ID: 905645997

View in Genome Browser
Species Human (GRCh38)
Location 1:39625615-39625637
Sequence ATTGGGTGCACAGTGCAGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 217}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905645997_905646017 29 Left 905645997 1:39625615-39625637 CCCCTCTGCACTGTGCACCCAAT 0: 1
1: 0
2: 0
3: 23
4: 217
Right 905646017 1:39625667-39625689 GACTGTAAGACGTGGGGGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 146
905645997_905646016 28 Left 905645997 1:39625615-39625637 CCCCTCTGCACTGTGCACCCAAT 0: 1
1: 0
2: 0
3: 23
4: 217
Right 905646016 1:39625666-39625688 CGACTGTAAGACGTGGGGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 83
905645997_905646007 -2 Left 905645997 1:39625615-39625637 CCCCTCTGCACTGTGCACCCAAT 0: 1
1: 0
2: 0
3: 23
4: 217
Right 905646007 1:39625636-39625658 ATGGGGAGGGACCACACGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 112
905645997_905646013 22 Left 905645997 1:39625615-39625637 CCCCTCTGCACTGTGCACCCAAT 0: 1
1: 0
2: 0
3: 23
4: 217
Right 905646013 1:39625660-39625682 GGATGGCGACTGTAAGACGTGGG 0: 1
1: 0
2: 0
3: 2
4: 24
905645997_905646008 1 Left 905645997 1:39625615-39625637 CCCCTCTGCACTGTGCACCCAAT 0: 1
1: 0
2: 0
3: 23
4: 217
Right 905646008 1:39625639-39625661 GGGAGGGACCACACGCCTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 178
905645997_905646009 5 Left 905645997 1:39625615-39625637 CCCCTCTGCACTGTGCACCCAAT 0: 1
1: 0
2: 0
3: 23
4: 217
Right 905646009 1:39625643-39625665 GGGACCACACGCCTGGAGGATGG 0: 1
1: 0
2: 1
3: 8
4: 208
905645997_905646012 21 Left 905645997 1:39625615-39625637 CCCCTCTGCACTGTGCACCCAAT 0: 1
1: 0
2: 0
3: 23
4: 217
Right 905646012 1:39625659-39625681 AGGATGGCGACTGTAAGACGTGG 0: 1
1: 0
2: 0
3: 0
4: 51
905645997_905646014 23 Left 905645997 1:39625615-39625637 CCCCTCTGCACTGTGCACCCAAT 0: 1
1: 0
2: 0
3: 23
4: 217
Right 905646014 1:39625661-39625683 GATGGCGACTGTAAGACGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 37
905645997_905646015 24 Left 905645997 1:39625615-39625637 CCCCTCTGCACTGTGCACCCAAT 0: 1
1: 0
2: 0
3: 23
4: 217
Right 905646015 1:39625662-39625684 ATGGCGACTGTAAGACGTGGGGG 0: 1
1: 0
2: 0
3: 0
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905645997 Original CRISPR ATTGGGTGCACAGTGCAGAG GGG (reversed) Exonic
900404942 1:2488682-2488704 ATTACCTGCACAGTGCAGAATGG - Intronic
901529893 1:9846346-9846368 TTTCAGTGGACAGTGCAGAGCGG + Intergenic
901833740 1:11910117-11910139 ATTTGGTGCACAATGCATTGTGG + Intergenic
904585159 1:31576086-31576108 CTAGGGGGCACAGTGGAGAGGGG + Intergenic
905235289 1:36542268-36542290 ATGGGGTGCACAGTACATATGGG - Intergenic
905645997 1:39625615-39625637 ATTGGGTGCACAGTGCAGAGGGG - Exonic
