ID: 905653049

View in Genome Browser
Species Human (GRCh38)
Location 1:39669182-39669204
Sequence GCCTTTCAGGGTCAGGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 235}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905653044_905653049 8 Left 905653044 1:39669151-39669173 CCAGGAAACCAGGGTGCTGGCAG 0: 1
1: 0
2: 1
3: 47
4: 286
Right 905653049 1:39669182-39669204 GCCTTTCAGGGTCAGGCTGATGG 0: 1
1: 0
2: 2
3: 18
4: 235
905653045_905653049 0 Left 905653045 1:39669159-39669181 CCAGGGTGCTGGCAGCTCTCTCT 0: 1
1: 0
2: 11
3: 31
4: 340
Right 905653049 1:39669182-39669204 GCCTTTCAGGGTCAGGCTGATGG 0: 1
1: 0
2: 2
3: 18
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905653049 Original CRISPR GCCTTTCAGGGTCAGGCTGA TGG Intronic
900321905 1:2088648-2088670 TCCTTTCTAGGTCAGGCTGTGGG + Intronic
900547588 1:3237210-3237232 CCCTTTGAGGACCAGGCTGAGGG - Intronic
901321059 1:8340023-8340045 GCCATTCAGGGTGGGGCTTATGG + Intronic
901532699 1:9863550-9863572 GCCTTCCAGGGCCAGGCTGCTGG - Intronic
903281905 1:22254912-22254934 GCCTCTCAGGGGAAAGCTGATGG - Intergenic
903971608 1:27122581-27122603 GGCATTCAGGGCCAGGCTGAAGG - Intronic
905653049 1:39669182-39669204 GCCTTTCAGGGTCAGGCTGATGG + Intronic
905658446 1:39701510-39701532 GCATCTCAGGGCCAGGATGAAGG - Intronic
906804190 1:48764186-48764208 GCCTTCCAGGGTTACACTGACGG - Intronic
911163417 1:94704582-94704604 GCTTCTCAGGGCCTGGCTGATGG - Intergenic
912517440 1:110225212-110225234 TGCTCTCAGGGTCAGGCTAAGGG - Intronic
913958342 1:143322133-143322155 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
914052657 1:144147508-144147530 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
914126540 1:144819033-144819055 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
915328288 1:155092548-155092570 GCCTCTCAGAGGCAGGCTGGTGG - Intergenic
917634375 1:176920509-176920531 GCCTTTCGGGGTCCCTCTGAGGG + Intronic
918070290 1:181129332-181129354 CCCTTCCCTGGTCAGGCTGAGGG + Intergenic
920718071 1:208359980-208360002 TCTTTTCAGGGTCAGCCTGATGG + Intergenic
923284931 1:232484811-232484833 GCCTTTCAGGCTCAGATTGCTGG - Intronic
1062805025 10:412668-412690 GCCTTTCAGGGTGGGGCTCTGGG - Intronic
1065320923 10:24509382-24509404 GCCTTACAGGATCCTGCTGAGGG - Intronic
1065861999 10:29879647-29879669 ACCTTTCAGGTCCAGGCTGATGG - Intergenic
1066759324 10:38738434-38738456 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1066962305 10:42234345-42234367 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
1070922203 10:80195089-80195111 GCCTTTCCGGGAGAGGCTGGGGG - Intronic
1070979542 10:80633173-80633195 GCCTCTCAGGGTCATGGAGATGG + Intronic
1071493376 10:86151867-86151889 CCCTCTCAGTGACAGGCTGATGG + Intronic
