ID: 905655147

View in Genome Browser
Species Human (GRCh38)
Location 1:39682210-39682232
Sequence GAATTCCTAACCAGAACCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905655145_905655147 -10 Left 905655145 1:39682197-39682219 CCCAGGATCAAGAGAATTCCTAA 0: 1
1: 0
2: 2
3: 11
4: 166
Right 905655147 1:39682210-39682232 GAATTCCTAACCAGAACCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 127
905655144_905655147 5 Left 905655144 1:39682182-39682204 CCTATAAAGCATAATCCCAGGAT 0: 1
1: 0
2: 0
3: 6
4: 116
Right 905655147 1:39682210-39682232 GAATTCCTAACCAGAACCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 127
905655141_905655147 20 Left 905655141 1:39682167-39682189 CCTGTGGGACCACATCCTATAAA 0: 1
1: 0
2: 0
3: 6
4: 68
Right 905655147 1:39682210-39682232 GAATTCCTAACCAGAACCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 127
905655142_905655147 11 Left 905655142 1:39682176-39682198 CCACATCCTATAAAGCATAATCC 0: 1
1: 0
2: 0
3: 6
4: 148
Right 905655147 1:39682210-39682232 GAATTCCTAACCAGAACCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905655147 Original CRISPR GAATTCCTAACCAGAACCCC AGG Exonic
902070721 1:13733706-13733728 GAATTCCTACGCAATACCCCAGG - Intronic
902204069 1:14854465-14854487 GAAGTCCTCACCAGAAGCCAGGG - Intronic
902470669 1:16646005-16646027 GAATGCCTAGCCAGGGCCCCTGG + Intergenic
902488134 1:16761455-16761477 GAATGCCTAGCCAGGGCCCCTGG - Intronic
902685090 1:18071273-18071295 CGACTCCTAACCACAACCCCGGG - Intergenic
903144146 1:21359106-21359128 GAATTCCTAAGTAGAACTTCTGG - Intergenic
905091570 1:35434759-35434781 ACAGTCCCAACCAGAACCCCTGG - Exonic
905655147 1:39682210-39682232 GAATTCCTAACCAGAACCCCAGG + Exonic
907917546 1:58884821-58884843 TGCTTCCTAAGCAGAACCCCAGG - Intergenic
909339691 1:74517888-74517910 GAATTTCTAACCAGTTCCCAGGG + Intronic
909867243 1:80688211-80688233 GAATTCTTCCCCAGAACCCCAGG - Intergenic
912302544 1:108533115-108533137 GATGTCCAAACCAGAACCCTGGG + Intergenic
915148799 1:153812336-153812358 AATTTCCTAACCAGAAAACCTGG + Intronic
915325476 1:155079471-155079493 GGAGTCCTAGACAGAACCCCTGG - Intronic
915852577 1:159341787-159341809 AAATTCCTAATCAGATCCCTGGG + Intergenic
916593868 1:166223011-166223033 GAAGTCCTAACCAAAACAACCGG - Intergenic
919825036 1:201497526-201497548 GAATTTTTAACAAGCACCCCAGG + Intronic
1069438871 10:68409780-68409802 GAATTCCTAATCAGAAAACGTGG + Intergenic
1076032204 10:127169206-127169228 GAGTTCCAAAGCAGGACCCCAGG + Intronic
1077350988 11:2093117-2093139 GAACTCCCAACCAGGTCCCCGGG + Intergenic
1077496565 11:2889614-2889636 CAATCCCTACCCAGAGCCCCAGG + Intronic
1078606458 11:12780802-12780824 GAAATCCTTATCAGAATCCCAGG + Intronic
