ID: 905654390

View in Genome Browser
Species Human (GRCh38)
Location 1:39676762-39676784
Sequence GGGCACCAGCCGATCTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905654390_905654401 27 Left 905654390 1:39676762-39676784 CCTTCTGAGATCGGCTGGTGCCC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 905654401 1:39676812-39676834 AAGGAGCAAATCATACAGAGGGG 0: 1
1: 0
2: 0
3: 18
4: 235
905654390_905654400 26 Left 905654390 1:39676762-39676784 CCTTCTGAGATCGGCTGGTGCCC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 905654400 1:39676811-39676833 TAAGGAGCAAATCATACAGAGGG 0: 1
1: 0
2: 1
3: 24
4: 418
905654390_905654397 8 Left 905654390 1:39676762-39676784 CCTTCTGAGATCGGCTGGTGCCC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 905654397 1:39676793-39676815 AGGACCTGGAGGGATATTTAAGG 0: 1
1: 0
2: 2
3: 20
4: 168
905654390_905654392 -6 Left 905654390 1:39676762-39676784 CCTTCTGAGATCGGCTGGTGCCC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 905654392 1:39676779-39676801 GTGCCCGATCATGCAGGACCTGG 0: 1
1: 0
2: 0
3: 6
4: 65
905654390_905654399 25 Left 905654390 1:39676762-39676784 CCTTCTGAGATCGGCTGGTGCCC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 905654399 1:39676810-39676832 TTAAGGAGCAAATCATACAGAGG 0: 1
1: 1
2: 1
3: 13
4: 180
905654390_905654396 -2 Left 905654390 1:39676762-39676784 CCTTCTGAGATCGGCTGGTGCCC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127
905654390_905654394 -3 Left 905654390 1:39676762-39676784 CCTTCTGAGATCGGCTGGTGCCC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 905654394 1:39676782-39676804 CCCGATCATGCAGGACCTGGAGG 0: 1
1: 0
2: 3
3: 13
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905654390 Original CRISPR GGGCACCAGCCGATCTCAGA AGG (reversed) Intergenic
900228661 1:1544814-1544836 GGGCTCCAGCAGCTCTCACAGGG - Intronic
905654390 1:39676762-39676784 GGGCACCAGCCGATCTCAGAAGG - Intergenic
905884202 1:41482946-41482968 GGGGACCAGCCTGTCTGAGAGGG - Intronic
906841360 1:49143064-49143086 GGGCAACAGCAGGTCTCAGGGGG - Intronic
916404312 1:164482392-164482414 AGACCCCAGCCTATCTCAGAGGG - Intergenic
920414131 1:205786806-205786828 AGGCGCCAGCCTATCTCTGATGG - Intergenic
920850050 1:209622593-209622615 GAGCGCCAGCCGCTCCCAGATGG - Exonic
922001894 1:221487173-221487195 AGGCACCAGCCCAGCTGAGAGGG - Intergenic
922994470 1:229944717-229944739 GGGCACCAGCCGACCGCACCTGG - Intergenic
923225766 1:231937683-231937705 GGGCACTTGGAGATCTCAGAAGG + Intronic
1063449038 10:6139177-6139199 AGGAACCAGGAGATCTCAGAGGG - Intergenic
1065108965 10:22421361-22421383 GGGCACCAGCACTTCTCAGGGGG - Intronic
1071203825 10:83251821-83251843 GGGCACCATGCCATCTGAGAGGG + Intergenic
