ID: 905652001

View in Genome Browser
Species Human (GRCh38)
Location 1:39662804-39662826
Sequence CTTTGTCAGTACTTGCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 133}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905651994_905652001 18 Left 905651994 1:39662763-39662785 CCAAAACTGCCCCTCGAAAGACA 0: 1
1: 0
2: 1
3: 7
4: 85
Right 905652001 1:39662804-39662826 CTTTGTCAGTACTTGCATCTGGG 0: 1
1: 0
2: 1
3: 7
4: 133
905651992_905652001 22 Left 905651992 1:39662759-39662781 CCACCCAAAACTGCCCCTCGAAA 0: 1
1: 0
2: 1
3: 5
4: 131
Right 905652001 1:39662804-39662826 CTTTGTCAGTACTTGCATCTGGG 0: 1
1: 0
2: 1
3: 7
4: 133
905651998_905652001 7 Left 905651998 1:39662774-39662796 CCTCGAAAGACACACATAGAGGG 0: 1
1: 0
2: 0
3: 43
4: 363
Right 905652001 1:39662804-39662826 CTTTGTCAGTACTTGCATCTGGG 0: 1
1: 0
2: 1
3: 7
4: 133
905651993_905652001 19 Left 905651993 1:39662762-39662784 CCCAAAACTGCCCCTCGAAAGAC 0: 1
1: 0
2: 0
3: 7
4: 88
Right 905652001 1:39662804-39662826 CTTTGTCAGTACTTGCATCTGGG 0: 1
1: 0
2: 1
3: 7
4: 133
905651995_905652001 9 Left 905651995 1:39662772-39662794 CCCCTCGAAAGACACACATAGAG 0: 1
1: 0
2: 1
3: 17
4: 133
Right 905652001 1:39662804-39662826 CTTTGTCAGTACTTGCATCTGGG 0: 1
1: 0
2: 1
3: 7
4: 133
905651996_905652001 8 Left 905651996 1:39662773-39662795 CCCTCGAAAGACACACATAGAGG 0: 1
1: 0
2: 0
3: 14
4: 108
Right 905652001 1:39662804-39662826 CTTTGTCAGTACTTGCATCTGGG 0: 1
1: 0
2: 1
3: 7
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905652001 Original CRISPR CTTTGTCAGTACTTGCATCT GGG Intronic
903452061 1:23460571-23460593 CTTTGTCAGTATTTGTGTTTTGG - Intronic
904593858 1:31630703-31630725 CTCTGTCAGCACCTGCAGCTGGG + Exonic
905652001 1:39662804-39662826 CTTTGTCAGTACTTGCATCTGGG + Intronic
907184790 1:52601610-52601632 CTTTATCAGTCCTTGGATGTGGG - Intergenic
907617026 1:55936072-55936094 CTCTGCCAGTACCTTCATCTTGG - Intergenic
915440893 1:155944893-155944915 CTTTGTCAATATTTACCTCTGGG - Intergenic
917586985 1:176437218-176437240 CTTTGTCTGTGCTGTCATCTTGG + Intergenic
919028851 1:192213052-192213074 CTTTGTCAGTTTTTGCATTTGGG - Intergenic
921255843 1:213338668-213338690 TTTTCTCAGTCCTTGAATCTGGG + Intergenic
921774236 1:219078737-219078759 CTTTGTCACCACTTGGATCTTGG - Intergenic
924275333 1:242380459-242380481 CATTCTTAGTACTTCCATCTTGG - Intronic
1063826504 10:9904444-9904466 CTCTGGCAGTACCTGCACCTTGG + Intergenic
1068628008 10:59270213-59270235 CTTTGTCATTTCTTCCTTCTGGG + Intronic
1071552284 10:86575830-86575852 CTTTAAAAGTACTTTCATCTGGG + Intergenic
1072100313 10:92223517-92223539 CTTGGTGATTACTTGCATGTAGG - Intronic
1072521101 10:96230775-96230797 CTTTGTAAGTATTTGCTCCTGGG - Exonic
1073724284 10:106211649-106211671 CTTTTTCATTACTTTCAGCTTGG - Intergenic
1076260438 10:129060648-129060670 CTCTCTCAGTCCTTGCCTCTGGG - Intergenic
1077419070 11:2441147-2441169 GTCTGTCAGTCTTTGCATCTAGG + Intergenic