906403444 1:45522186-45522208 ATTGAGGGCACAGTGCGTAGTGG - Intronic
907962780 1:59298327-59298349 ATTGGGGGAACAGATCAGAGGGG + Intronic
909481002 1:76129043-76129065 ATTGGATGATCAGGGCAGAGAGG - Intronic
910218587 1:84866531-84866553 ATTGTGTTACCAGTGCAGAGTGG - Intronic
915733878 1:158072461-158072483 ATGGGGTGGCCAGTGCAGTGTGG + Intronic
917584290 1:176410147-176410169 ACTGAGTGCAAAGTGAAGAGAGG + Intergenic
917707102 1:177645777-177645799 ATTTTGTGCAAAGTGCAGAAGGG + Intergenic
919660354 1:200237918-200237940 ATTAGGGACACAGTGCACAGTGG - Intergenic
920717397 1:208353183-208353205 ATTGCGTGACCAGTGCAGCGTGG - Intergenic
922852222 1:228742745-228742767 AGCGTGTGCACAGTGCAGATGGG + Intronic
923076998 1:230618629-230618651 ATAGGGTCTGCAGTGCAGAGTGG - Intergenic
923782030 1:237033197-237033219 ATAGTGTGCACAGTGCAGACAGG - Intergenic
1065817150 10:29492532-29492554 ACTGGCTGAACAGTGCGGAGGGG - Intronic
1067042542 10:42962663-42962685 AGAGGGAGCACAGAGCAGAGAGG - Intergenic
1068331927 10:55582174-55582196 ATTGGTTGCACAGTACAGCACGG - Intronic
1071146178 10:82575425-82575447 ATAGGGTGCACAAGGCAGAATGG + Intronic
1071204907 10:83263324-83263346 ATTGAGTGCACAGTGCTCACAGG - Intergenic
1072442711 10:95471140-95471162 ATTGGGGGCACAGTGGTGAATGG - Intronic
1074521234 10:114226141-114226163 ATTGGTTGCACTCTGCAAAGAGG - Exonic
1075343365 10:121664597-121664619 AGTGGGTGCCCAGTGCGGACAGG + Intergenic
1077981836 11:7308765-7308787 ATGGGGTGGAAGGTGCAGAGAGG - Intronic
1080065080 11:28002098-28002120 CTAGGCTGCACAGAGCAGAGGGG - Intergenic
1081457068 11:43234089-43234111 ATGGGGTGCACTGTTTAGAGGGG - Intergenic
1083301384 11:61741190-61741212 CTTGGCTGCAGAGAGCAGAGCGG - Exonic
1083678998 11:64342746-64342768 ATTGGGTCCCGAGGGCAGAGAGG + Intronic
1089613846 11:119684362-119684384 AGTGGCGGCACATTGCAGAGAGG + Intronic
1092049898 12:5461042-5461064 TTTGGGTGGAGTGTGCAGAGTGG + Intronic
1096596981 12:52702036-52702058 AATGGGTTCTCAGGGCAGAGGGG - Intronic
1097747675 12:63317660-63317682 AAGGCGTGCACAGTGCACAGCGG - Intergenic
1098882338 12:75929331-75929353 AATGGGTAGGCAGTGCAGAGAGG - Intergenic
1099390936 12:82078028-82078050 ATTGGGGGTACAGGGCAGTGGGG + Intergenic
1100366578 12:93926779-93926801 ATTGGCTCCACATTGCAGAGAGG + Intergenic
1100796262 12:98185056-98185078 TTAGGGTGCACAGTGGAGAGGGG - Intergenic
1102056132 12:109897959-109897981 GTTGTGTCCCCAGTGCAGAGGGG - Intergenic
1102152347 12:110697462-110697484 ATAGGGTGAACAGCGCAGAGAGG + Intronic
1103899833 12:124297656-124297678 ATTAGCTGCACAGTGAAAAGGGG - Intronic
1104637564 12:130447652-130447674 AGTGGGTGAACTGTGCAGTGAGG + Intronic
1104751317 12:131241251-131241273 AAACGGTGCACAGTGCAGAGTGG - Intergenic
1106276742 13:28216314-28216336 CTTGGGGGCAGAGAGCAGAGAGG + Intronic
