ID: 905660368

View in Genome Browser
Species Human (GRCh38)
Location 1:39718001-39718023
Sequence TAGAGTCACTGCACCACCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905660364_905660368 13 Left 905660364 1:39717965-39717987 CCAGATATGGGTGAATTGAGCGC 0: 1
1: 0
2: 0
3: 2
4: 35
Right 905660368 1:39718001-39718023 TAGAGTCACTGCACCACCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 54
905660363_905660368 14 Left 905660363 1:39717964-39717986 CCCAGATATGGGTGAATTGAGCG 0: 1
1: 0
2: 0
3: 5
4: 49
Right 905660368 1:39718001-39718023 TAGAGTCACTGCACCACCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905660368 Original CRISPR TAGAGTCACTGCACCACCGC CGG Intronic
901174759 1:7290919-7290941 GAGAGTCACTTCACCCCCCCAGG - Intronic
904379181 1:30099874-30099896 TATAGTCGCTGCCCCACAGCAGG - Intergenic
905304874 1:37010681-37010703 GCGAGTCACTGCGCCATCGCAGG + Intronic
905660368 1:39718001-39718023 TAGAGTCACTGCACCACCGCCGG + Intronic
907985062 1:59522424-59522446 TAGAGTCACTTCTCCACCCTGGG - Intronic
917982053 1:180275840-180275862 GGGAGTCCCTGCACCACCACTGG - Exonic
920663012 1:207934094-207934116 TAGAGTCACTATACCATCACTGG + Intergenic
1064146849 10:12832710-12832732 TAGAGTCTCTGAGCCACCGCTGG + Exonic
1067734788 10:48841812-48841834 CAGAGTCACTGCACACCTGCTGG + Intronic
1072119684 10:92395452-92395474 TGCAGTCACTGCACCATGGCAGG + Intergenic
1073331453 10:102672662-102672684 TAGAGACACAGCAGCACAGCTGG - Intergenic
1074823557 10:117198857-117198879 AAGGGACACTGCACCATCGCAGG + Intronic
1076115168 10:127890600-127890622 AACAGTCAGTCCACCACCGCTGG + Intronic
1089846177 11:121460438-121460460 TAGAGCCACTGCACTCCAGCTGG - Intronic
1095736150 12:45558644-45558666 TAGAGACACTATACCACCACTGG + Intergenic
1097317322 12:58185824-58185846 TAAAGTGACAGCACCACCACTGG - Intergenic
1097332889 12:58351580-58351602 TAGTTTCACTGCACCACTGGAGG - Intergenic
1100278222 12:93092049-93092071 CAGAGGCACTGCACAACCGAGGG - Intergenic
1104655392 12:130570682-130570704 TAGAGTCACTGCTCCACAGAGGG - Intronic
1107072067 13:36281219-36281241 TACAGCCACTGCACCACCCCTGG + Intronic
1117051643 14:51866268-51866290 TAGATTCACTGCATCTCCGCAGG + Intronic
1117286061 14:54286807-54286829 AAGAGTCACTGCGCCCCGGCCGG + Intergenic
1118341866 14:64900860-64900882 TACAGTCACTGCACTACTCCAGG - Intergenic
1122630243 14:103104336-103104358 TAGAGGCCCTGCAGCACCTCGGG - Exonic
1125934762 15:43625570-43625592 TAGAGTCACGCCACCACGCCTGG - Intergenic
1135702282 16:24642773-24642795 TAGTGCCACTGCACTACAGCCGG + Intergenic
1143117148 17:4587535-4587557 TAGAGTCACAGCCCCACACCAGG + Intronic
1145832379 17:27927103-27927125 TAGTGTCACTGCACTCCAGCCGG + Intergenic
1160033024 18:75278768-75278790 TGGAGCCACAGCACCACCTCCGG - Intronic
1164383290 19:27753232-27753254 TAGAGACACTTCACAACAGCAGG - Intergenic
1166185299 19:41135474-41135496 TAGCCGCACAGCACCACCGCAGG - Intergenic
1167129586 19:47575345-47575367 TAGAGCCACTGCACCAGCCTGGG + Intergenic
1168367871 19:55805114-55805136 TAGAGTCCCACCACCACCACCGG + Intronic
928846690 2:35682539-35682561 TCGAGTCACTGCACGGCAGCCGG + Intergenic
932330383 2:70895303-70895325 TCCAGCCACTGCACCACCTCTGG - Intergenic
936541943 2:113359374-113359396 GGGAGTCACTGGACCACAGCTGG - Intergenic
938237017 2:129713451-129713473 TAGCGTCACTGCCCCAGCGGTGG + Intergenic
939954346 2:148513834-148513856 TATACTGACTGCACCACCGCTGG + Intronic
941336087 2:164245283-164245305 TAGGATCACTGCACCAGCCCAGG - Intergenic
942550540 2:177111682-177111704 TGCAGTCACTGAACCACTGCAGG - Intergenic
945388697 2:209236542-209236564 CAGAGTAACTGCACCACAGAAGG - Intergenic
1180724957 22:17939985-17940007 TAGAGTCAAAGCACCACAGCCGG + Intronic
1181821056 22:25475993-25476015 TAGAGGCACTGCACCACGCCTGG + Intergenic
1183284358 22:36952994-36953016 TATAGTCACTGTAGCAGCGCAGG + Intergenic
967957050 3:194885386-194885408 TCATGTCACTGCACCACAGCCGG + Intergenic
968808882 4:2791378-2791400 TAGAGTCACAGCCCCAGCGCCGG + Intergenic
971981146 4:33752646-33752668 TCGAGCCACTGCACTACAGCTGG - Intergenic
983713560 4:170749764-170749786 TAGAGCCACTACACCAAGGCTGG + Intergenic
994198447 5:96945112-96945134 GTGAGCCACTGCACCACCCCAGG - Intronic
997996635 5:138591794-138591816 TAGATTCACTGCAGCAACACGGG + Intergenic
1003881743 6:10485567-10485589 TAAAGTCACTACGCCACAGCAGG - Intergenic
1008483272 6:52008321-52008343 TAGAGTCAATTCATCACAGCTGG - Intronic
1017774167 6:157667906-157667928 TAGAGTCATTGCACTACCCTTGG + Intronic
1018743261 6:166746001-166746023 GAGACTCACAGCAGCACCGCTGG - Intronic
1023103634 7:36743224-36743246 TAGAATCACTGCTCCTCAGCAGG - Intergenic
1023715088 7:43036084-43036106 TTGAGTCACTGCACCAGAGTTGG + Intergenic
1031925653 7:127635953-127635975 TAGTGTCACTGCTACACTGCAGG - Intergenic
1033684577 7:143626644-143626666 TAGAGTCACTGCCCCAGAGCTGG - Intronic
1033687753 7:143705863-143705885 TAGAGTCACTGCCCCAGAGCTGG - Intronic
1033700034 7:143830979-143831001 TAGAGTCACTGCCCCAGAGCTGG + Intergenic
1043622532 8:82213259-82213281 TAGAGCCACTGCACTCCAGCCGG + Intergenic
1050136304 9:2469134-2469156 CAGAATCACTGCAGCAGCGCCGG - Intergenic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1192866528 X:75138961-75138983 TAGAGCCACTGCACGTCAGCAGG + Intronic
1196813612 X:119647526-119647548 TCGAGCCACTGCACTACTGCAGG - Intronic