1071692996 10:87842428-87842450 CCCTTTCAGGGTAAGGCAGTAGG + Intergenic
1073156805 10:101354046-101354068 ACCTCTCAGGCGCAGGCTGAGGG - Exonic
1074039961 10:109778660-109778682 TCCTTTCTGGGTCATGCTGTTGG - Intergenic
1074275089 10:111993416-111993438 GCATTCCAGACTCAGGCTGAGGG - Intergenic
1074696970 10:116058478-116058500 GCCTTTTAGGCTCAGGATGAAGG + Intronic
1075719333 10:124575797-124575819 GCCTTTGGGGGTCAGGGTGTGGG - Intronic
1077512795 11:2979087-2979109 GCATTTCAGCGTCTAGCTGATGG - Intronic
1078560131 11:12364029-12364051 GCCTTTGAAGGTCAGCCTGCCGG - Intergenic
1078725260 11:13924339-13924361 GCCTTGCAAGGTGAGGCTGTGGG + Intergenic
1078935442 11:15945424-15945446 GCCCTTCAGCATCAGGCTGCTGG - Intergenic
1079428668 11:20367219-20367241 GCCTTTCAAGGTCATGATGTTGG + Exonic
1084938639 11:72600718-72600740 GCCTTCCAGGCTCATGCTGGGGG + Intronic
1085020679 11:73204950-73204972 CTCTTTCAGGGCCGGGCTGAGGG + Intergenic
1085283640 11:75346328-75346350 TCCTTTCAGGCTCAGGCTGAGGG - Intronic
1085689376 11:78652967-78652989 CTCGTTCAGGGACAGGCTGAAGG - Exonic
1086448254 11:86890499-86890521 GCCATACAGGGTCAGTCTAAGGG - Intronic
1089612281 11:119676233-119676255 GCCTTTGAGGGTCAGGAGGAAGG - Intronic
1090028828 11:123190184-123190206 ACCATTCAGGTTCAGGGTGATGG - Intronic
1091129008 11:133128319-133128341 GCCTTGCAGAGTCAGTCTGAAGG + Intronic
1091638442 12:2215641-2215663 GCCCTTCAGGGACAGGCTCCAGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1091782537 12:3222953-3222975 GCCTATCAGGCTAAGGCAGAGGG + Intronic
1092779214 12:11969859-11969881 GCCATTCAGGATCAGACTCAGGG + Intergenic
1094207022 12:27851476-27851498 GCCATTCAGGGTCATTCTCAGGG - Intergenic
1094303175 12:28989009-28989031 TCCTCCCAGGGTCAGGTTGAGGG - Intergenic
1094533756 12:31302780-31302802 GCATCTCAGGGTCTGGCGGAAGG + Intronic
1095988647 12:48017999-48018021 CCCTGTCAGGGCCAGGCTCAGGG - Intergenic
1096403090 12:51323727-51323749 CCTTTTCTGGGTCAGCCTGAGGG + Intronic
1096453694 12:51767930-51767952 GGCTTTGAAGGCCAGGCTGAGGG - Intronic
1105489415 13:20873201-20873223 GGCTTGGAGGGTCATGCTGAGGG - Intronic
1106969100 13:35114553-35114575 GACTTTCAGGGTCAGGGCCAAGG - Intronic
1108715096 13:53071132-53071154 GCCTCTCAGCATCATGCTGATGG + Intergenic
1113104628 13:106759087-106759109 GCCTTTGTGGGACAGGCTGAGGG + Intergenic
1114486081 14:23062539-23062561 GACTTTCAGGGTCTAGCAGAAGG + Intronic
1114664016 14:24368114-24368136 GCCAATCAGGGACAGGCTGGGGG + Intronic
1115742427 14:36402733-36402755 GCCTTTCAATGTCATGCTAAGGG - Intergenic
1117222997 14:53625245-53625267 TCTTTTCAAGGTCAGGTTGAGGG - Intergenic
1117561274 14:56941924-56941946 GTCTTTCAGGGTGAGGGGGAAGG - Intergenic
1118315095 14:64721346-64721368 TCCTTCCAAGGTCAGGCCGAGGG + Intronic