1106564709 13:30874204-30874226 ATTGGCTGCACTCTCCAGAGTGG - Intergenic
1108695456 13:52898894-52898916 ATAGGGTGCACATCTCAGAGTGG + Intergenic
1108702245 13:52953552-52953574 ATGGGGTGAAGAGAGCAGAGAGG - Intergenic
1109297181 13:60548274-60548296 ATTGGGTGCTCAGTTTATAGAGG + Intronic
1109513045 13:63404438-63404460 CTAGGCTGCACAGAGCAGAGGGG + Intergenic
1110603920 13:77409354-77409376 AGTGGGTTCAAATTGCAGAGTGG + Intergenic
1113342460 13:109440351-109440373 CTTTGGAGCAGAGTGCAGAGTGG - Intergenic
1113497570 13:110743865-110743887 CTAGGCTGCACAGAGCAGAGGGG + Intergenic
1113582689 13:111440120-111440142 CTTGGGTGCAGAGGGCAGGGAGG + Intergenic
1113957372 13:114106063-114106085 GATGGGTGCACATCGCAGAGCGG + Intronic
1118490262 14:66252077-66252099 ATTGGGAACACATTGCAGGGCGG - Intergenic
1118984598 14:70742624-70742646 CTGGGGTGCTCAGTGCAGAGGGG + Intronic
1119552669 14:75526232-75526254 ACTGGGGGCAGAGTGAAGAGAGG - Intronic
1121242821 14:92442218-92442240 ATTTGGTGCCCAGAGCAGTGGGG + Intronic
1121313831 14:92949540-92949562 TTAGGGTACACAGTGGAGAGTGG - Intronic
1121616254 14:95315636-95315658 CTGGGTTGCACAGTGCAGAAGGG - Intronic
1124349402 15:28944074-28944096 CTTGGCTGCAGAGTGGAGAGTGG - Intronic
1124828684 15:33126433-33126455 GGTGGGTGCAGAGGGCAGAGTGG + Intronic
1124899290 15:33807631-33807653 ATGGTGATCACAGTGCAGAGGGG - Intronic
1125395522 15:39243400-39243422 ATTTGGTGGACAGATCAGAGAGG + Intergenic
1125791582 15:42370609-42370631 ACTGGGGGCATTGTGCAGAGTGG + Intronic
1126326677 15:47485785-47485807 GTTGGGTGCACTGTAGAGAGTGG - Intronic
1130048853 15:80466900-80466922 ATTGGGTTCACAGAGCACTGTGG + Intronic
1135051036 16:19193178-19193200 ATTGGGTGCACCCTGCACACCGG - Intronic
1135919975 16:26641201-26641223 AGTGGGTGCAGTGGGCAGAGTGG - Intergenic
1136048872 16:27636718-27636740 CTGGGGTGCACAGCTCAGAGAGG - Intronic
1137578125 16:49617279-49617301 ACTGGGTGCTCAGGACAGAGGGG + Intronic
1141377496 16:83545478-83545500 ATTGTCTGCACTGTCCAGAGAGG + Intronic
1141808778 16:86359975-86359997 GTTGGGTGCACACTGGGGAGTGG + Intergenic
1141919582 16:87127084-87127106 AGTGGGAGGGCAGTGCAGAGAGG + Intronic
1142982074 17:3678152-3678174 AGGGGGCGCACAGGGCAGAGAGG + Intronic
1144867263 17:18344730-18344752 ATGGGGTCCACAGTGCACAGAGG + Intronic
1145166158 17:20614633-20614655 ATTGGGTGGTCAGTCCAGTGGGG + Intergenic
1145988660 17:29064883-29064905 AATGAGTGCAGAGTGAAGAGTGG + Intergenic
1147563309 17:41521960-41521982 TGTGTGTGCACAGTGCAGGGTGG - Exonic
1149682667 17:58517093-58517115 ACTGGGGGCAGAGTCCAGAGTGG + Intronic
1151739859 17:75973361-75973383 ATGGGGTTTACAGTGCAGCGGGG - Intronic
1153440111 18:5107758-5107780 ATTTGTTGCACAGGGGAGAGAGG - Intergenic
1153907456 18:9675114-9675136 ATTTGGAGCACAGTGAGGAGTGG + Intergenic
