ID: 905663039

View in Genome Browser
Species Human (GRCh38)
Location 1:39743059-39743081
Sequence GCCACCCCAAAGCCACCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 9, 3: 37, 4: 211}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905663039_905663045 12 Left 905663039 1:39743059-39743081 CCCACAGGTGGCTTTGGGGTGGC 0: 1
1: 0
2: 9
3: 37
4: 211
Right 905663045 1:39743094-39743116 TGGTAGAGGCCCAGGGATTAAGG 0: 1
1: 0
2: 2
3: 14
4: 171
905663039_905663047 16 Left 905663039 1:39743059-39743081 CCCACAGGTGGCTTTGGGGTGGC 0: 1
1: 0
2: 9
3: 37
4: 211
Right 905663047 1:39743098-39743120 AGAGGCCCAGGGATTAAGGGAGG 0: 1
1: 0
2: 1
3: 29
4: 250
905663039_905663044 5 Left 905663039 1:39743059-39743081 CCCACAGGTGGCTTTGGGGTGGC 0: 1
1: 0
2: 9
3: 37
4: 211
Right 905663044 1:39743087-39743109 AGCTTACTGGTAGAGGCCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 97
905663039_905663043 4 Left 905663039 1:39743059-39743081 CCCACAGGTGGCTTTGGGGTGGC 0: 1
1: 0
2: 9
3: 37
4: 211
Right 905663043 1:39743086-39743108 TAGCTTACTGGTAGAGGCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 77
905663039_905663046 13 Left 905663039 1:39743059-39743081 CCCACAGGTGGCTTTGGGGTGGC 0: 1
1: 0
2: 9
3: 37
4: 211
Right 905663046 1:39743095-39743117 GGTAGAGGCCCAGGGATTAAGGG 0: 1
1: 0
2: 1
3: 13
4: 118
905663039_905663041 -8 Left 905663039 1:39743059-39743081 CCCACAGGTGGCTTTGGGGTGGC 0: 1
1: 0
2: 9
3: 37
4: 211
Right 905663041 1:39743074-39743096 GGGGTGGCTGCATAGCTTACTGG 0: 1
1: 0
2: 0
3: 6
4: 97
905663039_905663042 -2 Left 905663039 1:39743059-39743081 CCCACAGGTGGCTTTGGGGTGGC 0: 1
1: 0
2: 9
3: 37
4: 211
Right 905663042 1:39743080-39743102 GCTGCATAGCTTACTGGTAGAGG 0: 1
1: 0
2: 1
3: 11
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905663039 Original CRISPR GCCACCCCAAAGCCACCTGT GGG (reversed) Intronic
900543880 1:3217877-3217899 GGCACCCCAAAACCTCGTGTGGG - Intronic
900852636 1:5156111-5156133 GCCACACCAGGGCCACCTGCTGG - Intergenic
901197794 1:7449941-7449963 CCTACCCCCAAGCCACCTGGTGG - Intronic
902247212 1:15128852-15128874 CCCCCCCAAAAGCCACCTTTTGG - Intergenic
902876888 1:19345703-19345725 GGCACCCCAAAGCCACCATTTGG - Intronic
904477933 1:30776671-30776693 GCCACCCCTGAGCCACTTGGTGG + Intergenic
905663039 1:39743059-39743081 GCCACCCCAAAGCCACCTGTGGG - Intronic
906148735 1:43575527-43575549 GCCACCCAAATCCCACCGGTGGG - Intronic
906512812 1:46420770-46420792 GCCACCCCAAATCTATGTGTAGG - Intergenic
907045845 1:51299625-51299647 GCCACCCCAAAGCCACACAGCGG + Intronic
907327695 1:53651501-53651523 GCCCCCCCAGACCCACCTGAAGG - Intronic
907543281 1:55236348-55236370 GCCACCCCAATGGAACTTGTGGG - Intergenic