1122246125 14:100404733-100404755 GCATTTCAGAGTCAGGATCATGG - Intronic
1122834249 14:104423370-104423392 GCCTGGGAGGGGCAGGCTGAGGG + Intergenic
1202930067 14_KI270725v1_random:28051-28073 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1123442765 15:20303160-20303182 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1131652186 15:94412088-94412110 GGCTTTCATGGTCAGTCTGAGGG + Intronic
1132649188 16:1012845-1012867 GCCTGACAGGGTGAGGCCGAGGG + Intergenic
1132711545 16:1271168-1271190 GCCCCACAGGGACAGGCTGAGGG - Intergenic
1133268847 16:4600588-4600610 CCCTTTCTGGGCCAGGCTCAGGG - Exonic
1135726099 16:24854870-24854892 CCCTTTCAGGGTAAGGGTGGAGG - Intronic
1136610128 16:31361204-31361226 GCCATTGAGGGTGAGTCTGAAGG + Exonic
1136718487 16:32302554-32302576 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
1136836862 16:33508824-33508846 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
1137506792 16:49061082-49061104 CTCTTTCAGTGCCAGGCTGAGGG + Intergenic
1139624880 16:68179312-68179334 GCCTTTCATCCACAGGCTGAAGG + Intronic
1139703926 16:68727252-68727274 GACTTTCAGTCCCAGGCTGAAGG - Intergenic
1141055727 16:80812054-80812076 GCTGTTCAGGGTCAGGCTGAAGG + Intergenic
1203007941 16_KI270728v1_random:215211-215233 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1142467184 17:142706-142728 CCCCTTCAGGGTCAGGGTCAGGG - Intergenic
1142695119 17:1629118-1629140 GCCTCGCAGGGTCAGGCCGCTGG - Intergenic
1142960238 17:3547988-3548010 GACTGTGAGGATCAGGCTGAGGG + Intronic
1144675058 17:17156682-17156704 GGCTGTCAGGGCCAGGCTGGGGG + Intronic
1144678067 17:17174484-17174506 ACTTCTCAGGGTCAGGCTTACGG + Intronic
1144856259 17:18269878-18269900 ACCTTTCAGGTTCAGACTGCAGG + Intergenic
1145817623 17:27806683-27806705 GCCTTTCAGGGGCACTCTGGTGG - Intronic
1146606317 17:34260960-34260982 GTCTTTTAGGATCAGGCTGCCGG - Intergenic
1146674921 17:34766630-34766652 GACTTTCAGGCTCAGGCAAAGGG + Intergenic
1146928460 17:36761601-36761623 GCCTTTGAGGATCAGGACGAAGG - Intergenic
1147647577 17:42043066-42043088 CCTTTTGAGGGCCAGGCTGAAGG - Intronic
1149359819 17:55883421-55883443 CCCTTTCATGGTCAGCATGATGG - Intergenic
1149398732 17:56271806-56271828 GACTTTCAGGGGCAGGATGTAGG - Intronic
1149992597 17:61391248-61391270 GCCCTTCAGGTTGATGCTGAGGG + Intronic
1150011834 17:61511878-61511900 GCCTTTCAGGGGCACTCGGAAGG - Intergenic
1150019587 17:61597943-61597965 ACCTTTCAGGTTTAGACTGAGGG - Intergenic
1151057684 17:71052470-71052492 ATGTTCCAGGGTCAGGCTGATGG + Intergenic
1154176125 18:12088002-12088024 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1155234264 18:23803735-23803757 GCCTTTCTGGGACATCCTGAAGG - Intronic
1155837187 18:30600595-30600617 GTCATTTGGGGTCAGGCTGATGG - Intergenic
