ID: 905651180

View in Genome Browser
Species Human (GRCh38)
Location 1:39658032-39658054
Sequence GTGGGGAACGGGACAGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 442}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905651180_905651189 13 Left 905651180 1:39658032-39658054 CCATGCTCTGTCCCGTTCCCCAC 0: 1
1: 0
2: 1
3: 43
4: 442
Right 905651189 1:39658068-39658090 CAACAGGATGCAATAACTGGAGG 0: 1
1: 0
2: 0
3: 11
4: 112
905651180_905651193 27 Left 905651180 1:39658032-39658054 CCATGCTCTGTCCCGTTCCCCAC 0: 1
1: 0
2: 1
3: 43
4: 442
Right 905651193 1:39658082-39658104 AACTGGAGGAATGAGGGTGGTGG 0: 1
1: 0
2: 1
3: 42
4: 461
905651180_905651186 -3 Left 905651180 1:39658032-39658054 CCATGCTCTGTCCCGTTCCCCAC 0: 1
1: 0
2: 1
3: 43
4: 442
Right 905651186 1:39658052-39658074 CACCAGCAGAGCTGCTCAACAGG 0: 1
1: 0
2: 1
3: 19
4: 170
905651180_905651190 20 Left 905651180 1:39658032-39658054 CCATGCTCTGTCCCGTTCCCCAC 0: 1
1: 0
2: 1
3: 43
4: 442
Right 905651190 1:39658075-39658097 ATGCAATAACTGGAGGAATGAGG 0: 1
1: 0
2: 1
3: 22
4: 186
905651180_905651188 10 Left 905651180 1:39658032-39658054 CCATGCTCTGTCCCGTTCCCCAC 0: 1
1: 0
2: 1
3: 43
4: 442
Right 905651188 1:39658065-39658087 GCTCAACAGGATGCAATAACTGG 0: 1
1: 0
2: 2
3: 8
4: 86
905651180_905651192 24 Left 905651180 1:39658032-39658054 CCATGCTCTGTCCCGTTCCCCAC 0: 1
1: 0
2: 1
3: 43
4: 442
Right 905651192 1:39658079-39658101 AATAACTGGAGGAATGAGGGTGG 0: 1
1: 1
2: 0
3: 40
4: 378
905651180_905651191 21 Left 905651180 1:39658032-39658054 CCATGCTCTGTCCCGTTCCCCAC 0: 1
1: 0
2: 1
3: 43
4: 442
Right 905651191 1:39658076-39658098 TGCAATAACTGGAGGAATGAGGG 0: 1
1: 0
2: 1
3: 13
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905651180 Original CRISPR GTGGGGAACGGGACAGAGCA TGG (reversed) Intergenic
900130177 1:1084087-1084109 CTCGGGAACAGGAAAGAGCATGG + Intronic
900192188 1:1356338-1356360 GTGGGGAAGGGGACTCAGTAGGG + Intronic
900368705 1:2322061-2322083 GTGGGGAAGGGGCCAGGGCGGGG - Intronic
900993939 1:6110211-6110233 GTGGGGCCAGGGCCAGAGCAAGG + Intronic
901762723 1:11481013-11481035 CTGGGGGAGGGAACAGAGCAGGG - Intronic
902447948 1:16478909-16478931 GTGGGGAACGTGGCAGCTCACGG - Intergenic
902506730 1:16943593-16943615 GTGGGGAACGTGGCAGCTCATGG + Intronic
902515963 1:16989826-16989848 GTGAGGAAGGAGACAGAGCAGGG + Intronic
903011070 1:20330786-20330808 ATGCAGAAAGGGACAGAGCATGG - Intronic
903189268 1:21647708-21647730 CTGGGGTAGGGGAAAGAGCATGG - Intronic
904355605 1:29936990-29937012 GTGGGGTTGGGGAAAGAGCACGG + Intergenic
904368487 1:30033779-30033801 GTGGGGAATAAGACAGAGGAGGG + Intergenic
904746872 1:32716779-32716801 CTGGGGGAGGGGACAGGGCAGGG - Intergenic
904832595 1:33314665-33314687 GTGGGGCACGGGGAAGAGCAGGG - Intronic
904899263 1:33843674-33843696 GCAGGGAGCAGGACAGAGCAGGG + Intronic
905554666 1:38872950-38872972 CTGGGGAACGGGGCAGCGCCGGG + Intronic
905647034 1:39632259-39632281 GTGGGGGAGGGGACAGAAGAAGG - Intronic
905651180 1:39658032-39658054 GTGGGGAACGGGACAGAGCATGG - Intergenic
906299569 1:44672316-44672338 GGTGGGAACGATACAGAGCAAGG - Intronic
906794636 1:48687322-48687344 GTGAGGCTTGGGACAGAGCAGGG + Intronic
907313593 1:53553810-53553832 GTGGGAAAAGAGACAGAGCAAGG + Intronic
907335674 1:53697941-53697963 ATTGGGATGGGGACAGAGCAGGG + Intronic
907917507 1:58884531-58884553 GTGAAGAAAGGGGCAGAGCAAGG + Intergenic
910105939 1:83631232-83631254 GTGGAGAAGGGGCCAGAGGAAGG - Intergenic
912714867 1:111975969-111975991 GTGGGGGCCTGGGCAGAGCAAGG - Intronic
913206651 1:116545185-116545207 GTGGGGAACAAGACAGACAAAGG + Intronic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
915345145 1:155193436-155193458 GTGTGGAACGGGACAGGGAGCGG - Intergenic
915365348 1:155312169-155312191 GTTGGAAATGGGAGAGAGCAAGG + Intronic
915595441 1:156894007-156894029 GAGGGGAAGGGGACAGTGGAGGG + Intronic
915981098 1:160420364-160420386 GTGGGAGAAGGGACAGACCAAGG - Intronic
917405041 1:174696686-174696708 CTTGGGAAAGGGAGAGAGCAGGG - Intronic
917455210 1:175180157-175180179 ATGGTGAAGGGCACAGAGCAGGG - Intronic
917834669 1:178931942-178931964 GTGGGGTTCGGGACAGAGGCGGG - Intergenic
919134805 1:193494250-193494272 GTGGGGAAGGGTACAAGGCAGGG + Intergenic
919669287 1:200324242-200324264 GTGTGGGAAGGGACTGAGCATGG + Intergenic
920730978 1:208484128-208484150 GTAGGGAAGGGGAGAGAGAAAGG + Intergenic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
921377454 1:214489347-214489369 GTGGGCAAGGGGAGAGGGCATGG - Intronic