1087940033 11:104085404-104085426 GAATTGCTGAGCAGAATCCCAGG + Intronic
1089355421 11:117848104-117848126 GAATTCCTACCCAGTACACTAGG - Intronic
1091202660 11:133793945-133793967 AAAACCCTGACCAGAACCCCTGG - Intergenic
1093751184 12:22802250-22802272 CAATTCCTAACCACAATCCTAGG - Intergenic
1095365089 12:41393862-41393884 GAACTGATAACCAGAACACCTGG + Intronic
1102085647 12:110137050-110137072 AAATTCCTAACCAGATGGCCGGG + Intronic
1102807777 12:115797021-115797043 CAATTCTTAGCCAGAAGCCCTGG - Intergenic
1103906695 12:124331371-124331393 GCATTTCTAACCAGTACCCTGGG + Intronic
1107677924 13:42816266-42816288 GGGTTCCTAACCAGAGTCCCAGG - Intergenic
1107786092 13:43959404-43959426 GAATTCTTAGCCAGAGTCCCTGG - Intergenic
1110170964 13:72499499-72499521 GAATTCCTACCCACAGCCCCTGG + Intergenic
1112990407 13:105506584-105506606 GTATTTCTAACCAGCACCCTGGG + Intergenic
1113593796 13:111517977-111517999 GGATTCCTCACCAGCCCCCCCGG + Intergenic
1113720504 13:112552666-112552688 GAAGCCCAAACCAGAACCCTGGG + Intronic
1117294096 14:54363128-54363150 GAATTCCTAATCACCACCTCTGG - Intergenic
1120388457 14:83875570-83875592 AAATTCCTAAACATAAACCCTGG - Intergenic
1122431120 14:101645784-101645806 GAAGTCCTAACTAGAACAACTGG + Intergenic
1127643549 15:60937678-60937700 GAGTTCTGAACCAGAACACCTGG + Intronic
1131438341 15:92440379-92440401 GCATTTCTAACAAGCACCCCAGG + Intronic
1131856878 15:96606461-96606483 AAATTTGTAACCAGAACCCAGGG + Intergenic
1137228832 16:46541923-46541945 GAAGTCCTAGCCAGTACCACAGG - Intergenic
1139060753 16:63248446-63248468 GACTTTCTAACCAGAAACCATGG + Intergenic
1139926950 16:70493980-70494002 GACTTCCTAATCACAGCCCCTGG - Intronic
1140601843 16:76485662-76485684 GCATTACTAACAAGTACCCCAGG + Intronic
1145839536 17:27982910-27982932 GACTTCCTAAATAAAACCCCTGG - Intergenic
1146448754 17:32954812-32954834 GAATAACTAACCAGAACACATGG + Intergenic
1149269942 17:54967354-54967376 GACTTCCTAACCAGAATCTCTGG + Intronic
1155620198 18:27769274-27769296 AAACTCCAAAGCAGAACCCCAGG - Intergenic
1156179253 18:34583794-34583816 AAATTCTTAACAAGAACACCTGG + Intronic
1159346800 18:67216314-67216336 GAATTCCCAAGCACAACCCAGGG - Intergenic
1161744556 19:6047762-6047784 GAATTCCTCAACAGAAGGCCGGG + Intronic
1165886461 19:39082535-39082557 GAATTCCCAACCACCAGCCCAGG - Intergenic
926758085 2:16252000-16252022 GAATTCCTGAGCAGAACCAAGGG - Intergenic
927468198 2:23352325-23352347 GAGTTCTTCACCAGAATCCCCGG + Intergenic
928292915 2:30055658-30055680 AAATTCCTAATCTGAATCCCAGG + Intergenic
928353778 2:30588500-30588522 GAATTCCTAACCAGACTCTGAGG + Intronic
929131578 2:38579646-38579668 GAATCCCTAACCAGGACGCCAGG - Intronic
929307667 2:40382069-40382091 TAGGACCTAACCAGAACCCCTGG + Intronic
933847615 2:86337925-86337947 GAAGTCCGAACCTGAACCTCGGG + Intronic