1158513288 18:58110180-58110202 GCCTTTCATGTGGAGGCTGAGGG + Intronic
1159986968 18:74854088-74854110 GCTTTACAGGGTCAGCGTGAGGG + Intronic
1160935391 19:1592295-1592317 GCCGTTCAGGGACTGGCTGCCGG - Intronic
1163415354 19:17183242-17183264 TCCTTTCAGGATCATGCTGGTGG - Intronic
1165102639 19:33447855-33447877 GCCTTTGTGGTTCAGGCTGAGGG - Intronic
1166380065 19:42351108-42351130 GCCTTACAGGGACAGTCTGCAGG + Intronic
1167497584 19:49828626-49828648 GCCCTACAGGGTGAGGCTGGAGG - Intronic
1168307643 19:55444000-55444022 GCCTGTCAGTGTCAGGCAGCTGG - Intergenic
1168393989 19:56032866-56032888 GCCTTTCAAGTGCAGCCTGAGGG + Intronic
1202692054 1_KI270712v1_random:99932-99954 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
928372751 2:30752932-30752954 TCCTTTCAGCTTCAGGCTCATGG + Intronic
929440762 2:41964438-41964460 CCCTTTCAGCCCCAGGCTGAGGG - Intergenic
930237980 2:48905980-48906002 GCCTTTCTGGGTCAGCCTTTGGG - Intergenic
930834752 2:55781496-55781518 CCTTTTCAGGCTGAGGCTGAGGG - Intergenic
932008729 2:67954229-67954251 GCCTCTCAGGGTTAGTCTGCTGG - Intergenic
932110292 2:68993095-68993117 GGCTTTGAGGGTCTGGCTGGTGG + Intergenic
932125454 2:69141590-69141612 GTCTCCCAGGGTCAGGCAGAAGG - Intronic
933954343 2:87354040-87354062 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
934274655 2:91566450-91566472 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
934460957 2:94213591-94213613 GCATTTCAGGGTCAGGGCCATGG - Intergenic
934969231 2:98749588-98749610 GGCTTTGAGTGCCAGGCTGAGGG - Intergenic
935334630 2:102005203-102005225 TTCTCTCAGGGTCAGGCTTACGG - Intronic
935865761 2:107385970-107385992 GCCTTTTAGATTCAGGCTGATGG + Intergenic
936569498 2:113602669-113602691 GCATTGCAGGGTGAGGGTGAGGG + Intergenic
936921397 2:117692183-117692205 GCCATTCAGCCCCAGGCTGAGGG - Intergenic
937436421 2:121885519-121885541 GCCCCTCAGGGTTAGGCTCAGGG + Intergenic
938052814 2:128190660-128190682 GCCCGTCAGGGTCAGGGTCAGGG + Exonic
938381415 2:130838275-130838297 ACCTTTCAGGGTTAGTGTGAAGG + Intronic
940255219 2:151721333-151721355 GCCTTTCAAGGTCCTGCTGCCGG + Intronic
941581620 2:167303839-167303861 GCCTTTCCAGCTCAGTCTGAGGG - Intergenic
941700343 2:168597495-168597517 GCCTTACAGGGTCATTCTCAGGG + Intronic
945429122 2:209744194-209744216 TCCTTTCAGGATTAGGATGAGGG - Intergenic
946387762 2:219395541-219395563 GCCATTCAGGGTCATTCTCAGGG + Intronic
946937400 2:224736368-224736390 GGTTTTCTGTGTCAGGCTGAGGG + Intergenic
947274422 2:228374014-228374036 GCCTTTAAGGTTCAGGCAGCAGG - Intergenic
947661750 2:231874671-231874693 GCCTTTCTGGGTCTGTCAGATGG + Intergenic
948452057 2:238082038-238082060 TGATTTCAGGGACAGGCTGACGG - Exonic
948932721 2:241142309-241142331 GCCTTTCAGGGGCTGTCTGATGG - Intronic