922223631 1:223627216-223627238 TTGGGGACCGGGACAGTGCTAGG + Intronic
923336112 1:232971611-232971633 GTGGTGAACGAGACTGACCAAGG + Intronic
923362070 1:233221633-233221655 ATGGGGAAGAGAACAGAGCAAGG + Intronic
923630824 1:235648937-235648959 GTGGGGAGGAGGACAGAGCGTGG - Intronic
923863188 1:237913162-237913184 GTGGGGAAAATGGCAGAGCAAGG - Intergenic
924009054 1:239644356-239644378 TGGGGGAACAGGACAGAGCCAGG - Intronic
924092944 1:240521115-240521137 ATAGGGAATGGAACAGAGCAAGG - Intronic
924453612 1:244200420-244200442 GAGGGAAAGGGGACAGAGCTGGG + Intergenic
924636590 1:245793629-245793651 GGGGGGCACTGGGCAGAGCAGGG - Intronic
1064020550 10:11805329-11805351 ATGGAGAATGGGAGAGAGCATGG - Intergenic
1064314262 10:14240153-14240175 GAGGGGAAGGGAAGAGAGCATGG - Intronic
1064754274 10:18560409-18560431 GTGGGCAACGGAACAGAAAATGG + Intronic
1065363977 10:24917016-24917038 AAGGGGAAGGGGACAGAGCCTGG - Intronic
1066051254 10:31637816-31637838 GTGGGGAACGTCACACACCAGGG - Intergenic
1067067251 10:43111002-43111024 GAGTGGAACGGGGCAGGGCAGGG + Intronic
1067922378 10:50472911-50472933 GTGGGGAGCAGGATAGAGGAAGG - Intronic
1068197144 10:53731653-53731675 GTGGGGAACATCACACAGCAGGG + Intergenic
1069601216 10:69709444-69709466 GTGGGGAAGGGCACAGAGCCAGG + Intergenic
1070786087 10:79162952-79162974 CTGGGGCACGGGACAGAGCTGGG - Intronic
1070787625 10:79171147-79171169 GTGGAAAACGGGAGGGAGCAGGG - Intronic
1072332185 10:94364569-94364591 GTGTGGAAGGAGACAGAGCAAGG - Intergenic
1072733472 10:97863907-97863929 CTGGAGAAAGGGACAGAGCCAGG - Intronic
1073051370 10:100669519-100669541 GTGGGGAACCGCCCAGGGCAGGG - Intergenic
1074987790 10:118672837-118672859 GTGGGGAAAGGGACCCAACAGGG - Intergenic
1075222999 10:120600806-120600828 GTGGGCACCAGCACAGAGCAGGG - Intergenic
1075303650 10:121348399-121348421 GTGGGGACAGGAACACAGCATGG - Intergenic
1075513760 10:123093453-123093475 GTGGGGAGGGGGACCGAGAAGGG + Intergenic
1075638068 10:124043902-124043924 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638071 10:124043920-124043942 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638074 10:124043938-124043960 CAGGGGAACAGCACAGAGCAGGG + Intronic
1075638091 10:124044077-124044099 GCAGGGAGCGGCACAGAGCAGGG + Intronic
1075638110 10:124044200-124044222 GCTGGGAGCGGCACAGAGCAGGG + Intronic
1077503136 11:2918165-2918187 GTGGGGCACAGGCCAGAGGAAGG - Intronic
1078190325 11:9088843-9088865 GTGGGGTTGGGGACAGAGCTAGG + Intronic
1078659706 11:13277404-13277426 GAGGGGAAAGGGAGAGGGCAGGG + Intronic
1079102017 11:17547699-17547721 GTGGGGAACTAGAGAGAGCTGGG + Intronic
1079828423 11:25229817-25229839 GTGGGGAACATGACACACCAGGG - Intergenic
1080054984 11:27897622-27897644 GTGGGGAAGGGTTCAGACCATGG + Intergenic
1080928745 11:36785226-36785248 CTGGGGAAGGGGATAGAACAGGG + Intergenic
1081207583 11:40293326-40293348 GTGGGGGCGGGGACAGAGGAAGG - Exonic
1081613226 11:44575924-44575946 GTGGGGAACGTGACAGCGCCAGG - Intronic
1081870888 11:46382009-46382031 GTGGGGAAGGGGACGGGCCAGGG + Intronic
1083664983 11:64269401-64269423 GCGGGGACCCGGACAGAGCGGGG - Intergenic
1083738013 11:64692747-64692769 GAGGGGAAGGGGACAGGGGAAGG + Intronic
1083750673 11:64759086-64759108 AAGGGGAACTGGACAGTGCAAGG - Intronic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1085083719 11:73653024-73653046 GTGGGGAAAGGGGGAGAGAACGG - Intronic
1085760794 11:79239539-79239561 ATGGTGCACTGGACAGAGCATGG - Intronic
1086797636 11:91127855-91127877 GTGGGGAACGTCACACACCAGGG + Intergenic
1087508650 11:99061323-99061345 GTGGGGAGAGGGACAGAGAGGGG + Intronic
1087610589 11:100429630-100429652 GTGGGGAGTGGGACATAGAAAGG + Intergenic
1087614477 11:100472141-100472163 CTGGAGCCCGGGACAGAGCAAGG + Intergenic
1090407968 11:126488759-126488781 GTGGGGAACAGGTAGGAGCAGGG - Intronic
1090493856 11:127190908-127190930 GGGGGTAGCGGCACAGAGCACGG + Intergenic
1091368075 11:135038407-135038429 GTGGGGTAGGACACAGAGCAGGG - Intergenic
1091831067 12:3551516-3551538 GTGGGGGACAGGGCTGAGCATGG + Intronic
1093092466 12:14937080-14937102 ATGGGGAAGGGGCAAGAGCATGG - Intronic
1094179443 12:27576333-27576355 GTGGGGATCGGGACAGGGCCTGG + Intronic
1094691315 12:32772067-32772089 GAGGGGAAAGGGAAAGAGAAAGG + Intergenic
1094799454 12:34016318-34016340 TTGGGGAATGAGACAAAGCATGG - Intergenic
1095112241 12:38310590-38310612 TTGAGGAATGGGACAAAGCATGG - Intergenic
1095705877 12:45236402-45236424 GTGGGGAACAGCACACACCAGGG - Intronic
1095824528 12:46517158-46517180 CTGGGGAACAGCACAGAGCCAGG - Intergenic