1078468140 11:11565497-11565519 CTTTCCCAGTGCTTGCATTTGGG - Intronic
1079294452 11:19219851-19219873 ACTTGTCAATACTTGCAACTAGG - Intergenic
1080408533 11:32001471-32001493 CTTTGAAAGGACTTGCTTCTAGG + Intronic
1080867547 11:36208583-36208605 CATTGGCAGTACTTGTATTTTGG + Intronic
1082626202 11:55489533-55489555 CTGTGTCAGCACTTGCTTCTAGG - Intergenic
1085548757 11:77347016-77347038 CTTTGTGAGTTCTTGCTTATTGG - Intronic
1087412832 11:97813560-97813582 ATTTGTTAGAATTTGCATCTTGG + Intergenic
1089040955 11:115449250-115449272 TTTTGTCAGTAATTTAATCTAGG - Intronic
1092462728 12:8700052-8700074 TTTTGTCAGTAGTAGTATCTAGG + Exonic
1092625811 12:10327032-10327054 CATTTTCAGTACTTACATTTAGG + Intergenic
1094025230 12:25954975-25954997 CTTTCTGAGTACAAGCATCTTGG + Intergenic
1094255891 12:28425610-28425632 CTTTCTCATTACTTTCATTTTGG + Intronic
1097369059 12:58753580-58753602 CTTTTTTAGTAGTTGAATCTGGG - Intronic
1100683702 12:96960966-96960988 TCTTGTCAGTACTTGGATTTGGG - Intergenic
1101556118 12:105811447-105811469 CTTTGTCAGAACTTCCATCCAGG - Intergenic
1103897738 12:124285051-124285073 CTTGGTGAGGACTTGCTTCTTGG + Intronic
1104396176 12:128435158-128435180 CTTTGCCAATACCTTCATCTTGG + Intronic
1104663878 12:130633786-130633808 CCTTGTAAGTACCTGCTTCTGGG - Intronic
1106080600 13:26497418-26497440 CTTTGGCACTACTTACATCTGGG - Intergenic
1108213331 13:48159760-48159782 CTTATTCAGTACTTGCTGCTGGG - Intergenic
1109486967 13:63037846-63037868 TTTGGTCAATACTTACATCTTGG + Intergenic
1112929587 13:104717600-104717622 CTTTGGCACTACTGGCATTTGGG + Intergenic
1118846648 14:69552454-69552476 CTTTGTCAGGTGTTGCTTCTTGG + Intergenic
1124828994 15:33129439-33129461 CTTTCTCAGTACCTGCACATGGG + Intronic
1125304804 15:38299046-38299068 GTTTGACAGTATTTGCCTCTGGG + Intronic
1126538396 15:49794407-49794429 CTTCCTCAGTACTTTCACCTGGG - Intergenic
1128649432 15:69399892-69399914 CCTTCTCAGCACCTGCATCTGGG - Intronic
1129528287 15:76238027-76238049 ATGTCTTAGTACTTGCATCTGGG - Intronic
1130833800 15:87629911-87629933 CTTTGGCAGTACCTTGATCTTGG - Intergenic
1131081274 15:89538560-89538582 CTATCTCAGTTCTTCCATCTGGG - Intergenic
1140413925 16:74759794-74759816 CCTGGACAGGACTTGCATCTTGG + Intronic
1147351321 17:39847770-39847792 TTTTGTCATTATTTGTATCTTGG - Intronic
1150265215 17:63827820-63827842 CTTCGTCAGTACTGACACCTCGG + Intronic
1157288788 18:46395322-46395344 CTTTGTCACTACTGACATTTTGG + Intronic
1159495979 18:69205444-69205466 CTTTGTCAGCACTAGGATCCTGG + Intergenic
1167734444 19:51283491-51283513 CTTTTTCAGTATTTGTATTTAGG + Intergenic
927379712 2:22464832-22464854 ATTTGTAAGTACTGGCATTTTGG + Intergenic
928035541 2:27819178-27819200 CTTTGCCAGTACCTTGATCTTGG - Intronic
928205945 2:29283485-29283507 CATTGTCAGTGCTGCCATCTCGG - Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
931932233 2:67151860-67151882 CTTTGTCAGTTATTGTATCGGGG - Intergenic