1154203689 18:12319004-12319026 ATTGTGTATACAGTGCAGAAAGG + Intronic
1157519152 18:48333591-48333613 ATTTGGAGGACAATGCAGAGGGG - Intronic
1158479599 18:57809100-57809122 AATGGGCTCACAGTGCAGTGAGG - Intergenic
1158637468 18:59173909-59173931 ATAGGGCTCACAGTTCAGAGAGG - Intergenic
1160199636 18:76785931-76785953 CTTCAATGCACAGTGCAGAGTGG + Intergenic
1160947253 19:1649392-1649414 AGGGGGTGCCCAGTGCTGAGCGG - Intronic
1161348880 19:3781619-3781641 ATTGGGAGCACAGATCGGAGAGG - Exonic
1161453166 19:4357780-4357802 ATTGGCTGCTCAGTACAAAGAGG + Intronic
1162109868 19:8394121-8394143 ACTGGGTGCCCGATGCAGAGAGG - Intronic
1162651777 19:12093900-12093922 GTGGGGTACACAGTGCAGTGGGG + Intronic
1162672205 19:12266553-12266575 GTGGGGGACACAGTGCAGAGAGG + Intronic
1165324129 19:35104390-35104412 CTTGGGTGCTATGTGCAGAGTGG + Intergenic
1165719407 19:38068466-38068488 ATTTGGAGCACAGGGCAAAGGGG + Intronic
1165720042 19:38072700-38072722 ATTGGGTGGCCATTGGAGAGGGG + Intronic
1166800260 19:45452377-45452399 ACAGGGTGCACAGTCCAGTGGGG - Intronic
1167436013 19:49479103-49479125 CTGGGATGCACTGTGCAGAGAGG - Intronic
924979746 2:208602-208624 ATTGGGTGCAGATTGCAGACTGG + Intergenic
928071655 2:28223301-28223323 TTGGGGAGCACACTGCAGAGGGG + Intronic
928646943 2:33364677-33364699 ATTAGGTGCACTCAGCAGAGTGG + Intronic
930191330 2:48463191-48463213 GGTGGGTGCACAGTGCAGTCAGG + Intronic
934216823 2:90038770-90038792 ATGGGCTGCTGAGTGCAGAGAGG + Intergenic
935115303 2:100130399-100130421 ATGGGGTGCACTCTTCAGAGCGG - Intronic
935395791 2:102607303-102607325 ATTGAGTGCACAGTATAGACTGG + Intergenic
935424031 2:102900648-102900670 ATTTGGTGCACAGTCCTGGGAGG + Intergenic
936027909 2:109047386-109047408 ACTGAGTGCAGAGTGCACAGAGG - Intergenic
937457539 2:122055348-122055370 ATGGGGTACACAGGGCTGAGGGG + Intergenic
937680419 2:124638298-124638320 ATTGTGTGCATACTGCAGAATGG - Intronic
938264330 2:129915628-129915650 TTTGGGTGGAAAATGCAGAGGGG + Intergenic
939740679 2:145902168-145902190 CTTGGCTGCACACAGCAGAGGGG - Intergenic
940210809 2:151254726-151254748 ATTGGGTGCAGGGAGCAGAATGG + Intronic
940854873 2:158722268-158722290 ATGGGGGCCACAGTGGAGAGAGG + Intergenic
941992393 2:171569890-171569912 ATTGGGTGCAGTGAGCAGAGAGG + Intergenic
942282741 2:174383221-174383243 AGTGGCTGCTCAGTGCTGAGAGG + Intronic
943843094 2:192604469-192604491 AGTGGAAGCACTGTGCAGAGTGG + Intergenic
946734122 2:222737452-222737474 TTTGGGGGCACAGAGGAGAGAGG - Intergenic
946832910 2:223743798-223743820 TTTGGGGGCAGAGTGCAGTGGGG - Intergenic
947578920 2:231299419-231299441 TTTGGGTGAAAAATGCAGAGAGG + Intronic
948379592 2:237542987-237543009 AGTGGGGGCACAGTGGTGAGTGG + Intronic
948379964 2:237544380-237544402 AGTGGGGGCACAGTGGTGAGTGG + Intronic
