ID: 905654396

View in Genome Browser
Species Human (GRCh38)
Location 1:39676783-39676805
Sequence CCGATCATGCAGGACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905654390_905654396 -2 Left 905654390 1:39676762-39676784 CCTTCTGAGATCGGCTGGTGCCC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905654396 Original CRISPR CCGATCATGCAGGACCTGGA GGG Intergenic
900265341 1:1754369-1754391 CACCTCATTCAGGACCTGGAGGG + Exonic
901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG + Exonic
904378290 1:30095308-30095330 CCAATCTTGCAGGGCCTGGGTGG - Intergenic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
905341538 1:37281797-37281819 CAGATTATGCAGGGCCTGGGAGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
910667562 1:89741506-89741528 CAGACAATGCAGTACCTGGAGGG + Intronic
914234445 1:145795412-145795434 CCAATCAAGCAGGACGTGGGCGG - Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
924623931 1:245685135-245685157 CTGGTCAGGCAGGGCCTGGATGG + Intronic
1069932410 10:71891647-71891669 CGCAGCATGCAGGCCCTGGAGGG + Intergenic
1073290516 10:102410991-102411013 CCAGACATGCAGGACCTGGGAGG - Intronic
1076218673 10:128715956-128715978 CCCAGCACACAGGACCTGGATGG - Intergenic
1076546058 10:131246378-131246400 GCGGCCATGCTGGACCTGGAGGG + Intronic
1081596719 11:44464323-44464345 CTGGTCATCCAGGAGCTGGAAGG + Intergenic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1084440701 11:69171194-69171216 GCAATCATGAAGGACCTGGTGGG - Intergenic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1090387992 11:126367528-126367550 ACAAGCATTCAGGACCTGGAAGG - Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091985417 12:4907318-4907340 CAGATCATGCAGGGCCTCTAAGG - Intergenic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1095202969 12:39407111-39407133 TCGACAATGCAGGAGCTGGAAGG - Intronic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1096518142 12:52169649-52169671 CTGATCATGCAGAAACAGGAAGG + Exonic
1097703542 12:62845080-62845102 CCGACCAAGAAGGCCCTGGAGGG + Intronic
1097973400 12:65659406-65659428 TGGATCATGCAGGACCTCGCAGG - Intergenic
1099184446 12:79502671-79502693 CCAATCATGGAGGACGGGGAAGG + Intergenic
1101625848 12:106440448-106440470 CAGATTGTGCAGGAACTGGAAGG - Intronic
1101650860 12:106675918-106675940 CCAATTAGGCAGGACCTGGTGGG + Intronic
1101798769 12:108002320-108002342 CTGATCCTGTAGGACCTTGAGGG - Intergenic
1103185297 12:118951712-118951734 CCTATGATTCAGGACCTGGGTGG + Intergenic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1104732223 12:131113801-131113823 CAGGTCATGCGTGACCTGGAGGG - Intronic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1107821029 13:44285843-44285865 CAGTTCATGCAGGACCTGAGGGG - Intergenic
1108266952 13:48720416-48720438 GCAAACATGGAGGACCTGGAGGG + Intergenic
1110064765 13:71089386-71089408 CAGATCATGTAGAACCTGGTGGG + Intergenic
1112078466 13:95938788-95938810 CCAATCCAGCAGCACCTGGATGG + Intronic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1115223315 14:31078772-31078794 GTGATTATGCAGGACTTGGACGG + Intronic
1117583042 14:57172140-57172162 CCGATCTTGCAGATCTTGGATGG - Intergenic
1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG + Intergenic
1129333940 15:74841481-74841503 CCGTTCATGCAGGAATTGCAGGG + Exonic
1134023720 16:10939415-10939437 CATACCATGGAGGACCTGGAAGG - Intronic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG + Intronic
1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG + Intergenic
1142619166 17:1154159-1154181 AGGATCATGAAGGACCTGGGAGG - Intronic
1149576458 17:57716777-57716799 CCTATATTCCAGGACCTGGATGG + Intergenic
1150211953 17:63446514-63446536 CCGATCATGGGGGCCCCGGAGGG - Intergenic
1152604752 17:81283494-81283516 CCGATCATGCTGCACAGGGACGG + Exonic
1158508535 18:58068813-58068835 AGGAGCATGAAGGACCTGGAGGG - Intronic
1161170907 19:2812096-2812118 CCGATCACGCAGATCCCGGAAGG - Intronic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1162925284 19:13927885-13927907 GCGACCATCCAGGACCTGGGTGG - Exonic
1166563672 19:43750164-43750186 CAAATCATGTAGGACCTGGTAGG - Intronic
1166588715 19:43975378-43975400 TAGATCATCCAGGACATGGATGG + Intronic
1166891188 19:45994813-45994835 CCGATCAGTCATGAACTGGAAGG - Intergenic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1168371281 19:55836531-55836553 CCAATCATTAAGGACCAGGAAGG + Intronic