1095918351 12:47503510-47503532 GAGGGGAATGGCACACAGCAGGG + Intergenic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1096105519 12:48995106-48995128 GTGGGGAAAGGGTCAGTGAAAGG + Intergenic
1096235515 12:49923586-49923608 TTGGGGAAGGGGTCAGGGCAGGG - Intergenic
1096492605 12:52020955-52020977 GTGGAGAGGGGCACAGAGCAGGG + Intergenic
1096967434 12:55639364-55639386 GTGGGGAAGGGGACATAGGGAGG + Intergenic
1098150885 12:67545121-67545143 GTGGGAAAGGGGACAGAGAAGGG + Intergenic
1098205517 12:68105243-68105265 CTGGGTAACAGGACAGAGAAGGG - Intergenic
1101645426 12:106627006-106627028 AGAGGGAACGGGACACAGCATGG - Intronic
1101686685 12:107030777-107030799 GTGGGGAAGGGGGCAGGGGAAGG + Intronic
1101738932 12:107484659-107484681 GTGGGGCAAGGACCAGAGCAGGG + Intronic
1101747888 12:107558001-107558023 GCTGGGAATGGGACAGATCAGGG + Intronic
1102463282 12:113113415-113113437 GTAGGGACCTGGACAGGGCAGGG - Intronic
1102774490 12:115506861-115506883 CAGGGGCACGGGACAGAGAAGGG - Intergenic
1102996426 12:117354806-117354828 GTGGGGACTGGCACAGAGCTGGG + Intronic
1103611974 12:122129563-122129585 GTGGGCAAAGGGACAGGACACGG - Intronic
1104149412 12:126068061-126068083 GTTGGGAACAGGGCAAAGCAGGG + Intergenic
1104757673 12:131279221-131279243 GGGTGGAAGGGGACAGAGCTCGG - Intergenic
1105641407 13:22268845-22268867 GTGGGGAGCCAGACTGAGCAGGG + Intergenic
1106346775 13:28886976-28886998 GTGGTGCAAGGTACAGAGCAAGG + Intronic
1106609151 13:31262052-31262074 GTGGGGAAGGAGACAAAGCATGG + Intronic
1106770036 13:32952912-32952934 GTGGGGAGGGGGACACAGCTTGG + Intergenic
1107249491 13:38341331-38341353 GTGGGGAGCGGGGTAGGGCAGGG + Intergenic
1107802003 13:44117055-44117077 GTGGGGATTGGGAAAGAGGATGG + Intergenic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1111566434 13:90023050-90023072 GTGGGGAACATCACAGACCAGGG - Intergenic
1112339279 13:98538980-98539002 GTGGGGAGGGGGACACAGAAAGG + Intronic
1112609954 13:100946284-100946306 GTGGGGAACTGGATGGAGCAAGG - Intergenic
1113333572 13:109356055-109356077 GCGGGGCACGGGAGAGCGCACGG + Intergenic
1113419026 13:110155454-110155476 GTAGGTAACGGGGCAGTGCATGG - Intronic
1114857461 14:26466430-26466452 GTGGGGAACTGGACATAGTCTGG + Intronic
1117027047 14:51631543-51631565 GTGGTAAAAGGGACAGAGAATGG + Intronic
1117069442 14:52043474-52043496 GGGGAGAAGGGGACAGAGGAGGG + Intronic
1118812073 14:69282479-69282501 GTGGGGAAGGCAACAAAGCAAGG - Intronic
1119424452 14:74526741-74526763 GAGGGGCAGGGGACAGAGTAGGG + Intronic
1119837249 14:77761432-77761454 TCGGGGAACGGGACTGAGTAAGG - Intronic
1120559095 14:85969205-85969227 GTGGGGAACGTCACACATCAGGG - Intergenic
1120708079 14:87765284-87765306 GTGGGGAGAGGGACAGAGGGAGG + Intergenic
1121310593 14:92933231-92933253 GAGGGTAACGGGGCAGGGCAGGG + Intronic
1122396678 14:101437721-101437743 GTGTGTAAGGGGACAGGGCAGGG - Intergenic
1122441738 14:101736797-101736819 GTGGGAGAGAGGACAGAGCAGGG + Intergenic
1122607123 14:102954229-102954251 GTGGGCAACGGCACAGCGGATGG + Exonic
1124208156 15:27740805-27740827 GTAGGGACAGAGACAGAGCAGGG - Intergenic
1124635450 15:31361866-31361888 GTAGGGAAAGGGACACAGTATGG - Intronic
1125010225 15:34864278-34864300 GTGTGTGAAGGGACAGAGCAGGG + Intronic
1125046608 15:35248472-35248494 GTGGAGAATGGGACCCAGCAAGG - Intronic
1127121639 15:55777054-55777076 GTGGGGAAGGGGAGAGAGGGAGG + Intergenic
1127849721 15:62902058-62902080 GAGGGCAGTGGGACAGAGCAGGG + Intergenic
1128419972 15:67482771-67482793 GTGGGAAACGGGCCTGAGTAGGG + Intronic
1128797988 15:70478818-70478840 CTGGAGAACGGGACAGAGGAGGG + Intergenic
1128940286 15:71782368-71782390 GTGGGGAAGGGGTCAAGGCAGGG - Exonic
1129025235 15:72565786-72565808 ATGGGGAATGGGAAGGAGCAGGG - Intronic
1129189653 15:73929963-73929985 GAGGGGAATGGGACAGGGCAAGG + Intronic
1130625376 15:85508594-85508616 GCGGAGAACAGGACAGAGCAAGG - Intronic
1130973319 15:88752798-88752820 GTGGGGACTGGTAGAGAGCAGGG - Intergenic
1131070342 15:89461810-89461832 GTGGGGTGGGGGACAAAGCAGGG + Intergenic
1132500556 16:282932-282954 GGGGGTCCCGGGACAGAGCAGGG - Exonic
1132537647 16:491037-491059 GAGGGGAACAGGACAGGACATGG - Intronic
1133029060 16:3001119-3001141 GGGGGGAGAGGGACAGAGTATGG - Intergenic
1134257111 16:12621682-12621704 GTGAGGAAGGGGGGAGAGCATGG - Intergenic
1136145063 16:28311758-28311780 GTGGGGTAGTGGTCAGAGCATGG + Intronic
1136234574 16:28905792-28905814 GTGGGGAAAGGGAGAGGGCATGG - Intronic
1137549189 16:49425266-49425288 GTGGGGAAGGGGACAGTGGCTGG - Intergenic
1138344141 16:56309510-56309532 GTGGGGACAAGGACAGAGAAGGG + Intronic