933996093 2:87671115-87671137 GAATTGCTCCCCAGAACCGCTGG + Intergenic
935233374 2:101118282-101118304 GAAGTCCTAGCCAGAGCCACTGG + Intronic
936297762 2:111279797-111279819 GAATTGCTCCCCAGAACCGCTGG - Intergenic
938919440 2:135981404-135981426 GCATTCCTAACCCGAAAACCCGG + Intronic
940015469 2:149099890-149099912 CACTTCCTAACCAAAGCCCCTGG - Intronic
941361561 2:164557880-164557902 GAATTCATATCCAGGACTCCTGG - Intronic
943723369 2:191228509-191228531 GCATGCCTAACCAGGACCACAGG - Intergenic
946042686 2:216795981-216796003 GAATCCCTACCCAAAACCCCAGG - Intergenic
946044204 2:216807694-216807716 GCATTTCTAACAAGAACCTCTGG - Intergenic
946466518 2:219916874-219916896 TAATTCCTGACCACCACCCCAGG + Intergenic
946767846 2:223056660-223056682 GAATTTCTAAGCAGAACCTAAGG + Intronic
1170702007 20:18712241-18712263 AAATTACAAACAAGAACCCCTGG - Intronic
1174667822 20:52276622-52276644 GCATTCCTAACCTGTACCCATGG - Intergenic
1176765052 21:13008339-13008361 GTATTCCTTACCAAAACCTCTGG - Intergenic
1177085302 21:16695429-16695451 GAATTCCTCCCCAGAAAACCTGG + Intergenic
1179494794 21:41764716-41764738 ACATTCCTAACAAGAACCTCAGG + Intronic
1179570584 21:42276362-42276384 GAATTCCTAACTCGCACCACTGG + Intronic
1181147252 22:20858180-20858202 GAAATCGGAAGCAGAACCCCAGG + Intronic
953097820 3:39795882-39795904 GAATTCTGACCCACAACCCCTGG - Intergenic
954298762 3:49688249-49688271 GAATGCCTAGCCAGGGCCCCTGG - Intronic
955636012 3:61030277-61030299 GCATTTTTAACAAGAACCCCAGG + Intronic
960583062 3:119296781-119296803 GAATGGCAAACCAGTACCCCGGG + Intronic
962094481 3:132279229-132279251 GAATTTCTTACCAGCTCCCCAGG + Intronic
966120872 3:176518677-176518699 GTATTCCAAGCCAGAAACCCGGG - Intergenic
966470080 3:180279507-180279529 GAATTCAAAGCCAGAATCCCTGG + Intergenic
968623364 4:1614627-1614649 GGCTTCCTAGACAGAACCCCAGG - Intergenic
969629316 4:8326400-8326422 GATCTCCTCACCAGAACCCCTGG + Intergenic
972839979 4:42919285-42919307 GGATAACTAACAAGAACCCCTGG - Intronic
975782468 4:77854036-77854058 GAAAGCCTGACCAGAACCTCTGG + Intergenic
982269233 4:153569615-153569637 GAATTCCAAACCAGACCACCTGG + Intronic
983126255 4:163954710-163954732 GAATTTGTAACAAGATCCCCAGG - Intronic
983374366 4:166905632-166905654 GAAGTCCTAACCAAAACCTAAGG + Intronic
985204326 4:187518182-187518204 GATTTCCTAACCAAAACACAAGG + Intergenic
985767907 5:1790252-1790274 GAATTGCTACCCAGAAATCCTGG - Intergenic
986382406 5:7199963-7199985 GAAATACTAACCAGCAACCCTGG + Intergenic
990859768 5:60314077-60314099 GAACTCCTAGCCAGAACAACAGG + Intronic
997013814 5:129906486-129906508 GAAGTCCTTCCCAGAACCACAGG + Intronic
998136150 5:139675764-139675786 GAATGCCTCCCCAGAACCCCGGG - Intronic