908678508 1:66632830-66632852 TGCAGCCCAAAGCCACATGTGGG - Intronic
910016749 1:82534506-82534528 GCCAGCCCAAATGCTCCTGTAGG + Intergenic
910258859 1:85276727-85276749 GCCACCCGAAAGGCTCCGGTCGG - Exonic
912422741 1:109556643-109556665 TCACCCCCAAATCCACCTGTTGG + Intronic
913410138 1:118542270-118542292 GTCATCCCAAAGGCACCTGTAGG - Intergenic
915061527 1:153189900-153189922 GCCCCACAAAAGCCTCCTGTAGG + Intergenic
915440417 1:155942232-155942254 TCCACCCCGAAGACAGCTGTGGG - Exonic
915844863 1:159252535-159252557 GCAGGCCCAAAGGCACCTGTAGG - Intergenic
916594690 1:166233022-166233044 GCCAGCCCAAACACACTTGTAGG + Intergenic
917117630 1:171618467-171618489 GGAACCCCAAAGGCACATGTAGG - Intergenic
917424708 1:174902092-174902114 GCCAGCCCACACACACCTGTAGG + Intronic
918434578 1:184498186-184498208 CCCACCCCCAAGCCACCTGGTGG - Intronic
918614729 1:186531587-186531609 GCCAGTCCAAATGCACCTGTAGG + Intergenic
919747321 1:201016975-201016997 GACACCCCAAGGCCTCCTGTAGG - Intronic
920400119 1:205670954-205670976 ACCGCGCCACAGCCACCTGTTGG - Intronic
923326746 1:232886784-232886806 GCCAACCCACATCCACCTTTTGG - Intergenic
924152683 1:241144754-241144776 CCAACCCCACAGCCGCCTGTTGG + Intronic
1062886144 10:1017918-1017940 GCCACCTCAAAAGCACCTGCTGG + Exonic
1065458949 10:25935046-25935068 GCCGACCCAGCGCCACCTGTGGG - Intronic
1067528674 10:47054892-47054914 GCCACTCCAGTGCCACCTGATGG + Intergenic
1069044206 10:63724812-63724834 GCCTCCCCAAAGCCCCCCTTGGG + Intergenic
1071288928 10:84174093-84174115 GGAACCCCCAAGCCACCTGCAGG - Intronic
1071491219 10:86137823-86137845 GCCAGCCCAAAGCCCACTGCTGG - Intronic
1073257212 10:102160562-102160584 GCAGCCCCCAAGCAACCTGTGGG + Exonic
1073783623 10:106865242-106865264 GCCAGCTCAAATGCACCTGTAGG - Intronic
1075893895 10:125978231-125978253 GTCGGCCCAAAGGCACCTGTAGG + Intronic
1076313659 10:129525893-129525915 GCCACCCCAAAGCCTCCTGGTGG - Intronic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1078033777 11:7781120-7781142 GCCAGCCCAAATGCACCTGTAGG - Intergenic
1078294771 11:10057000-10057022 GCTGGCCCAAAGGCACCTGTAGG - Intronic
1078423994 11:11234518-11234540 GACTCCTCAGAGCCACCTGTGGG - Intergenic
1079076007 11:17386042-17386064 TCCACCCCCAAGCCACCTTCTGG + Exonic
1079408304 11:20163866-20163888 CCCACCCCAAAGCCAGGCGTCGG - Intergenic
1082087696 11:48063562-48063584 GCCACCCCCCAGCAGCCTGTTGG - Intronic
1083757854 11:64801168-64801190 GACACCCCAAAGTCAGCTGTGGG + Exonic
1083896904 11:65624590-65624612 CCCATCCCTGAGCCACCTGTGGG - Intronic
1085688848 11:78649591-78649613 TCCACCCCCAAGCCAGCTGGAGG + Intergenic
1085880622 11:80463174-80463196 GCCAGCCCAAATGCACCTGTAGG - Intergenic