933384217 2:81589630-81589652 CATGCTCAGTACCTGCATCTGGG + Intergenic
935365382 2:102283970-102283992 CTTTGACACCATTTGCATCTGGG + Intergenic
936733497 2:115411435-115411457 AATTGTCTGTATTTGCATCTTGG + Intronic
936937733 2:117854147-117854169 CTGTGTCAGCACTCGCTTCTGGG + Intergenic
937626380 2:124048719-124048741 CACTGTCAATACTTCCATCTAGG - Intronic
940699940 2:157028154-157028176 CATTGGCAGTACTTGAATTTGGG - Intergenic
941561316 2:167048831-167048853 CTTTTTCAGTTTTTGCATCATGG - Intronic
941690004 2:168491049-168491071 CTTTGGCACTCCTTGCTTCTAGG - Intronic
942417196 2:175771765-175771787 CCTTGCCAGCACCTGCATCTTGG - Intergenic
943545931 2:189277840-189277862 CTTTGGCAGTATATGCATTTGGG + Intergenic
947013575 2:225592241-225592263 TGTTTTCAGTGCTTGCATCTTGG + Intronic
948498289 2:238369751-238369773 CTTTGTAATTACTAGCATTTTGG + Intronic
1170006037 20:11670174-11670196 CAGTGTCAGTAGTTGCTTCTAGG - Intergenic
1170033194 20:11963733-11963755 CTTTCTCAGCCCTTGAATCTGGG - Intergenic
1171177983 20:23068467-23068489 CTTTACCAGTACTTTCATTTTGG + Intergenic
1174980317 20:55387130-55387152 CCTTGTAAGTACCTGGATCTAGG + Intergenic
1176979662 21:15366477-15366499 CTTTTTCAGTAAATGTATCTGGG + Intergenic
1180719307 22:17895252-17895274 TCTTGTCAGTATTTACATCTGGG - Intronic
1183764783 22:39862808-39862830 CATTGGCAGTACTTGAATTTTGG - Intronic
1185100840 22:48840148-48840170 GTTTGGCAGTGCTCGCATCTGGG + Intronic
950945526 3:16941816-16941838 GTTTGTCTGTACTTGTATATAGG + Intronic
952331396 3:32367349-32367371 CTTTTTAAGAACTTGCAGCTAGG + Intronic
955151797 3:56375043-56375065 CTTCCTCAGTGCTTGCATCAAGG + Intronic
967674865 3:192284994-192285016 CTATGTCTGTACTTGTACCTTGG - Intronic
968279555 3:197465874-197465896 CTTTCTCAGAATTTGAATCTCGG + Intergenic
969178195 4:5416113-5416135 TTTGGTCAGTACTTGCTTTTTGG - Intronic
970457276 4:16237681-16237703 ATTTGTAAGCATTTGCATCTGGG + Intergenic
974543909 4:63275488-63275510 CTTTGACAGTACATGCATGTGGG + Intergenic
976403448 4:84635500-84635522 ATTTCTCAGTACTTCCATCTGGG + Intronic
978404442 4:108364460-108364482 CTTTTTCTGCACTTGCACCTAGG - Intergenic
979160701 4:117457148-117457170 CTTTGTCTTTACTTGCCTATAGG + Intergenic
979166213 4:117534734-117534756 ATTTGTCAGTTCTTACACCTAGG - Intergenic
983587754 4:169374535-169374557 CATTATCAGTACTTGGATATAGG - Intergenic
983842426 4:172473652-172473674 CTATGTCTGTAGTTGCTTCTTGG + Intronic
984335756 4:178387988-178388010 CTGAGTCAGTGCTGGCATCTGGG - Intergenic
991023988 5:62010044-62010066 CTTTGTAAGTACCTGCCTTTTGG + Intergenic
991475353 5:67012565-67012587 CTTTGTATCTACTTTCATCTAGG - Intronic
991691836 5:69233053-69233075 CCTTGTCATTACTTGGGTCTAGG - Intergenic
994599598 5:101886399-101886421 CTGTGCCAGTACTTTGATCTTGG - Intergenic
998509758 5:142701800-142701822 CATTGTTAGTTGTTGCATCTGGG + Intergenic
999865479 5:155696090-155696112 CTTTGCCAGTAGATGGATCTGGG + Intergenic