1138479124 16:57290175-57290197 GTGGGGATAAGGTCAGAGCAGGG - Intergenic
1138489854 16:57370484-57370506 ATAGGGTACGGGACAGAGCCTGG - Intergenic
1138750740 16:59417136-59417158 GTGTGGATAGGGACAGAGAATGG - Intergenic
1139544935 16:67645634-67645656 ATGGGGCAGGGGACAGAGCCGGG + Intronic
1140041137 16:71409002-71409024 GGGGGCAAGGTGACAGAGCAGGG + Intergenic
1141059667 16:80854183-80854205 GTGGGGAACAGGACAAAGAGCGG - Intergenic
1141100811 16:81196310-81196332 AAAGGGAACGGGACAGGGCAGGG - Intergenic
1141219023 16:82051907-82051929 GTGGGGTCTGGGAGAGAGCAGGG - Intronic
1141254289 16:82386410-82386432 GTGGGGAGAGGGACAGGGTAAGG - Intergenic
1141916604 16:87101825-87101847 GTGGGGGGTGGGAGAGAGCAGGG - Intronic
1141943982 16:87297401-87297423 GTGGGGCTTGGGACAGGGCATGG + Intronic
1142153067 16:88521188-88521210 GTGGGAAACAGCACAGAGGAGGG - Intronic
1142352170 16:89585554-89585576 GTGGGGGACGGGATGGACCAAGG + Intronic
1142412760 16:89924566-89924588 GAGGGGAAGGGGCCAGAGAAAGG + Intronic
1143447948 17:7019845-7019867 ATTGGCATCGGGACAGAGCAGGG - Intergenic
1143965814 17:10755929-10755951 GGGGGGAGGGGGACAGAGAAAGG - Intergenic
1144443794 17:15308171-15308193 ATGGGGAACGCGACAGAAAAGGG - Intronic
1145242902 17:21250037-21250059 GTGGGGACCAGGACAGAGCAGGG - Intronic
1145251536 17:21299358-21299380 GGGAGGAACGGGGCATAGCACGG - Intronic
1145990813 17:29078408-29078430 ATGGGGGAAGTGACAGAGCAGGG + Exonic
1146375134 17:32288753-32288775 GTGGGGAGAGGGTCAGAGCTGGG - Intronic
1146696004 17:34909578-34909600 GTGGGGAGCAGGACAGACCCCGG - Intergenic
1146957841 17:36947143-36947165 GTAGGGACCAGGACAGAGAAGGG + Intergenic
1147160803 17:38568474-38568496 GTGGGAAAAGGCACAGAGGATGG + Intronic
1147862918 17:43533991-43534013 GGGGTGGAGGGGACAGAGCAAGG + Intronic
1147968532 17:44207144-44207166 GGGGGGCAAGGGACAGAACATGG + Exonic
1148041308 17:44709367-44709389 GTGGGTAACAGGACAGAACTAGG + Intronic
1148073382 17:44921573-44921595 GTGGGGAACAGAGCAGATCAGGG - Intergenic
1148558031 17:48590197-48590219 GTGGGGAAGGGGGCAGAGGTAGG - Intronic
1148756718 17:49976892-49976914 GTGGGGGATGGGAAAAAGCAAGG - Intergenic
1148873879 17:50675286-50675308 GTGGGGAATGGGAGATACCAGGG + Intronic
1149444559 17:56703624-56703646 GTTGGGATGGGGACAGAACATGG + Intergenic
1150603038 17:66667115-66667137 GTGGGGGAAGGGACTGGGCAGGG - Intronic
1150656836 17:67044899-67044921 GTGGGGATCGGGACGGAGGGTGG - Intronic
1150790145 17:68196555-68196577 GTGGGGAAGGGGACAGGGTGGGG + Intergenic
1151397788 17:73835855-73835877 GTGGGGGACTGGACAGAGAAGGG + Intergenic
1151604010 17:75124916-75124938 CTGGTGGAAGGGACAGAGCAAGG + Intronic
1151620500 17:75242050-75242072 GTAAGGAAAGGGAGAGAGCAGGG + Intronic
1151765584 17:76131829-76131851 GTGGGGATGGGGACAGGGCTTGG + Intergenic
1152288579 17:79426006-79426028 GTGTGGAGGGGGAGAGAGCAAGG + Intronic
1152431718 17:80251988-80252010 CGGGGGATCAGGACAGAGCAGGG + Intronic
1156709101 18:39920134-39920156 GTGGGGAACGTCACACACCAGGG - Intergenic
1157210004 18:45734249-45734271 GTGGGGCAAGAGACACAGCACGG - Intronic
1157864184 18:51166745-51166767 GAGGGGAAGGGGGCTGAGCAGGG - Intergenic
1160050244 18:75426704-75426726 GTGGGGATCAAGACAGAGGAAGG + Intronic
1160738165 19:674195-674217 GTGGGGAGAGGGGCAGAGCCGGG + Intergenic
1161309014 19:3583699-3583721 CTGGGCATGGGGACAGAGCAGGG + Intergenic
1162073892 19:8171793-8171815 GTGGGGGAAGCCACAGAGCACGG + Intronic
1162909927 19:13843065-13843087 TTGGGGGACGGGACAGAGTTGGG - Intergenic
1162997365 19:14344728-14344750 GGTGGGAAGGGGACAGGGCAGGG - Intergenic
1162998222 19:14349944-14349966 GTGGGTAGGGGGACAGTGCATGG - Intergenic
1163067833 19:14812463-14812485 GAGTGGAACAGAACAGAGCAGGG - Intronic
1163293123 19:16393786-16393808 GAAGGGAACGGGACCGAGAATGG + Intronic
1163549412 19:17957235-17957257 GTGGGGAAGGGGAAAGGGAAAGG + Intronic
1163939049 19:20476266-20476288 ATGAGGACAGGGACAGAGCATGG + Intergenic
1164912869 19:32026649-32026671 ATGGGCAACAGGAAAGAGCAAGG - Intergenic
1165141582 19:33703173-33703195 TGGGGGAAGGGGACAGAGCCGGG - Intronic
1165324944 19:35109054-35109076 GTGGGGCAGGGACCAGAGCAGGG + Intergenic
1166279900 19:41784963-41784985 GTAGGGAACAGGAAGGAGCAGGG + Intergenic
1166325399 19:42047176-42047198 CTGGGGAAGGGGGCTGAGCATGG - Intronic
1166383787 19:42369404-42369426 GATAGCAACGGGACAGAGCAGGG + Intronic
1166412853 19:42568241-42568263 GTAGGGAACAGGAAGGAGCAGGG - Intergenic
1167868781 19:52350285-52350307 GTGGGAAACTGCACAGGGCAGGG - Intronic
