610 21:35869350-35869372 CAGAACCTGCAGAGGCAGTAGGG - Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180589438 22:16923857-16923879 CCTCAGCTGCCAAGGCTGCAGGG + Intergenic
1180836772 22:18933829-18933851 CCTCACCTGAAGAAGATGTGGGG - Intronic
1180895812 22:19331345-19331367 TCTCACCTGACCAGGCTGTAGGG - Exonic
1183065272 22:35358340-35358362 CCTCACTTGCAGAGGAGGAAGGG + Intergenic
1183191779 22:36326252-36326274 CCTCCCCTTCTGAGGCTGGAAGG - Intronic
1183394901 22:37566194-37566216 CCCCAAATGCAGAGGCTGTGGGG - Exonic
1183442625 22:37831803-37831825 CCTCACCCGCAGATGCCGTGGGG - Exonic
1184259049 22:43304195-43304217 CCGCAAGTGCAGATGCTGTACGG - Intronic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
1184561999 22:45268850-45268872 CCTCACTTCCAGGGGCTGCAGGG - Intergenic
1184824208 22:46936181-46936203 CCTCACCTGTGATGGCTGTAGGG + Intronic
1184844227 22:47071296-47071318 CCACAGCAGCACAGGCTGTAAGG - Intronic
1184965783 22:47971088-47971110 TGTCCCCTGCAGAGGCTGAAGGG + Intergenic
1185203071 22:49520444-49520466 CCTGACCCACAGAGGCTGTGAGG - Intronic
1203286865 22_KI270734v1_random:159128-159150 CCTCACCTGAAGAAGATGTGGGG - Intergenic
950434967 3:12974042-12974064 ACTCACCTGCTGAGGATGCATGG + Intronic
951394031 3:22142672-22142694 CATCACCTGCTGAGGCTGTTTGG - Intronic
951718613 3:25674539-25674561 CCTCACCTGCTGTTGCTGTGGGG - Intergenic
952271211 3:31833458-31833480 CCTGACATGCAGAAGCTGCATGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954713121 3:52514638-52514660 CCTCACCTGGCAGGGCTGTAAGG - Intronic
958928022 3:100179907-100179929 CCTCAATTTCAGAGGATGTATGG - Intergenic
961095044 3:124147211-124147233 TCTCACCTGGAGGGGCTGCATGG - Intronic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
961986518 3:131140436-131140458 CATCACCAGCAGATGCTGTGGGG + Intronic
965777044 3:172242433-172242455 CCTAGACTTCAGAGGCTGTATGG - Intronic
966121607 3:176527933-176527955 CCTGCCCTGCTGAGGCTGTCTGG + Intergenic
967425299 3:189319888-189319910 CAGCACCTGCAAAAGCTGTAAGG - Intronic
968000240 3:195200625-195200647 CCTGCCCTGCACAGGCTGTGAGG - Intronic
968899538 4:3424666-3424688 CCTCGGCTGCCGAGGCTGTGGGG + Intronic
969601613 4:8179735-8179757 CCTGACCTGCAGAGGGTCCATGG + Intergenic
969671758 4:8593566-8593588 CCACACCTGGAGAGGCCGTGAGG - Intronic
970551973 4:17190752-17190774 CTTCACCTGCAAATGCTGCATGG - Intergenic
972832702 4:42832906-42832928 CCTAAATTGCAGAGGATGTATGG + Intergenic
978182447 4:105815224-105815246 CCTCCTCTGCTGATGCTGTATGG - Intronic
978890842 4:113825425-113825447 CCTCCACTGCAGAGGCTTCAGGG + Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
983338069 4:166421280-166421302 TCTCAGCTGCAGTGGCTATAGGG - Intergenic
983970344 4:173863902-173863924 CCTCACCAGCATAGTCTGTGGGG - Intergenic
984625139 4:181998581-181998603 CCTCAATTGCAGAGGTTCTAGGG + Intergenic
985024883 4:185731180-185731202 AGTCAAATGCAGAGGCTGTAAGG + Intronic
985761593 5:1751892-1751914 TCTCAGCTGCACAGGCTGTGGGG - Intergenic
987597532 5:20020688-20020710 CCTCAATTTCAGAGGGTGTATGG + Intronic
988368279 5:30331670-30331692 CATCAACTGCAGAGCATGTAAGG + Intergenic
988537651 5:32083430-32083452 CATCACCTGGAGAGGCTGCTGGG + Intronic
989746838 5:44839430-44839452 CCTCAATTTCAGAGGATGTATGG + Intergenic
990041990 5:51387476-51387498 CCTCCCCCGCACAGGTTGTACGG + Exonic
996818827 5:127603011-127603033 CCTCAGCTCCACAGGCTGTGTGG + Intergenic
997980097 5:138463719-138463741 CCCGACCTCCAGAGGCTGTTGGG + Intergenic
1001475737 5:172049343-172049365 CCTCCCCCACGGAGGCTGTATGG - Intronic
1001652363 5:173324921-173324943 CCTAAACTGCAGAGGATGTGCGG - Intronic
