ID: 905650817

View in Genome Browser
Species Human (GRCh38)
Location 1:39655683-39655705
Sequence CTGGCCATGCTGGTTTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905650817_905650824 4 Left 905650817 1:39655683-39655705 CCTCCCTAAACCAGCATGGCCAG No data
Right 905650824 1:39655710-39655732 CCACAAAACAGAGTAGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905650817 Original CRISPR CTGGCCATGCTGGTTTAGGG AGG (reversed) Intergenic
No off target data available for this crispr