948380137 2:237545022-237545044 AGTGGGGGCACAGTGGTGAGTGG + Intronic
948885548 2:240881101-240881123 ATTTTGTGCACAGTGTAGAAAGG + Intergenic
948953417 2:241270106-241270128 ACTGGGTGCACAGTGGGGATTGG - Intronic
1169147418 20:3261992-3262014 AATGTGTGCACAGCACAGAGCGG + Intronic
1169334059 20:4740623-4740645 ATTGGGTGCCAGCTGCAGAGAGG - Exonic
1170279962 20:14635023-14635045 ATTGAGTGCAGAGTGCAATGAGG + Intronic
1170420528 20:16187816-16187838 AGTGTGTGGACAGTGCAGTGTGG + Intergenic
1171156040 20:22875391-22875413 GCAGGGTGCACAGTGCAGGGTGG - Intergenic
1174081270 20:47972229-47972251 GTTGGGTGCACAATGGAGATGGG + Intergenic
1174135229 20:48374659-48374681 GTTGGGTGCACAATGGAGAAGGG - Intergenic
1174140252 20:48408141-48408163 TTTGGGTGCACAATGCTGAGAGG - Intergenic
1174294228 20:49533191-49533213 TTTGGGGGCATAGTACAGAGAGG + Intronic
1175308735 20:57996213-57996235 ACTGGAAGCACACTGCAGAGGGG + Intergenic
1175652104 20:60734301-60734323 CCTGGGTGAACAGTGCAGTGCGG + Intergenic
1175804181 20:61818290-61818312 GTTGGGAGGACAGTGCAGAGAGG - Intronic
1175817501 20:61891120-61891142 GTGGGGTGCACAGTGCAGACAGG + Intronic
1179119602 21:38530481-38530503 ATTGGGTGAACTTTACAGAGAGG + Intronic
1179908595 21:44436512-44436534 ATGGGGTGCAGAGTGCAGCCCGG - Intronic
1180281222 22:10698592-10698614 ATTTGGTAGACAGTGAAGAGAGG - Intergenic
1181509042 22:23380696-23380718 ATGGGGTGCGCATTGTAGAGTGG - Intergenic
1181589780 22:23876940-23876962 AGTGGCTGGACAGTGCTGAGTGG + Intronic
1182903412 22:33918035-33918057 AGTTGATGCACAGTGCAGGGAGG - Intronic
1183060713 22:35334841-35334863 ATGCGGTACACAGTGCAGGGAGG - Intronic
1183085040 22:35481477-35481499 AATGAGTGCAAAGTGCAGGGCGG - Intergenic
1183261952 22:36800840-36800862 ATTGGGTGTTCAGGGCAGAGAGG + Exonic
1183520947 22:38295714-38295736 TTGGGGTGCAGAGAGCAGAGTGG - Intronic
1183602783 22:38849836-38849858 ATTGGGAGCCCAGACCAGAGAGG + Intergenic
1184700588 22:46169592-46169614 ATTGAGTGGAAAGTACAGAGAGG - Intronic
950076925 3:10193882-10193904 ACTTGGTGCACAGTCCCGAGAGG - Intronic
950560932 3:13723835-13723857 ATTGAGTGCTCAGTGTATAGGGG + Intergenic
950995751 3:17494441-17494463 AGTGGGTGCACTGTGCTGGGGGG + Intronic
953912522 3:46900130-46900152 TCTGGGTGCTGAGTGCAGAGAGG - Intronic
955415640 3:58688768-58688790 ATGGGTTGCACAGAGCAGAGTGG - Intergenic
955963973 3:64369095-64369117 ATTGTTGGCACAGGGCAGAGGGG - Intronic
956657105 3:71563075-71563097 AGTGGGAGCAAACTGCAGAGGGG + Intronic
957370688 3:79290574-79290596 AGTGGGTCCACAGTAGAGAGAGG - Intronic
957790866 3:84939664-84939686 AGCGTGTGCACAGGGCAGAGAGG + Intergenic
963274148 3:143313837-143313859 ATTGGAAGCACAGAGCAGGGAGG + Intronic
967501561 3:190203878-190203900 CTAGGCTGCACAGAGCAGAGGGG - Intergenic