1087797235 11:102467306-102467328 GGCACCAGCAAGCCACCTGTTGG - Exonic
1088995298 11:114990554-114990576 GCCAGCCCACAGCAACCAGTGGG + Intergenic
1089161602 11:116442122-116442144 GCCATCCCTAAGTCACCTTTTGG - Intergenic
1090929859 11:131287493-131287515 CCCACTGCAAAGCCACCTCTGGG + Intergenic
1091324845 11:134678409-134678431 CCCACCCCAGAGCTCCCTGTTGG + Intergenic
1092741113 12:11630508-11630530 GGCACACCCAAGCCAGCTGTTGG + Intergenic
1094124839 12:27013082-27013104 GCCACTTCAAATTCACCTGTGGG - Intronic
1095824363 12:46516238-46516260 GTCAGCCCAAAGACACTTGTAGG + Intergenic
1096183714 12:49565205-49565227 GCCACAGCAATGCCACCTGGGGG + Intronic
1096842270 12:54386657-54386679 GCCAGCCCAAAACCAGCTGCTGG - Intronic
1098128417 12:67323229-67323251 GCCGGCCCAAACACACCTGTAGG - Intergenic
1098310178 12:69140671-69140693 CCCAGCCAAAAGGCACCTGTGGG + Intergenic
1102866818 12:116381380-116381402 GCCAGGCAAGAGCCACCTGTGGG - Intergenic
1110035090 13:70672941-70672963 GCTAGCCCAAAGGCACCTGTAGG + Intergenic
1113226878 13:108168926-108168948 GCCAGTCCAAATACACCTGTAGG - Intergenic
1115473962 14:33796658-33796680 GCCACTCCAAGGCCACCTGATGG - Intronic
1117196713 14:53347250-53347272 GCCAGCCCAGAACCACCTCTAGG - Intergenic
1119649829 14:76375857-76375879 CCCACCCCAGACCCACCTGGCGG + Intronic
1121580491 14:95026111-95026133 GCAGCCCCAAAGCCACCGGGTGG + Intergenic
1121954214 14:98199305-98199327 GTCACCCCAAAGCTTCCTGAGGG - Intergenic
1122419304 14:101565051-101565073 GGGACCCCCAAGCCACCGGTAGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1124492579 15:30167316-30167338 GCCACCCCCAAGACTCCTGGAGG + Intergenic
1124750955 15:32371009-32371031 GCCACCCCCAAGACTCCTGGAGG - Intergenic
1124822515 15:33061061-33061083 CCCACCCCACAGCCATCTGTGGG - Intronic
1126225278 15:46262454-46262476 GCCAGCCCTAATGCACCTGTAGG + Intergenic
1128532464 15:68463955-68463977 ACCACCCCACAGCCGCCTGTGGG - Intergenic
1128889483 15:71318051-71318073 GCCCCCCAAAAGCCACTGGTAGG - Intronic
1129222096 15:74136880-74136902 GCCCCCCCAGAGCCTCCCGTTGG + Intronic
1129605525 15:77023142-77023164 TCAACCCCAAACCCACCTGTGGG - Intronic
1131086710 15:89581676-89581698 GCCAACCCTAAACCACCTTTTGG - Intronic
1132253460 15:100352289-100352311 GGCACCCAAAAGCAACCTGTAGG + Intergenic
1132420529 15:101662628-101662650 CCTACCCCAAAGCTTCCTGTAGG - Intronic
1133333570 16:4991713-4991735 GCCACTCAATAGCCACGTGTCGG + Intronic
1133988934 16:10690010-10690032 GACACTCCAAGGCCACCTGTGGG + Exonic
1134693527 16:16206503-16206525 GCCACACAACAGCCACCTGCTGG - Intronic
1134978324 16:18588197-18588219 GCCACACAACAGCCACCTGCTGG + Intergenic