1168050185 19:53824059-53824081 CTGGGGACCGCGACAGAGCTGGG - Exonic
1168271229 19:55250854-55250876 GTGGGGAGAGGGAACGAGCAGGG - Intronic
1168530480 19:57124371-57124393 GTGGGGAGAGAGACAGAGAAAGG - Intronic
925174344 2:1771714-1771736 GTAGGGAAAGGGAAAGAGGAAGG + Intergenic
925488003 2:4357764-4357786 ATGGGGAGCAGGAAAGAGCAAGG - Intergenic
926083170 2:10004969-10004991 GTGGGGAGTGGGACAGACTAAGG - Intergenic
926258572 2:11234230-11234252 ATGGGGAACGGGATAGAATATGG - Intronic
927207500 2:20619380-20619402 GAGTGGAATGGGGCAGAGCAGGG - Intronic
927356286 2:22177412-22177434 GTAGGGCAGGGGACAGAGAAGGG + Intergenic
927478576 2:23432955-23432977 GTGGGGGAAGGCACAGAGAAAGG + Intronic
929552479 2:42903429-42903451 GTGGGGCACTGGCCTGAGCAGGG - Intergenic
929979446 2:46664953-46664975 GGGGGGAAGGTGAAAGAGCAGGG + Intergenic
931648183 2:64444379-64444401 GTGGGGAGCAGGAGAGAGCATGG + Intergenic
931706578 2:64951472-64951494 GTGGGGGAGGGGACAGAGGTAGG - Intergenic
931981692 2:67699959-67699981 GTGGGAAAAGGGAGAGAACATGG - Intergenic
932771308 2:74502299-74502321 GTGGGGAACGGGGTCGAGCGGGG - Intronic
934097562 2:88620664-88620686 GTGAGCAAGGGCACAGAGCAGGG - Intronic
934736096 2:96690608-96690630 GTTGGGATCGGGAGAGACCAGGG + Intergenic
934990246 2:98915396-98915418 GTGGGGCAAGGCACAGGGCAGGG + Intronic
935116750 2:100143594-100143616 GTGGGGTAGAGGACAGAGCAGGG - Intergenic
936795920 2:116204143-116204165 GTGGGGCACTGGACAGGGAAGGG + Intergenic
937215219 2:120308452-120308474 GTGGGGAAGGCCACAGCGCAGGG - Intergenic
937361832 2:121235044-121235066 GAGGGGCACGGGCCACAGCAGGG - Intronic
938173178 2:129101053-129101075 GAGGGAAACAGGGCAGAGCAGGG - Intergenic
941225117 2:162838766-162838788 GTGGGGAACGGGAAGGAGGCGGG + Intergenic
941348214 2:164396856-164396878 GTGGGGAAAGGGACAGATCTTGG - Intergenic
942069024 2:172298652-172298674 GTGGAGAATGGGAGAGAGGAAGG + Intergenic
942608328 2:177714979-177715001 GTGGGGAACCAGACACAGGAGGG - Intronic
943358141 2:186884283-186884305 GTGGGGATGGGGAGAGGGCAAGG + Intergenic
945361480 2:208900376-208900398 GTGGGAAAGGGGTCGGAGCATGG - Intergenic
946506942 2:220311961-220311983 GTGGAGGACTGGACAGAGGACGG - Intergenic
947224134 2:227823930-227823952 TTGGGAAAAGGGACAGAGGATGG + Intergenic
947401132 2:229732558-229732580 ATGGGGAACTGGAAAGAGGATGG - Intergenic
947421014 2:229941633-229941655 GTGGGGAAGGGGAGATAGGAGGG + Intronic
947634565 2:231673464-231673486 GTGGGGAAGGGGAGGGAGCAGGG - Intergenic
948641595 2:239378903-239378925 CTGGGGAACTAGACAGAGCTTGG - Intronic
948880212 2:240852945-240852967 GCAGGGCACGGGGCAGAGCATGG + Intergenic
1171239369 20:23552419-23552441 GTGGGGCTCTGGAGAGAGCACGG - Intergenic
1172111298 20:32546776-32546798 GTGGGACACAGGAGAGAGCATGG + Intronic
1172409462 20:34710662-34710684 GTGGGGAATGAGCCAGATCAGGG - Exonic
1172428871 20:34874356-34874378 GTGGGGAAAGGCACAGACAATGG - Intronic
1172455739 20:35071452-35071474 GTGGGGAACGTCACACACCAGGG - Intronic
1172483916 20:35287380-35287402 CTGGGAACCGGGACAGAGCTGGG + Exonic
1173029623 20:39342723-39342745 GAGGGGCAGGGGAGAGAGCAGGG + Intergenic
1173476832 20:43365572-43365594 GTGGAGAAAGGGACAGAGCCTGG - Intergenic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1175147821 20:56910169-56910191 GTGGGGAAGGGGACAGAAATAGG - Intergenic
1175487384 20:59355720-59355742 GGGGGGAGAGGGACAGAGGAGGG - Intergenic
1176512798 21:7761434-7761456 GTGGGGCCTGGCACAGAGCAGGG - Intronic
1178037816 21:28604232-28604254 GTGGGGAACGTCACACACCAGGG + Intergenic
1178340506 21:31782133-31782155 GTGGGGTAGAGGACAGAGCATGG - Intergenic
1178646911 21:34391958-34391980 GTGGGGCCTGGCACAGAGCAGGG - Intronic
1179971175 21:44837264-44837286 TTGGGGTGCGGGGCAGAGCACGG + Intergenic
1180100821 21:45584247-45584269 GTGGAGAAGGAGACAGAGCAGGG - Intergenic
1181865405 22:25850925-25850947 GTGGGGAACTGGGAAGAGAAGGG - Intronic
1182008846 22:26983648-26983670 GAGGGGAACTGAACAGAGAAGGG - Intergenic
1183025911 22:35065927-35065949 CTGGGGAACTGGCCAGAGCAGGG - Intergenic
1183028118 22:35081608-35081630 GTGGGGAAGGGAACTGGGCAGGG + Intronic
1183096213 22:35553847-35553869 GTGGGGAAGGGGACAGAGGCAGG - Exonic
1183179544 22:36250467-36250489 GGGGGGAACAGAACAGGGCAGGG - Intergenic
1183411859 22:37659458-37659480 GTGGGGAACAGGAGAGTGCGAGG + Intronic
1183897184 22:40978730-40978752 GTGGGTAAGGGGACAGGGCTTGG - Intergenic
1184021187 22:41822571-41822593 GTGGGGAAGGGAACAGGGAAAGG + Intronic
1184257629 22:43296188-43296210 GTGGGGACCCGAACAGAGCTGGG - Intronic