969006076 4:4021092-4021114 ATTGGGTGAAATGGGCAGAGTGG + Intergenic
969334522 4:6499845-6499867 ATTGGGTGGTCAGTGGAGAAAGG - Intronic
969638774 4:8384584-8384606 ATTGGGTGCACAGGGCGGCTGGG - Intronic
969806872 4:9616198-9616220 ATTGGGTGAAATGGGCAGAGTGG - Intergenic
969968604 4:11022757-11022779 GCTGGATGCACAGGGCAGAGGGG - Intergenic
973564675 4:52172211-52172233 AGTGGGTGCAAAGAGCAGAGCGG + Intergenic
974985540 4:69020930-69020952 ATTGGTTGCCCAGTGCAGGGTGG - Intronic
975005589 4:69279913-69279935 ACTGGTTGCCCAGTGCAGGGCGG + Intergenic
975039390 4:69726154-69726176 ATTGGGTCAAGAGGGCAGAGTGG + Exonic
976452770 4:85210758-85210780 ATTGGGTAGAAAGAGCAGAGAGG - Intergenic
978580913 4:110230320-110230342 ACTGGGTACTCACTGCAGAGGGG + Intergenic
981918392 4:150059723-150059745 ATTGGGTACAGAGTTCAGTGTGG + Intergenic
982855030 4:160371089-160371111 AATGAGTGCCCAGTGAAGAGGGG + Intergenic
984593372 4:181640655-181640677 CTTAGGTGCACAGAGCTGAGTGG - Intergenic
985386309 4:189451753-189451775 AGTAGGTGCACAGTGCAGCCAGG - Intergenic
985720296 5:1485353-1485375 CTTGGGTGCACAGTGCTGGCGGG - Intronic
987537282 5:19205928-19205950 AGTGGGTGCATAGTACAGAGAGG + Intergenic
988555742 5:32234397-32234419 ATTGGGGGCACAGTCCAGGAAGG + Intronic
990374346 5:55154272-55154294 TTTGGGGGGCCAGTGCAGAGGGG + Intronic
990563298 5:57004778-57004800 ATTGGGTACACAGAGGAGAAAGG - Intergenic
1000015218 5:157269740-157269762 ATTGGCTCAACAGTACAGAGAGG - Intronic
1001095406 5:168771961-168771983 ATTGGGGGCACAATGCAGTTTGG + Intronic
1003195180 6:3908146-3908168 CCTGGGAGCACAGTTCAGAGTGG + Intergenic
1007171699 6:39868701-39868723 ATTGGGTGGAGAGAGCAGATGGG + Intronic
1008680703 6:53868839-53868861 ATTTGATGCACAGTGATGAGAGG - Intronic
1012849957 6:104434752-104434774 AATGACAGCACAGTGCAGAGTGG + Intergenic
1013185495 6:107754137-107754159 ATTGGCTGCACAGTGCTAAATGG + Intronic
1013819358 6:114136036-114136058 AGTGGGTGCTCAGTGCATACTGG + Intronic
1014536034 6:122614073-122614095 ATTATGTGCCCAGAGCAGAGTGG + Intronic
1015862450 6:137695133-137695155 ATTTGGTGCACTGAGAAGAGAGG + Intergenic
1017233265 6:152094837-152094859 ATTGGGTGCAGTGTGCAAATAGG + Intronic
1017433899 6:154397736-154397758 ACTAGGTGCACAGTGCAGTGGGG + Exonic
1017433916 6:154397857-154397879 ACTAGGTGCACAGTGCAGTGGGG + Exonic
1017450825 6:154552972-154552994 TTTGGCTGCAGTGTGCAGAGTGG + Intergenic
1017541191 6:155404759-155404781 GCTGGGTGCAGGGTGCAGAGAGG + Intronic
1018703595 6:166447241-166447263 ATTGGGTGGAGACTGCAGCGAGG - Intronic
1020818102 7:12931222-12931244 ATTGGGTGCACAGAGTGGAAAGG + Intergenic
1021311397 7:19102255-19102277 ACTTGGTCCACAGTGCAAAGGGG + Intronic
1023927109 7:44677503-44677525 ATTGGGGACACAGAGCAGGGAGG + Intronic
1024558728 7:50626360-50626382 ATAGGCAGCAAAGTGCAGAGAGG - Intronic