1171110259 20:22474175-22474197 TCCCTGCAGGGTCAGGCTGAAGG + Intergenic
1171238479 20:23546696-23546718 GCGTTTCAGGGTCAGCCTGGGGG - Intergenic
1171243188 20:23587738-23587760 GTGTTTCAGGGTCAGCCTGGGGG + Intergenic
1171371633 20:24666050-24666072 GCTTCTCAGGGTCAGGCCAATGG - Exonic
1171419802 20:25010470-25010492 GCCTTTCAGGCAAAGGCTGTAGG - Intronic
1172207339 20:33173298-33173320 TAATTTCAGGGTCAGGGTGAAGG + Intronic
1173492623 20:43495486-43495508 GGCTTTCAGCCTCAGACTGAAGG - Intergenic
1173524839 20:43723967-43723989 GCTTTGCAGGTTCATGCTGAGGG - Intergenic
1173708609 20:45135403-45135425 CCCTTTCAGACTCAGGCTCAAGG - Intergenic
1176244110 20:64089274-64089296 GCCGTTCAGGGTCCAGCAGAAGG - Intronic
1176592082 21:8656633-8656655 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1178698472 21:34814336-34814358 GGCTTTCAGGGACAAGCAGACGG + Intronic
1178810996 21:35881380-35881402 GCCATACAGGGTCAGTCTCAGGG - Intronic
1180274933 22:10633762-10633784 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1180549405 22:16528689-16528711 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1180787636 22:18555881-18555903 GCCTGTCAGGGCCAGGCAGTGGG - Intergenic
1180836317 22:18931326-18931348 GGCTTTCAGGGTCAGTTTCATGG + Intronic
1181234103 22:21439425-21439447 GCCTGTCAGGGCCAGGCAGTGGG + Intronic
1181244544 22:21495406-21495428 GCCTGTCAGGGCCAGGCAGTGGG - Intergenic
1181355288 22:22293147-22293169 GCATTTCAGGGTCAGGGCCAGGG + Intergenic
1181847477 22:25723327-25723349 GTCTCCCAGGGTCAGGCAGAAGG - Exonic
1182112351 22:27732652-27732674 GCCTCTCCAGGTCAGGCTGGTGG - Intergenic
1183698255 22:39435450-39435472 GCCCTTCAGGGGCTGGGTGAGGG - Intronic
1183884681 22:40869030-40869052 TCCTTTCTGGGACAGGCTGAAGG - Exonic
1184907648 22:47499631-47499653 CCCTTTTGGGGACAGGCTGATGG + Intergenic
1203286409 22_KI270734v1_random:156625-156647 GGCTTTCAGGGTCAGTTTCATGG + Intergenic
950120981 3:10482495-10482517 CCCTTTCCTGGCCAGGCTGATGG + Intronic
950475416 3:13211631-13211653 GGCCTTCAGGGATAGGCTGAGGG - Intergenic
950789123 3:15458431-15458453 GCATTTCAGGGTATGCCTGAGGG + Intronic
952796620 3:37244156-37244178 GCCATCCTGGGTCAGGCTGCTGG + Intronic
956662234 3:71610512-71610534 GCCTTCCAGCAACAGGCTGAAGG - Intergenic
956698170 3:71936120-71936142 GCCATACAGGGTCAGTCTAAGGG + Intergenic
966206157 3:177408743-177408765 GTCCTTCAGTGTCAAGCTGATGG + Intergenic
966416274 3:179693223-179693245 GCCTGGCAGGGTGAGGCTGCAGG - Intronic
969271438 4:6105990-6106012 GCCGGTCAGGGTCAGGGTCAGGG + Intronic
969431277 4:7156105-7156127 CCATTTCAGGGTGATGCTGATGG + Intergenic
969458056 4:7312317-7312339 GCTTCTCAGGGTCCAGCTGAGGG - Intronic
973231046 4:47838644-47838666 GCCTTTTAGGTTCAGCCTGTAGG - Intergenic