1075711554 10:124533514-124533536 GGGGACCAGCCCCTCCCAGAAGG + Intronic
1076626582 10:131824723-131824745 GGGCTCCGGCAGAGCTCAGAGGG + Intergenic
1080114928 11:28611401-28611423 GGGCACTAGTAGATATCAGAGGG - Intergenic
1081848017 11:46254353-46254375 GGGCACCAACTGACCTCAGGAGG + Intergenic
1083715891 11:64576798-64576820 GGGCCCCAGGGCATCTCAGAAGG - Intergenic
1084332690 11:68439227-68439249 GGGCACCTGCAGACCTCACAGGG - Intronic
1089379068 11:118014799-118014821 GAGCACCAGACGTTCTTAGAAGG - Intergenic
1090440460 11:126721012-126721034 GGGCACCAGCCGAGCTGGCAAGG + Intronic
1102480628 12:113221057-113221079 GGTTACCCGCCAATCTCAGAAGG + Exonic
1107015192 13:35702549-35702571 GTGCAGCAGCAGAACTCAGAGGG - Intergenic
1109211357 13:59538892-59538914 GGGCACCAGCTGAGCACAGCAGG + Intergenic
1115651249 14:35404216-35404238 GGGCACCGGCCCAACTCGGAGGG - Intronic
1118523634 14:66616616-66616638 GGGCACCAGCCTATGCCAGTAGG + Intronic
1119424511 14:74527085-74527107 GGGCCCCAGCCCATCCCAAATGG + Intronic
1122768797 14:104087946-104087968 GAGCACCAAGGGATCTCAGAAGG - Intronic
1128331424 15:66757950-66757972 GGCCACCAGCAGAGCCCAGAGGG + Intronic
1128758621 15:70199675-70199697 GGGGACCAGCCCATCTATGAGGG + Intergenic
1129459005 15:75690563-75690585 GGGAACCAGCCGACCCCTGAGGG - Exonic
1132802388 16:1760839-1760861 GGGCTCCAGCCCTTCTCTGATGG + Intronic
1134215937 16:12316960-12316982 GGGCAGGAGCCCATCACAGAGGG + Intronic
1135825327 16:25722250-25722272 GGGCTCTACCAGATCTCAGAGGG + Intronic
1136592205 16:31224327-31224349 GCGCACCAGCAGCTCTCCGAGGG + Exonic
1138527274 16:57616359-57616381 GGGCAGCACCAGCTCTCAGAGGG + Intronic
1138580004 16:57934608-57934630 GGACACGAGATGATCTCAGATGG + Intronic
1142366755 16:89654184-89654206 TGGTACCAGCCAATCTCAAAGGG + Intronic
1149776882 17:59365283-59365305 GGGGACCAGCAGGTCTCAGGAGG + Intronic
1149884909 17:60330123-60330145 GGGCACCAGCGGACCTGAGGAGG - Intronic
1153227202 18:2907963-2907985 GGGCACCAGGCTATCACCGATGG - Intronic
1155436791 18:25820966-25820988 GTGCACCAGCCTGTCTCTGAAGG - Intergenic
1161349325 19:3783559-3783581 GGCCCCCATCCCATCTCAGATGG - Intronic
1161943391 19:7419509-7419531 GGCCTCCAGCCTGTCTCAGAAGG + Intronic
1167713738 19:51127490-51127512 GGGCAGGAGTGGATCTCAGAGGG + Intronic
1168259912 19:55187567-55187589 GGGCCACAGCCAGTCTCAGATGG - Exonic
1168471789 19:56646119-56646141 GGCCACTGGTCGATCTCAGATGG + Intronic
1168582251 19:57565334-57565356 AGGCACCCCCCGATATCAGAAGG - Intergenic
925627475 2:5855591-5855613 GGGGAAGAGCAGATCTCAGAGGG - Intergenic
926764554 2:16312888-16312910 GGGCAGGAGCTGATCTCACAAGG + Intergenic
930033996 2:47074430-47074452 GGGGCCCAGCTGGTCTCAGAGGG - Exonic
932076606 2:68670127-68670149 GGGCACAAGTCTATCTGAGATGG - Intergenic