1026169186 7:67938225-67938247 ATTGGGTGGAAAGAGCAGGGAGG - Intergenic
1028239287 7:88399502-88399524 ATGGTGAGCAAAGTGCAGAGGGG + Intergenic
1030413593 7:109212942-109212964 AGTGGGTGCACTGTGCTGTGGGG + Intergenic
1030901168 7:115125643-115125665 AATGGGAGCACAGTGGTGAGAGG - Intergenic
1031984989 7:128158355-128158377 ATTGGCTGCAGTGTGCAGAGTGG - Intergenic
1032527209 7:132587774-132587796 ATGAGGTGTACAGTGCAGAGTGG - Intronic
1034431497 7:151043454-151043476 CTAGGGTGCACAGTGCGGGGTGG + Intronic
1034431515 7:151043532-151043554 CTAGGGTGCACAGTGCGGGGTGG + Intronic
1034431532 7:151043610-151043632 CTAGGGTGCACAGTGCAAGGTGG + Intronic
1034431596 7:151043842-151043864 GGAGGGTGCACAGTGCTGAGAGG + Intronic
1034947115 7:155269468-155269490 CTTGGTTGCATTGTGCAGAGTGG + Intergenic
1037958276 8:23075656-23075678 ATTGTTTGCCCAATGCAGAGTGG + Intergenic
1038351957 8:26784327-26784349 ATTGGGTGAGCATTTCAGAGGGG - Intronic
1038714093 8:29976145-29976167 ATAGGGTGCAAGGTGCAAAGTGG - Intergenic
1039124690 8:34188157-34188179 AGTGGGGGCAAAGAGCAGAGAGG + Intergenic
1039891292 8:41687492-41687514 ATTGGTTGGAGAGTGCAGGGTGG - Intronic
1040573804 8:48633354-48633376 GTGGGGGACACAGTGCAGAGAGG + Intergenic
1040575514 8:48647978-48648000 GCTGGGTGCAGAGAGCAGAGAGG + Intergenic
1040835786 8:51730223-51730245 ATTGAGTGGACAGTACAGAGAGG - Intronic
1041605766 8:59780853-59780875 ATTGGGGGCACTGTGTAGGGAGG - Intergenic
1043682884 8:83052876-83052898 ATTGGAGGCACGGTGCAGAACGG - Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1044735801 8:95276765-95276787 ATTGGGTTCACCTTGCAGATGGG - Intergenic
1046616026 8:116478279-116478301 ATTTGGGCCACAGGGCAGAGAGG + Intergenic
1046665299 8:116995629-116995651 ATTGGGGGCACAGTAGGGAGGGG + Intronic
1049247802 8:141571974-141571996 ATTGGGACCACATGGCAGAGGGG + Intergenic
1049775153 8:144400630-144400652 AGGGGGCCCACAGTGCAGAGGGG + Intronic
1056629440 9:88281160-88281182 ACTGGGGGCACAGTGCTCAGCGG - Intergenic
1057171359 9:92965131-92965153 ATTGTGCCCACTGTGCAGAGGGG + Intronic
1059085538 9:111298404-111298426 ATTTGGTGCCTAGTGGAGAGTGG + Intergenic
1061499902 9:130995832-130995854 GTTGGGGGCACAGCGCAGAGGGG - Intergenic
1185888687 X:3805115-3805137 AATACGTGCACATTGCAGAGTGG + Intergenic
1187756830 X:22537309-22537331 ATTTTCTACACAGTGCAGAGAGG - Intergenic
1189652737 X:43207985-43208007 TTTGCCTGCACAGAGCAGAGGGG - Intergenic
1190984048 X:55484672-55484694 CTTAGATGCTCAGTGCAGAGGGG + Exonic
1193014338 X:76715458-76715480 ATTCAGTGGACAGTGCAGTGGGG - Intergenic
1193143553 X:78054587-78054609 TTTGCATGCACAGTGCAGTGAGG + Intergenic
1193600911 X:83508043-83508065 ATTGGCTGCCTAGCGCAGAGTGG - Intergenic
1195646794 X:107240270-107240292 ATTAAATGCGCAGTGCAGAGAGG + Intronic