1136013928 16:27383010-27383032 ACCACCCCAATCCCACCCGTTGG - Intergenic
1139599147 16:67976236-67976258 GCCACCCACCAGCCAGCTGTGGG + Intronic
1141137920 16:81478652-81478674 GCCACCCCAGAGCCTCCCGGTGG + Intronic
1142797983 17:2323700-2323722 GCCACTCCAACACCAGCTGTAGG - Exonic
1144734584 17:17547998-17548020 GCCACCCCAAAGAAATCTGATGG + Intronic
1147864319 17:43542931-43542953 GCCACCCCAAAGCTCCCCATGGG + Intronic
1151680264 17:75619351-75619373 TCCACCTCCAAGCCTCCTGTGGG - Intergenic
1151777022 17:76211741-76211763 GCCACTCAATAGCCACCTGGCGG + Intronic
1151942599 17:77301965-77301987 GCCACTCCAAACCCCTCTGTGGG - Intronic
1152120081 17:78413142-78413164 GCCACATCAAAGCCACTTGCTGG - Intronic
1156364158 18:36409815-36409837 GCCACCCCAAAGCCACCTTCAGG - Intronic
1157699432 18:49751602-49751624 GCCACCCCAAATCTCCCTGTGGG + Intergenic
1160175729 18:76592554-76592576 GCCACCCCCCAGCCCCCTCTGGG + Intergenic
1160811524 19:1014960-1014982 GCCACCCCAGGGCCACCAGCTGG + Intronic
1160964693 19:1741949-1741971 GCCACCCCAAGGACACCAGCTGG + Intergenic
1161035066 19:2079909-2079931 CCCACCCCAGAGCAACCCGTGGG - Intronic
1161119894 19:2519747-2519769 GGAACCCCAAGGCCACCTGGAGG - Intronic
1162452330 19:10762738-10762760 CCCACCCTTAAGCCACCTCTTGG + Intronic
1164733875 19:30526272-30526294 GCCAGCCCATAGCCACCCCTTGG + Intronic
1166911746 19:46163949-46163971 GCCAATGCAAAGGCACCTGTAGG + Intergenic
927638095 2:24830588-24830610 GCCACTCCAAAGCTACATGACGG + Intronic
930018084 2:46984544-46984566 GCCCCCCGACAGCCACCTCTAGG + Intronic
931543330 2:63353697-63353719 GCCAGCCCAAAGACACCTGTAGG - Intronic
932183792 2:69673937-69673959 TTCACCCCAAAGCCTCGTGTAGG - Intronic
932449580 2:71800849-71800871 CCCTCCCCAAAGCCTCCAGTGGG + Intergenic
932523581 2:72440085-72440107 GCCAGCCCAAACGCACCTGTAGG + Intronic
933085802 2:78053011-78053033 GTCAGCCAAAAGGCACCTGTAGG + Intergenic
933778281 2:85785063-85785085 GCCAGCCCCAAGCCGTCTGTTGG - Intronic
935245775 2:101217918-101217940 GACACCTCTAAGCCACCTGAAGG + Intronic
936012425 2:108933544-108933566 CCTTCCCCAAAGCCACCTGGAGG - Intronic
937226497 2:120373484-120373506 GCATCACCAAAGCCAACTGTGGG - Intergenic
937397127 2:121546926-121546948 GCCAGCCCAAAGGCACCTGTAGG - Intronic
943050430 2:182907309-182907331 CCAACCCCAAAGACACCAGTGGG + Intergenic
943611956 2:190044861-190044883 GCCGGCCCAAAGGCACCTGTAGG + Intronic
944420561 2:199525566-199525588 GCATCCCCAAGACCACCTGTAGG - Intergenic
946467254 2:219922881-219922903 GCCACACCAAAATCACCTGGGGG + Intergenic
948730422 2:239959985-239960007 GGCACTCCACAGCCGCCTGTGGG - Exonic
948878035 2:240840656-240840678 GCCTCCCCAGTGCCACCTGCTGG + Intergenic
1169091205 20:2862376-2862398 GCCCCCCTAAAGGCAGCTGTGGG + Intronic