1005352407 6:24949457-24949479 CTTCACGTGCAGAGGCTGAGAGG - Intronic
1005989069 6:30892172-30892194 ACTCACCTGCATAGCCTGGAAGG - Exonic
1006154559 6:32007252-32007274 GCTCTCCTGCAGAGGGTGAAAGG - Intergenic
1006160870 6:32039988-32040010 GCTCTCCTGCAGAGGGTGAAAGG - Exonic
1008848194 6:55993654-55993676 CCTCAATTTCAGAGGATGTATGG - Intergenic
1009994567 6:70884146-70884168 CCTCACCCTCAGAGACTATATGG + Intronic
1010453943 6:76033213-76033235 ACACACCTGCAGAGTCTTTAAGG - Intronic
1010774016 6:79864501-79864523 CCTCACCTCCAGGGCCTGTGTGG - Intergenic
1013055784 6:106581587-106581609 CCTCTCCTGCACAAGCTGTTTGG - Intronic
1019081628 6:169435189-169435211 CCTCAATTTCAGAGGATGTATGG + Intergenic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1020796945 7:12687371-12687393 CTTCACCTGCAGCGGCTGCTCGG + Exonic
1021342211 7:19479320-19479342 TATCACCAGCAGAGGCTGCAGGG + Intergenic
1022015390 7:26344927-26344949 GCTCCCCTGCAGAGGCCCTAGGG + Intronic
1022478315 7:30726536-30726558 CATCCCCTGGAGAGCCTGTAGGG + Intronic
1024383526 7:48725451-48725473 CCTCAATTTCAGAGGATGTATGG - Intergenic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1030967070 7:116006039-116006061 CCTCAATTTCAGAGGATGTATGG + Intronic
1032018756 7:128395125-128395147 CCTCACCTGTGGAGGCTCCAAGG + Exonic
1035133338 7:156675902-156675924 CTGCAGCTGCAGAGGCTGTGGGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038771407 8:30485189-30485211 CCTAACTTGCACAGGCTGTCAGG - Intronic
1039031469 8:33314234-33314256 CCTCAGTTGGAGAGGCTGCAGGG - Intergenic
1039925944 8:41932593-41932615 GCTCACCAGCAGCAGCTGTATGG - Exonic
1041972649 8:63761046-63761068 CCTCACCTGCACATACTCTATGG - Intergenic
1042103248 8:65297054-65297076 CCTCACCTCCAGAAGCTATGTGG - Intergenic
1043714697 8:83467270-83467292 CCTCAATTTCAGAGGGTGTATGG + Intergenic
1044951614 8:97440839-97440861 CCTCACTTTCTGAGGCTCTAGGG + Intergenic
1048267683 8:133001845-133001867 CCACACCTGCACAGGCTGGCTGG - Intronic
1049483960 8:142841759-142841781 CCTAACCTGCAGAAGATGTATGG + Intronic
1049622386 8:143604569-143604591 CCTCACCTCCAGAGGCTGTTGGG + Exonic
1050617318 9:7415745-7415767 CCTCATGTACAGAGGCTATAGGG + Intergenic
1053242122 9:36504589-36504611 CCCTCCCTGCAGAGGCTGTTGGG + Intergenic
1057262299 9:93591900-93591922 GCTCACCTGCAGAGGCCTTGAGG + Intronic
1057567952 9:96181544-96181566 CATCTCCTGCAGAGGCTGCAGGG - Intergenic
1059925505 9:119205330-119205352 TCTCACCTGGAGAGGATGTCTGG - Intronic
1059997344 9:119924939-119924961 CCTCACCTGCAGAGGGCTTTAGG + Intergenic
1061952569 9:133944552-133944574 CACCACCTGCAGAGCCTGTGAGG + Intronic
1062070230 9:134551433-134551455 CCTCACCTGCGGAGGATGCCAGG - Intergenic
1062634842 9:137485278-137485300 CCTCACCTGCAGCGTTTGTCTGG - Intronic
1062634852 9:137485354-137485376 CCTCACCTGCAGCGTTTGTCTGG - Intronic
1062634857 9:137485392-137485414 CCTCACCTGCAGCGTTTGTCTGG - Intronic
1062634862 9:137485430-137485452 CCTCACCTGCAGCGTTTGTCTGG - Intronic
1062634867 9:137485468-137485490 CCTCACCTGGAGAGTGTGTCTGG - Intronic
1062738818 9:138154917-138154939 CCACACCTGCAGTGACTTTAGGG + Intergenic
1186794215 X:13029005-13029027 ACACACCTGCAGGGGATGTAGGG - Intergenic
1188027493 X:25226043-25226065 CCTCACCTGCAGCAACTGTGTGG + Intergenic
1189011357 X:37048772-37048794 CCTAAACTTCAGAGGATGTATGG + Intergenic
1189213372 X:39303205-39303227 CCTCAATTTCAGAGGATGTATGG + Intergenic
1194764049 X:97828765-97828787 TCTCTCTTACAGAGGCTGTAGGG - Intergenic
1195157127 X:102134906-102134928 CCTCACCAGCAGAATCTTTAGGG - Intergenic