1168486249 19:56764834-56764856 CCGATCGTGGAGGACCTGGAGGG - Intergenic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933613810 2:84463302-84463324 CAGATCATGCCAGACCTGGGAGG + Intergenic
935799439 2:106678885-106678907 CAAATCGTGAAGGACCTGGAGGG - Intergenic
936410296 2:112252581-112252603 CCAATCATGGAGGAACTGGTAGG - Intronic
939730405 2:145777571-145777593 CTCATCATGCTGGACATGGAGGG - Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
943368385 2:186985765-186985787 CCGATCATGCATGACCCAAATGG + Intergenic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
947671648 2:231940761-231940783 CGGGTCATGCAGGACCAGGATGG - Intergenic
1169482595 20:5998249-5998271 CCTATAATGCAGGGGCTGGAAGG + Intergenic
1170116812 20:12869280-12869302 GCCATGATGCAGGACATGGAAGG + Intergenic
1172807105 20:37619913-37619935 CAGAACATGCAGGACCTCGTAGG + Intergenic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1176167066 20:63679922-63679944 CAGATCATCCAGCACCTGGCAGG + Exonic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177626604 21:23670308-23670330 CCAATCATGCAGGTCTTAGAGGG + Intergenic
1177809054 21:25905231-25905253 CCGAGCATCGAGGACCAGGAGGG + Intronic
1178942419 21:36917163-36917185 CAGATCATGTAGGAGCTGGCAGG - Intronic
1181065999 22:20306344-20306366 CCTCTCATGCAGGGCCGGGAGGG - Intergenic
1184730713 22:46369635-46369657 CCAAACATGCATGAGCTGGAAGG - Intronic
954998018 3:54899827-54899849 CCGTTCATCCAGGAGCTGGATGG - Exonic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
959833913 3:110896302-110896324 CAGATCATCAAGGACCTGTAGGG - Intergenic
962072713 3:132048360-132048382 TGGATCATGCAGGACCTTGCAGG - Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
967866413 3:194193680-194193702 CAGGTCATGAAGGACCTAGACGG + Intergenic
968056641 3:195696956-195696978 CGGACAATGCAGGAGCTGGATGG - Intergenic
972263971 4:37440723-37440745 ACCATCATGCAGGACTTGAAAGG - Intronic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
984386622 4:179067907-179067929 TTGATGAAGCAGGACCTGGAAGG + Intergenic
985606779 5:862154-862176 CTGATCCTGCAGGACTTAGAGGG - Intronic
986748619 5:10765221-10765243 CCCATCATGCAGGGTCTGGTAGG - Intergenic
988894675 5:35659086-35659108 CCGAACATGCATGAGCTGCACGG - Exonic
997367544 5:133335544-133335566 CCAACCATGCAAGGCCTGGAGGG - Intronic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
998269876 5:140696990-140697012 CAGAACAAGCAGGCCCTGGAGGG + Exonic
999411270 5:151351936-151351958 TGGATCATGCAGGACCTTGTGGG - Intergenic
1002992955 6:2254890-2254912 GCCATCAGGCAGGATCTGGATGG - Intergenic
1003065399 6:2900607-2900629 TCCATGATGCAGGGCCTGGAAGG + Exonic
1005136961 6:22580272-22580294 CTGATCCTGTAGGACCAGGATGG + Intergenic
1009994081 6:70879911-70879933 CCAACCATGCAGGGCCTGGGAGG + Intronic
1013767055 6:113587187-113587209 TCTCTCATTCAGGACCTGGAAGG - Intergenic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG + Intergenic
1028984829 7:97001671-97001693 CAAACCAGGCAGGACCTGGATGG - Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1035070679 7:156143276-156143298 CCGAGCATGCTGGGCCTGGCCGG + Intergenic
1035160216 7:156944614-156944636 CAGATCCTGCAGCTCCTGGACGG + Intergenic
1035662096 8:1356008-1356030 CCGATCATGCAAGGCAGGGAGGG - Intergenic
1041364044 8:57082948-57082970 CTGCTCCTGCAGGACCTGGGAGG + Intergenic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG + Intronic
1048904019 8:139069479-139069501 CGGATCACTCAGGACCTGGTAGG + Intergenic
1055392530 9:75838390-75838412 CAGATCATGGAGAACCTGGTGGG - Intergenic
1056578845 9:87876011-87876033 CCACCCAGGCAGGACCTGGACGG + Intergenic
1056835390 9:89951096-89951118 CTGAGGATGCAGGACCAGGAAGG + Intergenic
1057030270 9:91769763-91769785 CAGATCATGAAGGTACTGGAGGG - Intronic
1057119637 9:92559475-92559497 CTGCTCCTGCAGGACCTGGGAGG - Intronic
1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG + Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1190302561 X:49065167-49065189 CTGATCATGCAGGATGTGGTCGG - Intronic
1192069200 X:67918766-67918788 CTGTTCCTGCAGGACCTGGGAGG - Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1200216173 X:154369152-154369174 CCCAGCAGGCAGCACCTGGAGGG + Intronic