998896284 5:146803686-146803708 GTATTCCTTACCATTACCCCAGG - Intronic
1000881542 5:166703548-166703570 GAATTCCTGGCCAGAAGCCAGGG - Intergenic
1002540526 5:179903509-179903531 GAATCCTGAACCAGTACCCCGGG + Intronic
1003450436 6:6226305-6226327 GAATTCCTAACAAGCTCCCAGGG - Intronic
1005704974 6:28442560-28442582 CAAATCCTAACTAGAAGCCCAGG + Intronic
1006217379 6:32455998-32456020 GAAGTCCTGACCAGAACATCAGG + Intergenic
1006744656 6:36332875-36332897 GAATGCCAAACCTGAGCCCCTGG + Intronic
1007228405 6:40330632-40330654 GCATTTCTAACCAGCTCCCCAGG - Intergenic
1009540791 6:64955660-64955682 GAATGCCTAAGCAAAACCCATGG - Intronic
1010765750 6:79776104-79776126 CAATTCCCCACCAAAACCCCAGG - Intergenic
1014616943 6:123614082-123614104 GCATTCCTAACAAGCCCCCCAGG - Intronic
1016655817 6:146517229-146517251 AAAATCCTTACCAGAACCACAGG - Intergenic
1019754674 7:2760331-2760353 GAATGCCTTACCAGTACACCAGG + Intronic
1023177414 7:37448041-37448063 TATTTACTAACCAGAACCTCAGG + Intronic
1023292710 7:38685109-38685131 CAATTCCTACCCCTAACCCCTGG - Intergenic
1024274834 7:47669163-47669185 GAAGTCCTAACCAGAATCTCAGG - Intergenic
1025118964 7:56283311-56283333 GAATTTCACATCAGAACCCCTGG + Intergenic
1030171829 7:106610218-106610240 TAAGTCCTATCCAGAACTCCAGG + Intergenic
1030597611 7:111558793-111558815 GATTTCCAGATCAGAACCCCAGG - Intronic
1031631981 7:124054177-124054199 GTTTTTCTTACCAGAACCCCTGG + Intergenic
1032924239 7:136584686-136584708 GTATTCCCATCGAGAACCCCAGG - Intergenic
1033437127 7:141343310-141343332 AAATTCATAATCAGAATCCCAGG - Intronic
1035764069 8:2091683-2091705 GAACTCATACCCAGAACCACAGG + Intronic
1036732130 8:11275221-11275243 GAATACCAAACCAGCTCCCCAGG + Intergenic
1048214638 8:132482699-132482721 GAGTTCATGACAAGAACCCCAGG + Intergenic
1048349264 8:133603021-133603043 GCATTTCTAACCAGCACCCAGGG + Intergenic
1048970746 8:139643758-139643780 AAATTCCTCCCCAGGACCCCTGG + Intronic
1049590809 8:143461279-143461301 GAAATGCAAACCAAAACCCCAGG + Intronic
1052838057 9:33265849-33265871 GTATTCCCAACCAGAAACCCTGG - Intronic
1053036848 9:34833343-34833365 CAATTCCAAAGCAGTACCCCAGG - Intergenic
1055934477 9:81592047-81592069 GATTTCTAAACCATAACCCCAGG - Intronic
1055997184 9:82172718-82172740 AAATTCCTCACCAGAAGCCAAGG - Intergenic
1057556099 9:96088879-96088901 TCATTCCTCACGAGAACCCCTGG + Intergenic
1060777784 9:126389078-126389100 AACTTCCCAACCAGGACCCCTGG - Intronic
1186444476 X:9614996-9615018 GACTTCCTGATCAGAAACCCAGG - Intronic
1189490667 X:41469313-41469335 GAATTCCTAGCAAATACCCCTGG - Intronic
1195527054 X:105902983-105903005 GAATTCCTACCCAGAAACTAGGG - Intronic
1195741079 X:108064948-108064970 GACTTCCAAACCAGAAAGCCAGG - Intronic
1200915445 Y:8567329-8567351 GAAATCTTAAGCAGAGCCCCAGG + Intergenic