932322187 2:70830431-70830453 GGGTGCCAGCCGAGCTCTGAAGG + Exonic
934287255 2:91659326-91659348 GGGCCCCACCCCATCACAGAGGG + Intergenic
935130289 2:100256584-100256606 GGGCACCAGCAGAGATCAGGTGG - Intergenic
936229488 2:110687622-110687644 GAGAACAAGCCGATCTCACAGGG + Intergenic
941045109 2:160665973-160665995 TGTCACCAGCCAAGCTCAGACGG + Intergenic
944222939 2:197320430-197320452 AGGCCCCAGCAGATCCCAGAGGG - Intergenic
948055911 2:235009221-235009243 TGGCACCTGCAGAGCTCAGAGGG - Intronic
1172188682 20:33048667-33048689 GGGCACCAGCTGATCATAGGAGG - Intergenic
1175612469 20:60363225-60363247 GAGCACCTGCTGACCTCAGAGGG + Intergenic
1176109038 20:63402836-63402858 GGGCACCTGCCCTGCTCAGACGG + Intergenic
1179957268 21:44748676-44748698 GGGCATCAGCAGCTCTCAGGGGG + Intergenic
1180080951 21:45487308-45487330 GGGGAGCCGCCGTTCTCAGATGG - Intronic
1183548699 22:38468814-38468836 GGGCACCAGCCGGGCTCAGGCGG + Intronic
1184568482 22:45307934-45307956 GGCTCCCAGCCTATCTCAGATGG + Intergenic
1184654838 22:45935833-45935855 GGGCAGCTGCTGAGCTCAGATGG - Intronic
968599203 4:1501260-1501282 GGGCACCAGCCGAGCCCTGGGGG + Intergenic
969312509 4:6362151-6362173 CGGCGCCAGCAGAACTCAGAGGG + Intronic
983553404 4:169038653-169038675 GGGCAGCAGTAGGTCTCAGATGG + Intergenic
985573316 5:662264-662286 GGGCACCACCCGACCTCGCAGGG - Exonic
995917245 5:117262682-117262704 GGGCACCAGCTGCTCTCTGCTGG + Intergenic
1001288703 5:170441427-170441449 GGGCACCAGAGGCTCACAGATGG - Intronic
1002531357 5:179847820-179847842 GGGCAGCTGCTGACCTCAGATGG + Intronic
1002772453 6:301411-301433 TGGCTCCAACCGATCTCTGAAGG - Intronic
1013734158 6:113206268-113206290 GTTCACCAGCAGATCTCAGAAGG + Intergenic
1017498383 6:155001507-155001529 GGGCACCAGCCTATGTCTGCTGG - Intronic
1018160294 6:161034864-161034886 GGGCACCAGCAGAGAGCAGAGGG - Intronic
1018244183 6:161806029-161806051 GGGCACCAGTTCATCCCAGAAGG - Intronic
1021576597 7:22111004-22111026 GGGCAACAAGCCATCTCAGAGGG - Intergenic
1022992212 7:35719790-35719812 GGGCACCAAAGAATCTCAGATGG - Intergenic
1028307870 7:89289619-89289641 GGGCACCAGCTGAGTTCAGCTGG - Intronic
1031863746 7:127013952-127013974 GTGCATCAGCCCATCTCATAAGG + Intronic
1034908343 7:154971148-154971170 GTGCTCCATCTGATCTCAGAGGG + Intronic
1040904617 8:52453616-52453638 GGGCATCAGCCAATCTGTGAGGG + Intronic
1046024984 8:108711724-108711746 TGGCACCAGCCCATGTAAGAGGG + Intronic
1047805298 8:128353214-128353236 GGGCACCAGCTGGGCTCAGTAGG + Intergenic
1058650857 9:107174680-107174702 GGGCACCAGCAGGGCCCAGATGG + Intergenic
1060814344 9:126626847-126626869 GGGAACCGGCCGAGTTCAGAGGG + Intronic
1061483564 9:130909003-130909025 GGGCACCAGCCGGGGTCAGGAGG - Intronic