ID: 905650419

View in Genome Browser
Species Human (GRCh38)
Location 1:39652806-39652828
Sequence TACTTCCCAATTAAGGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905650416_905650419 -10 Left 905650416 1:39652793-39652815 CCCATCAGGGAGATACTTCCCAA No data
Right 905650419 1:39652806-39652828 TACTTCCCAATTAAGGTCAATGG No data
905650412_905650419 11 Left 905650412 1:39652772-39652794 CCAAAGGCCTCTAGGGGATGGCC No data
Right 905650419 1:39652806-39652828 TACTTCCCAATTAAGGTCAATGG No data
905650413_905650419 4 Left 905650413 1:39652779-39652801 CCTCTAGGGGATGGCCCATCAGG No data
Right 905650419 1:39652806-39652828 TACTTCCCAATTAAGGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905650419 Original CRISPR TACTTCCCAATTAAGGTCAA TGG Intergenic
No off target data available for this crispr