1184979961 22:48089207-48089229 GGGAGGAAAGAGACAGAGCAGGG - Intergenic
1185326586 22:50228628-50228650 GTGGAGAAGGGGTCAGAGCAGGG - Intronic
950265875 3:11572522-11572544 GAGGGGAATGGGACTGAGGAGGG - Intronic
950300044 3:11868932-11868954 CTGAGGAATGGGACAGAGAATGG - Intergenic
950305053 3:11910797-11910819 GTGGGGAGCAGGCCTGAGCAGGG + Intergenic
951405384 3:22290461-22290483 GCTGGGAAGGGGACATAGCAAGG + Intronic
952124852 3:30288679-30288701 GTGGGGAAAGGGATAGAGAGAGG + Intergenic
952759516 3:36901714-36901736 GTGGGGAAGGGGAGAGAGGATGG + Intronic
952896703 3:38082512-38082534 GTGGGAAAGGGGTCAGGGCACGG + Intronic
953112789 3:39959493-39959515 GTGGGGAACGTCACACATCAGGG + Intronic
954106424 3:48412075-48412097 CTGGGGAAGGGGACAGGACATGG + Intronic
954381401 3:50221025-50221047 GTGAGGTACGGGCCAGAACATGG + Intergenic
954420507 3:50416578-50416600 CTGGGGCCCAGGACAGAGCAGGG - Intronic
955260830 3:57388874-57388896 GTGGGGAACGTCACACACCAGGG + Intronic
955668083 3:61371329-61371351 GGTGGGGAGGGGACAGAGCAGGG + Intergenic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
956939918 3:74146651-74146673 ATGGAGAAGGGGACAGAGAAGGG - Intergenic
958025022 3:88039971-88039993 GTGGGGAACTGGAGAGGGAATGG + Intergenic
958027201 3:88061986-88062008 GTGGGCAAAGGGAGAGAGGAAGG + Intronic
959486634 3:106934500-106934522 GTGGGGAACTGGAAAGGGGATGG - Intergenic
959498928 3:107082933-107082955 GTGGTGAACCTGACAGAGCCTGG + Intergenic
960326194 3:116298966-116298988 GTGGGGAGTGGGAAAGAGAATGG + Intronic
960787021 3:121384822-121384844 ATGGGGACGGGGACAGAGAAGGG - Intronic
960936957 3:122910351-122910373 GAAGGGAACAGGCCAGAGCAAGG + Intronic
961362583 3:126377367-126377389 GTGGGGATGTGGACATAGCATGG - Intergenic
962199525 3:133390052-133390074 GTGGGAAAAGGGGCAGGGCATGG - Intronic
962553011 3:136514882-136514904 GTGGGGAACGTCACACACCAGGG + Intronic
963142462 3:141958540-141958562 GTGGGAAAGGGCACAGAGCCTGG + Intronic
963229173 3:142892444-142892466 GTGGGGCAGGGGAAAGAGGAAGG - Intergenic
964805902 3:160609483-160609505 GTGGGTAACAGGACACATCAAGG + Intergenic
965147895 3:164929330-164929352 GTGGGGAAGGGGATAGAGAGAGG - Intergenic
967109465 3:186280827-186280849 GTGGGAAGAGGGACAGGGCAGGG + Intronic
967991811 3:195137128-195137150 GTGGGGGCCAGGACAGAGAAGGG + Intronic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968267659 3:197375209-197375231 GTGGGGATGGGGAGAGAGGATGG - Intergenic
968440884 4:623892-623914 CTGGGGGACGGGAAAGAGCCCGG + Intergenic
968818098 4:2832122-2832144 GCTGGGCATGGGACAGAGCAGGG - Intronic
968913417 4:3486892-3486914 GAGGGGAGCAGGAGAGAGCAGGG - Intronic
969388000 4:6869179-6869201 GTGGGGGATGGGACAGGTCAGGG - Intronic
969487146 4:7478628-7478650 GTGGTGACCAGGTCAGAGCAGGG - Intronic
971540156 4:27805774-27805796 CTGGGGAAGGGAACACAGCAGGG + Intergenic
973650680 4:52994333-52994355 GCGGGGAAGTGGAAAGAGCACGG + Intronic
974552083 4:63389351-63389373 GTGAGAAACGGGACAGATTACGG - Intergenic
974671000 4:65030056-65030078 GTGGGGAACATGACACACCAGGG + Intergenic
976342491 4:83960758-83960780 GTGGAGAACCTGAAAGAGCAGGG - Intergenic
978240154 4:106505605-106505627 GTGGGGAAGGCCACAGAGCAAGG - Intergenic
980003520 4:127516028-127516050 GTGGGAAAGGGGTCAGGGCATGG + Intergenic
980577854 4:134708499-134708521 GTGGGGAGCAAGAGAGAGCAAGG - Intergenic
980987613 4:139710955-139710977 GGGGGTAACAGGACAGAGAAGGG + Intronic
981018482 4:140000656-140000678 GTGGGGAACGGGACAAAGATTGG + Intronic
981934094 4:150220086-150220108 GTGGGGAATGGAATAGAGAATGG + Intronic
983609595 4:169628087-169628109 GTTGGGAATGGGACAGTGTATGG - Intronic
984884976 4:184442034-184442056 GTGTGGAAGGGGACACAGCCAGG + Intronic
985288030 4:188356993-188357015 GTGGGGTTCTGGAAAGAGCAGGG + Intergenic
985706646 5:1405416-1405438 GTGGGGACTGGAACAGGGCAGGG - Intronic
985756652 5:1723479-1723501 GAGGGGAAAGGGAGAGAGGAAGG - Intergenic
988752699 5:34206838-34206860 GTTGGGAACTGGACAGGTCAGGG - Intergenic
989775856 5:45206350-45206372 GAGTGGAACAGAACAGAGCAGGG - Intergenic
990079843 5:51899500-51899522 ATGGGGAACTGGAAAGAGGATGG + Intergenic
991214912 5:64150093-64150115 GTGGGAACCGGGACTGTGCATGG + Intergenic
991740470 5:69667652-69667674 GTTGGGAACTGGACAGGTCAGGG - Intergenic
991757029 5:69885515-69885537 GTTGGGAACTGGACAGGTCAGGG + Intergenic
991792045 5:70247393-70247415 GTTGGGAACTGGACAGGTCAGGG - Intergenic
991819930 5:70543757-70543779 GTTGGGAACTGGACAGGTCAGGG - Intergenic
991836432 5:70761397-70761419 GTTGGGAACTGGACAGGTCAGGG + Intergenic
991884491 5:71247719-71247741 GTTGGGAACTGGACAGGTCAGGG - Intergenic