999938380 5:156513788-156513810 CTTTATAAATATTTGCATCTGGG + Intronic
1000381104 5:160630229-160630251 CTTAGTCAGAACTTGCCTTTGGG + Intronic
1000978291 5:167788885-167788907 CTTTCCTAGTACCTGCATCTAGG - Intronic
1002365663 5:178707973-178707995 CATTGTGATTATTTGCATCTGGG + Intergenic
1008051312 6:46902863-46902885 CTTTGTAACTCCTTGAATCTGGG - Intronic
1008545639 6:52580819-52580841 ATGAGTCAGAACTTGCATCTGGG + Intergenic
1010244405 6:73650010-73650032 CTTTGTCATCACATCCATCTCGG - Intronic
1012323918 6:97889340-97889362 CTCTTTCAGTTCTTGCATATTGG - Intergenic
1013095807 6:106943986-106944008 CTTTTTGAGTACTTGTGTCTTGG + Intergenic
1016224550 6:141719591-141719613 ACTTGTCAGTATTCGCATCTAGG + Intergenic
1016368054 6:143340262-143340284 ATTAGTCAGCATTTGCATCTAGG - Exonic
1016642144 6:146361342-146361364 CTTTGGCTGTACTTGTGTCTTGG - Intronic
1017022763 6:150153674-150153696 CTTAGTCAGCACTGGCATTTTGG + Intronic
1019099365 6:169615704-169615726 CTTTGCCAGTTCTTGTGTCTAGG - Intronic
1020475424 7:8588602-8588624 CTTTTTCATTAGTTCCATCTTGG + Intronic
1026346358 7:69477616-69477638 CTGAGTCAGGACTTGAATCTGGG + Intergenic
1032531072 7:132620888-132620910 ATTGGTCAGAACTTGGATCTTGG - Intronic
1032632142 7:133664942-133664964 TTTTGTAAGTACATGCATTTTGG + Intronic
1035321892 7:158035397-158035419 CTTTCTCTGTTCTGGCATCTGGG - Intronic
1040963484 8:53060774-53060796 CTTTGTATATACTTGGATCTAGG + Intergenic
1042970958 8:74408583-74408605 ATTTGTCAGTACCTTGATCTTGG + Intronic
1045683933 8:104691691-104691713 CTTTGTCAGTGCTTAGAACTGGG + Intronic
1046084828 8:109419597-109419619 CAATGTCAGTAGTTGCATTTTGG - Intronic
1048219071 8:132524960-132524982 TTTTGTCAGCACCTGCTTCTTGG - Intergenic
1048501373 8:134978527-134978549 CTTTGTCAATAATGGCTTCTTGG - Intergenic
1051600620 9:18869218-18869240 CCTTGCCAGCACTTTCATCTCGG + Intronic
1051679109 9:19589336-19589358 TTTTGTTATTAATTGCATCTTGG - Intronic
1055664958 9:78544132-78544154 CTTTGTCAGTACTTACTTCTTGG + Intergenic
1055930397 9:81554261-81554283 CTCTGTGATTATTTGCATCTAGG + Intergenic
1057797345 9:98168434-98168456 CTATGACAGTACTTGCATGAGGG - Intronic
1058426268 9:104877464-104877486 CTTGGTCAGTACTTGGATGGGGG - Intronic
1186659000 X:11649063-11649085 CTTTGTCACTTCTTCCATCAAGG + Intronic
1188337404 X:28954276-28954298 ATTTGTGAGTACTGGCATGTGGG + Intronic
1188789576 X:34391999-34392021 CTTTGTCAGTTGTTCCTTCTTGG + Intergenic
1191685368 X:63884563-63884585 CCTTGACAGTAGTTGCAGCTAGG + Intergenic
1193337368 X:80306696-80306718 CTGTGTCAGGACTTGACTCTTGG - Intergenic
1193848403 X:86503842-86503864 CTTTGTCAGCTATTGGATCTTGG + Intronic
1195430183 X:104780409-104780431 CTTACTCAGTCCTTGCATATGGG - Intronic
1196638327 X:118030455-118030477 CTGTTTCACTAATTGCATCTAGG + Intronic
1198314177 X:135450227-135450249 CTATGTGTGTACTTGCACCTGGG + Intergenic
1199448750 X:147956307-147956329 CTTAGTTAGTACTGGTATCTTGG + Intergenic