976077555 4:81316776-81316798 GCCTTTCAGGATGAGTATGAAGG + Intergenic
977080564 4:92522249-92522271 GCCTTGCAATGTCAGGCTGAAGG + Intronic
980678690 4:136126230-136126252 GCCCTTCAGTCACAGGCTGAAGG - Intergenic
981212513 4:142124714-142124736 GTCCTTCAGGGTAAGGATGAGGG + Exonic
981756460 4:148145683-148145705 TGCTTTCATGGTCAGGCTGTCGG + Intronic
985633867 5:1026651-1026673 GCCTCTCAGGAAAAGGCTGAGGG - Intronic
985721049 5:1489199-1489221 GCTTTGCAGGGTCTGGCTGGGGG - Intronic
986501884 5:8409477-8409499 GCCTCTCAGGGCCAGCCTGTGGG - Intergenic
986632197 5:9784565-9784587 GCTTTTCAGGGGCAGGCTGGCGG - Intergenic
989985684 5:50694828-50694850 GGCTTTCAGGCACAGACTGAAGG - Intronic
995938833 5:117553010-117553032 GCATTACTGGCTCAGGCTGAAGG + Intergenic
996037735 5:118777179-118777201 GCATTTCAGGGTTGGTCTGAAGG + Intergenic
996038745 5:118787318-118787340 CCCTGTCAGGGTGTGGCTGAGGG + Intergenic
996886005 5:128354310-128354332 GCCAGTCTGGCTCAGGCTGAGGG + Intronic
999690282 5:154140512-154140534 GCCTTAAAGGGCCAGGCAGATGG + Intronic
1000372930 5:160554597-160554619 CCCTTTCAGGGTCATTCTCAGGG - Intergenic
1002947747 6:1779155-1779177 CCCTCTCAGGGTCATGCTGGAGG + Intronic
1003674802 6:8193180-8193202 GCCTTTCAGGTTCAGTTTGGAGG - Intergenic
1003728094 6:8789659-8789681 GGCTTTCAGGGCCAGGTAGAGGG + Intergenic
1003899542 6:10641393-10641415 GCCCTTCAGTGTCACCCTGATGG + Intergenic
1006105524 6:31713993-31714015 TCCTTGCAGGGGCAGGCTGGGGG - Exonic
1007107639 6:39294671-39294693 GCCTCTAAGGGTCAGGCTCTTGG - Intergenic
1010818034 6:80383062-80383084 GCATTTTGGGGTCAGGCTGAAGG + Intergenic
1012893927 6:104927670-104927692 GTCTTCCAGACTCAGGCTGATGG + Intergenic
1014290372 6:119551287-119551309 GCCCTTCAGGGTCTGGCTCCTGG + Intergenic
1015734320 6:136381551-136381573 GCCTTTCAGGGTTCTACTGAGGG + Intronic
1018710854 6:166497438-166497460 GGCTTTCTGGGTTAGGCTGTGGG + Intronic
1019187926 6:170231761-170231783 GCCTTTCCAGGTAAGGGTGATGG + Intergenic
1019746778 7:2705222-2705244 GCTTTTCTGGGTCATTCTGATGG + Intronic
1021220483 7:17970095-17970117 GCTTTTCTGGGTCAAGCAGATGG - Intergenic
1022109511 7:27219885-27219907 GGGTGTCAGGGTCTGGCTGAGGG + Intergenic
1024055690 7:45658780-45658802 GTAGTTCAGGGCCAGGCTGATGG + Intronic
1024084007 7:45878657-45878679 GGCTTTGTGGGCCAGGCTGAGGG - Intergenic
1026178875 7:68021434-68021456 GCCTTTCAGCCACAGACTGAAGG - Intergenic
1028512979 7:91645233-91645255 GCCTTTGAAGGTCAGACTAAGGG - Intergenic
1029609776 7:101620702-101620724 GCCTGGCAGGGGCAGCCTGAGGG + Intronic
1032632266 7:133666521-133666543 GCCTTTAAGGGTTATGCTAATGG + Intronic
1035179594 7:157079624-157079646 GCCATCTGGGGTCAGGCTGAAGG - Intergenic
1035332097 7:158103025-158103047 GCCTTACTGGGTCCTGCTGATGG - Intronic