992089651 5:73305610-73305632 GTAGGGCACTGGACAGAACAGGG + Intergenic
992471304 5:77057827-77057849 GTGGGGACTGGAACAGAGCCTGG + Intronic
993880755 5:93358045-93358067 GTGGGGAAAGAAAGAGAGCAAGG - Intergenic
995750864 5:115452042-115452064 GTGGGGAAAGGGAAATAGCAGGG - Intergenic
995837378 5:116412107-116412129 GTGGGGAGGGGGCCAGAGGAGGG - Intronic
996006165 5:118423052-118423074 GTGGGGAACATCACACAGCAGGG + Intergenic
997326489 5:133026273-133026295 CTGCGGCACGGGACAGAGCGGGG - Intronic
997432550 5:133850754-133850776 GCTGGGAGCGGGACAGAGCCTGG - Intergenic
998199612 5:140108656-140108678 GGGGGGAACCGAACAGAGGAGGG - Intronic
998487433 5:142515224-142515246 GTGGGGACTGGAACAGAGCCTGG + Intergenic
998509353 5:142698473-142698495 GTGGGCAACGCCACAGAGCTAGG + Intergenic
999437776 5:151577533-151577555 GTGGGGCAAGGGGTAGAGCATGG + Intergenic
1001741598 5:174057550-174057572 ATGGGGACCGGCAGAGAGCAGGG - Intronic
1001937482 5:175715589-175715611 CAGGGGAACTGGAGAGAGCAGGG + Intergenic
1001992802 5:176132508-176132530 GTGGGGGGCGAGTCAGAGCAGGG + Intergenic
1002053576 5:176585725-176585747 GCAGGGAAGGGGACTGAGCATGG + Intronic
1002494646 5:179603488-179603510 GGAAGGAACGGGCCAGAGCACGG - Intronic
1004026966 6:11828229-11828251 GTGGGAAAAGGGACAGAGATGGG - Intergenic
1005550865 6:26913558-26913580 GTTGGGAACTGGACAGGTCAGGG - Intergenic
1005922980 6:30417332-30417354 GTGGGAACCTGGAAAGAGCATGG - Intergenic
1006227860 6:32555583-32555605 GTGGATAAAGGGACAGAGTAGGG + Intronic
1006372455 6:33653813-33653835 GTGGGGAATGGGACACACCAGGG - Intronic
1006506773 6:34494217-34494239 CTGGGGAACTGGGCAGAGCAGGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1007046973 6:38785653-38785675 GAGGGGAACGGCACACACCAGGG - Intronic
1009438843 6:63651704-63651726 TTGGGGAAGGGGAAGGAGCAGGG - Intronic
1010392066 6:75349335-75349357 GTTGGGGGCGGGGCAGAGCAGGG - Intronic
1011194067 6:84764287-84764309 GTGGGGAAGGGGGCAGATCTCGG - Exonic
1011554868 6:88563784-88563806 GTGGGAAATGGGACAGACCCAGG - Intergenic
1011599779 6:89049252-89049274 GTGGGGTAAGGAAGAGAGCAAGG - Intergenic
1011959559 6:93070248-93070270 GTGGGGAAGGGGAAAGGGAAAGG + Intergenic
1016597293 6:145815704-145815726 GTGGGGATGGGGGCAGAGCCAGG + Intergenic
1016855243 6:148662855-148662877 ATGGGGAAGGGGAAAGATCAAGG - Intergenic
1017203717 6:151782852-151782874 GTGGAGTATGGGAAAGAGCATGG - Intronic
1018275331 6:162124372-162124394 GCTGGGAAAGGGACAGAGCAGGG + Intronic
1018597300 6:165495346-165495368 GAGGGGAAAGGGAGAGAGAAAGG + Intronic
1021041910 7:15872800-15872822 ATGGGGAGCTGGACAGAGGATGG - Intergenic
1022336903 7:29430885-29430907 GGAGGGCATGGGACAGAGCAGGG - Intronic
1024470703 7:49766678-49766700 GTGGGGACCTGGAGAGGGCATGG + Intergenic
1024639831 7:51319431-51319453 GTGGGGAGGGGCACAGAGCCTGG + Intergenic
1025034512 7:55585258-55585280 GTGGGGGATGGGACAGTGGAGGG + Intergenic
1025296346 7:57777683-57777705 GATGGGAACGGGACATGGCAAGG + Intergenic
1026101460 7:67387885-67387907 GAGGGGAGGGAGACAGAGCAAGG + Intergenic
1026361443 7:69604559-69604581 GTGGGGAATGGGACCTAGAAGGG + Intronic
1027435129 7:78156295-78156317 GTGGGGAAGGGGACAGGGAGGGG + Intronic
1029100176 7:98123081-98123103 GGGAGGAACGGGACAGGACAGGG - Intronic
1029121345 7:98270411-98270433 GGGAGGAACTGGACAGAGCCAGG - Intronic
1030607871 7:111657502-111657524 TTGGGGAAGGGGAAAAAGCAGGG - Intergenic
1032092577 7:128918506-128918528 GTGTGGGACTGGGCAGAGCAGGG - Intergenic
1032537854 7:132679188-132679210 GTGGTGAACGGGAAAGAACCTGG + Intronic
1033426297 7:141247584-141247606 GTAGGGAAAGGGAAAGAGGATGG + Intronic
1033600479 7:142885357-142885379 GTGGGGAAGGGAGCAGACCAAGG + Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033800507 7:144896193-144896215 TAGGGGAAGGAGACAGAGCAAGG + Intergenic
1033988625 7:147256751-147256773 GTGGGGAACAGGACAGTTAATGG + Intronic
1034434081 7:151054883-151054905 GAGGGCAAGGGGAGAGAGCAGGG - Intronic
1034500332 7:151446695-151446717 GTGGGGAAGGGGGCAGAACCTGG - Intergenic
1034531429 7:151698319-151698341 GTGGGGGATGGGACAGTGAAGGG - Intronic
1034683841 7:152952305-152952327 GTGCAGAACTGGACAGAACAAGG - Intergenic
1034985528 7:155511180-155511202 GGGGGGATGGGGACAGAGCCAGG + Intronic
1035264633 7:157684423-157684445 GTGGGGGAGGGGAGTGAGCAGGG + Intronic
1035692136 8:1567149-1567171 TTGGGGAGCTGGACAGAGCTGGG + Intronic
1035998574 8:4576380-4576402 CTGGGGAATGGGACAGGGGAAGG - Intronic
1036808774 8:11853143-11853165 GTGGGGTATGGGACAAAGGAGGG + Intronic
