ID: 905645027

View in Genome Browser
Species Human (GRCh38)
Location 1:39619314-39619336
Sequence CAGGGCTTTCAGCAAAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905645027_905645039 25 Left 905645027 1:39619314-39619336 CCCAGATTTTGCTGAAAGCCCTG No data
Right 905645039 1:39619362-39619384 CCTTGGGCTGAGGGCAGTGTAGG No data
905645027_905645029 -9 Left 905645027 1:39619314-39619336 CCCAGATTTTGCTGAAAGCCCTG No data
Right 905645029 1:39619328-39619350 AAAGCCCTGAGCAAAAGCATAGG No data
905645027_905645036 16 Left 905645027 1:39619314-39619336 CCCAGATTTTGCTGAAAGCCCTG No data
Right 905645036 1:39619353-39619375 TGAAATGGCCCTTGGGCTGAGGG No data
905645027_905645033 8 Left 905645027 1:39619314-39619336 CCCAGATTTTGCTGAAAGCCCTG No data
Right 905645033 1:39619345-39619367 CATAGGCTTGAAATGGCCCTTGG No data
905645027_905645035 15 Left 905645027 1:39619314-39619336 CCCAGATTTTGCTGAAAGCCCTG No data
Right 905645035 1:39619352-39619374 TTGAAATGGCCCTTGGGCTGAGG No data
905645027_905645032 1 Left 905645027 1:39619314-39619336 CCCAGATTTTGCTGAAAGCCCTG No data
Right 905645032 1:39619338-39619360 GCAAAAGCATAGGCTTGAAATGG No data
905645027_905645034 9 Left 905645027 1:39619314-39619336 CCCAGATTTTGCTGAAAGCCCTG No data
Right 905645034 1:39619346-39619368 ATAGGCTTGAAATGGCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905645027 Original CRISPR CAGGGCTTTCAGCAAAATCT GGG (reversed) Intergenic
No off target data available for this crispr