1035744900 8:1954900-1954922 TCCTTTCAGAGGCAGGCTGCAGG - Intronic
1036929116 8:12935984-12936006 GCATTTCAGGGTATGGCTGGAGG + Intergenic
1037272365 8:17144056-17144078 GATCTTCAGTGTCAGGCTGAGGG + Intergenic
1041324880 8:56653399-56653421 GCATTGCAGGGTGAGGCTGGAGG - Intergenic
1041622654 8:59990466-59990488 GACTATGGGGGTCAGGCTGAAGG + Intergenic
1041666918 8:60454751-60454773 GCCTTTCAGGGTCACCAGGAGGG - Intergenic
1044049085 8:87477323-87477345 GATTTTCAGGGTCTGTCTGATGG + Intronic
1047808628 8:128383786-128383808 TTCTTTCATTGTCAGGCTGATGG + Intergenic
1048479708 8:134777528-134777550 GCCTTTTAGGGTAATGGTGAAGG + Intergenic
1049305050 8:141898277-141898299 GAGTTTCAGGGTCAGGCACAGGG - Intergenic
1050128687 9:2386634-2386656 GCCTATGAGGGTCAAGGTGAGGG + Intergenic
1051667547 9:19479758-19479780 GGCTTTCAGAATCAGTCTGAAGG + Intergenic
1053691454 9:40589289-40589311 GCATTTCAGGGTCAGGGCCATGG - Intergenic
1054273349 9:63048196-63048218 GCATTTCAGGGTCAGGGCCATGG + Intergenic
1054302712 9:63390255-63390277 GCATTTCAGGGTCAGGGCCATGG - Intergenic
1054401486 9:64716760-64716782 GCATTTCAGGGTCAGGGCCATGG - Intergenic
1054435094 9:65201080-65201102 GCATTTCAGGGTCAGGGCCATGG - Intergenic
1054495296 9:65820601-65820623 GCATTTCAGGGTCAGGGCCATGG + Intergenic
1055562031 9:77530747-77530769 GTCTTGCAGGCTCAGGCTGCTGG + Intronic
1055933280 9:81581470-81581492 ACCTTTCAGGGTCTGGAGGATGG - Intergenic
1056683721 9:88742462-88742484 GGCTTCCAGGGTCAGGCAGTGGG - Intergenic
1056811924 9:89771721-89771743 GCATGTGAAGGTCAGGCTGAGGG + Intergenic
1059425856 9:114220531-114220553 GCCTGGCTGGGTCAGGCTCAGGG - Intronic
1060666422 9:125434757-125434779 GCATTTTAGGGGCAGGCAGATGG + Intergenic
1060943583 9:127557257-127557279 GCCTGGAAGGGTCAGTCTGAAGG + Intronic
1203622133 Un_KI270749v1:135480-135502 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1185579435 X:1198643-1198665 CTCTTTCTGGGTCAGGGTGAAGG - Exonic
1187236729 X:17474881-17474903 GCCTGTCTGGGTCTGGCTGGGGG - Intronic
1189767132 X:44383179-44383201 CCCTAGCAGGGTCAGGATGAGGG + Intergenic
1190058777 X:47197705-47197727 GCCTTGCTGGGTCAGGGTCATGG + Intronic
1192451043 X:71245243-71245265 ACTTTTCAGGGTCATGCTCAGGG + Intronic
1197472643 X:126882412-126882434 TTCTTTCAGGGCCAGGCTCAAGG + Intergenic
1201190146 Y:11437961-11437983 GCATTTCAGGGTCAGGGCCAGGG - Intergenic
1201225590 Y:11815748-11815770 GCCTTTTAGGGTCTGGTGGAGGG - Intergenic
1202255630 Y:22917386-22917408 GCCTCTCAGTGTTAGGCTTAGGG + Intergenic
1202408621 Y:24551135-24551157 GCCTCTCAGTGTTAGGCTTAGGG + Intergenic
1202462161 Y:25118945-25118967 GCCTCTCAGTGTTAGGCTTAGGG - Intergenic
1202583482 Y:26403966-26403988 GCATTTCAGGGTCAGGGCCAGGG + Intergenic