1037546572 8:19929668-19929690 AAGGGGAAAGGGAAAGAGCATGG - Intronic
1037697214 8:21234294-21234316 GTGGCTAACAGCACAGAGCATGG + Intergenic
1037920085 8:22799724-22799746 GTGGGGAACGTCACACACCAGGG - Intronic
1039045568 8:33446129-33446151 GTGGGGAAGGGGTCTGAGCTGGG + Intronic
1039441608 8:37598913-37598935 CTGGGGAAAGGGACACAGCTGGG + Intergenic
1039466209 8:37787117-37787139 GAGGAGAAAGGGAGAGAGCAGGG + Intronic
1039615401 8:38951272-38951294 ATAGGAAATGGGACAGAGCATGG + Intronic
1040274473 8:46000276-46000298 GTGGGGAACACCACAGACCAGGG - Intergenic
1041280703 8:56209535-56209557 GTGGGATATGGGACAGAGCAGGG - Intronic
1041964184 8:63655983-63656005 GTGGGGCACGAGGCAGATCAAGG - Intergenic
1042153032 8:65810317-65810339 GTGGGGAACGTGACACACCAGGG + Intronic
1042847054 8:73178861-73178883 GTGGGGCACTGCACAGAGCCAGG - Intergenic
1042978486 8:74498817-74498839 GTGGGGAGCAGGACAGAGAAAGG - Intergenic
1043066329 8:75575773-75575795 GTGGGGAACAGCACACACCAGGG - Intergenic
1045161033 8:99544283-99544305 GTGGGGAACATCACACAGCAGGG + Intronic
1045163169 8:99572474-99572496 GTGGGGAACATCACACAGCAGGG - Intronic
1048097442 8:131311335-131311357 GTGGGAAAGGGGTCAGGGCATGG - Intergenic
1048421581 8:134283289-134283311 GTGGGGAATGTGAGTGAGCATGG + Intergenic
1048695785 8:137026362-137026384 GTGGGGAACGTCACACACCAGGG + Intergenic
1048852735 8:138660001-138660023 GCATGGAACGGGACAGAGAAGGG - Intronic
1049161589 8:141101671-141101693 GTGGGGAAGGGCACGGAGAAGGG - Intergenic
1049213867 8:141398952-141398974 ATGGGGACAGGGACAGGGCAGGG - Intronic
1049374012 8:142280574-142280596 GTGGGGAGGGGGACAAACCAGGG - Intronic
1049423069 8:142525333-142525355 GTGGGAAAGGGGACAGAGACAGG + Intronic
1049566336 8:143341076-143341098 GTGGGGAGCGGAAGAGTGCAGGG - Intronic
1049645971 8:143735760-143735782 GTGGGGAACAGGGCACACCATGG - Intergenic
1049752532 8:144291903-144291925 GTGGGGACCGGGAGGGAGCAGGG + Intronic
1050427059 9:5522415-5522437 TTGGGGAAGGTGACAGACCATGG - Intronic
1050459649 9:5866773-5866795 GTGGGGATGGGCAAAGAGCAAGG + Intergenic
1050650069 9:7766692-7766714 GTGCGTGACGGGACAGAGCAGGG + Intergenic
1051250398 9:15153013-15153035 GTGGGGAAAGGGAAAAAGGAGGG - Intergenic
1053141929 9:35688035-35688057 GGGGGGACAGGGACAGAGCTGGG - Intronic
1053163205 9:35827936-35827958 GTGAGGAAGGGGAAAGAGAAGGG + Intronic
1053284455 9:36841354-36841376 GTGGGGAAAGGCACAGAGGCAGG - Intronic
1053314714 9:37041588-37041610 TTGAGGAACGGGACAAAGGAAGG + Intergenic
1057885051 9:98823591-98823613 GTGGGAAACTGGAAGGAGCAGGG + Intronic
1058424839 9:104867223-104867245 GTGGGGAACAGGAGAGAGGAAGG + Intronic
1058512200 9:105731477-105731499 GTGGGGAACCTCACAGACCAGGG - Intronic
1058979926 9:110159794-110159816 GTGGAAAACTGGAGAGAGCAGGG - Intronic
1060227971 9:121807731-121807753 GTGGGGCAAGGGACAGGGGACGG + Intergenic
1060549890 9:124479912-124479934 GTGGGGAAGGGGACAAAGGTGGG + Intergenic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1061883655 9:133580095-133580117 GCGGGGAAGGGGACAGGGCAGGG - Intronic
1062041389 9:134405837-134405859 GCGGGGATCAGGTCAGAGCAGGG - Intronic
1062289707 9:135789047-135789069 GTGGGGAAAAGCACAGAGCCGGG - Intronic
1062552421 9:137095703-137095725 GTGGGGAAGGGAGCAGAGGACGG + Intronic
1062569485 9:137178546-137178568 AGGGGGAAAGGGACCGAGCACGG + Intronic
1062585127 9:137245734-137245756 ATGGGGGACAGCACAGAGCAGGG + Exonic
1185792081 X:2934866-2934888 AGGGGGAACGGGCCACAGCAGGG + Exonic
1185938376 X:4284841-4284863 GTGGGAATCTGGACAGAGTATGG + Intergenic
1187245037 X:17546278-17546300 GAGGGGAATGAGACAGAGAATGG - Intronic
1187831708 X:23389075-23389097 CTGGGGAATGGGACAGAGAATGG - Intronic
1189261591 X:39682769-39682791 ACGGGGAACGGGAGAGAGGAAGG + Intergenic
1191833235 X:65437293-65437315 GTTGGGAAGGGTATAGAGCAGGG - Intronic
1193612418 X:83648863-83648885 GTGGGGTAGGGGACAGGGGAGGG - Intergenic
1194088535 X:89558395-89558417 GTGGGGAACAGCACACACCAGGG + Intergenic
1194594251 X:95837495-95837517 GTGGGGAGCAGCACAGAGCCAGG - Intergenic
1195444872 X:104940897-104940919 GTGGGGAACGTCACACACCAGGG - Intronic
1196180481 X:112684435-112684457 GTGGGGAACATCACAGACCAGGG - Intergenic
1197313903 X:124940191-124940213 GTGGGCAACTGAACAAAGCAAGG + Intronic
1198298548 X:135310677-135310699 GTGGGGGAGGGGACACAGGAAGG - Intronic
1200236266 X:154469275-154469297 GTGGGGAGCGGGAGAGCCCACGG - Intronic
1200441211 Y:3214442-3214464 GTGGGGAACAGCACACACCAGGG + Intergenic
1201936916 Y:19419731-19419753 GTGGGAAAGGGGTCAGGGCATGG - Intergenic