1169687179 20:8288512-8288534 CCTACCCCAAAGCTCCCTGTGGG - Intronic
1170571322 20:17634422-17634444 GCCACACCAAAGCCCACTGTAGG + Intronic
1172520880 20:35564768-35564790 GCCACCACAGAGCAAACTGTGGG - Intergenic
1172626762 20:36351893-36351915 GCTCCTCCAAACCCACCTGTGGG + Intronic
1172976477 20:38909775-38909797 GCCACATCAAAGCCACCAGCTGG + Intronic
1173652146 20:44673197-44673219 CCCAACCCAAAGCCTCCTTTGGG + Intergenic
1175980191 20:62734954-62734976 CACACCCCAAAGCCACCCGAGGG - Intronic
1178584167 21:33859012-33859034 GGCACCCCAGAGCCTGCTGTTGG + Intronic
1180597967 22:16991634-16991656 GTCACCTCTCAGCCACCTGTAGG - Intronic
1180699371 22:17773377-17773399 CCCATCTCAAAGCCTCCTGTGGG + Intronic
1180998800 22:19978408-19978430 GCCACCCCAATGGCAGCTCTGGG + Intronic
1181262408 22:21607742-21607764 ACCACCCGAAAACCACCTTTGGG - Intronic
1182096717 22:27630676-27630698 CCCACCCCAGAGCTGCCTGTGGG + Intergenic
1183074683 22:35419419-35419441 GTCACCGCCAAGCCTCCTGTGGG + Intronic
1183945496 22:41323577-41323599 GCCTCCCCGAAGCCGTCTGTTGG + Intronic
1184828342 22:46968378-46968400 TCCATCCAAAAGCCCCCTGTGGG - Intronic
1184854610 22:47139536-47139558 GCCGACCCAAAGCCCCCTGGAGG - Intronic
950582337 3:13870773-13870795 GCAACCCCAGGGCCACCTCTTGG - Intronic
951460339 3:22944981-22945003 ACCACCCCAACTCCAGCTGTAGG + Intergenic
953664315 3:44915169-44915191 GCCACCCTAAAGGCACCTCTAGG - Intergenic
954486799 3:50860512-50860534 GCTGGCCCAAAGCCACTTGTAGG + Intronic
954498598 3:50988618-50988640 GCCAGCCTGAAGGCACCTGTAGG - Intronic
954866346 3:53733010-53733032 GCCACCCTCAAGCAACCTGTAGG - Intronic
955410828 3:58654346-58654368 CCCAACCCCAAGCCACCTGGAGG - Intronic
955681314 3:61505102-61505124 GCCAGCACAAACCCATCTGTAGG + Intergenic
956890221 3:73606114-73606136 ACCACACCAAAGCCTACTGTTGG - Intronic
957060735 3:75479429-75479451 GCAACCCCAACTCCATCTGTGGG - Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
958068346 3:88575314-88575336 CCCACCCCAATTCCAACTGTAGG - Intergenic
959950508 3:112175354-112175376 GCCAGCCCGAACACACCTGTAGG + Intronic
960685206 3:120288026-120288048 GCTGGCCCAAAGGCACCTGTAGG - Intergenic
961171360 3:124799978-124800000 GCCTGCCCGAAGCCACCCGTGGG + Intronic
961540057 3:127593266-127593288 GCCACCCCTGAGCCTGCTGTAGG - Intronic
961556405 3:127699118-127699140 GGGACCCCAAAGCCTCCTCTTGG + Intronic
962374601 3:134849778-134849800 GCCACCCCAGAAAGACCTGTGGG + Intronic
962747192 3:138405671-138405693 GACACCCCACGGCCACCAGTGGG - Intergenic
962915856 3:139902804-139902826 GCCACCCCACAGCCACAGGAAGG + Intergenic
962966399 3:140358274-140358296 CCCAGCCCAGAGCCACCTCTGGG - Intronic
962983226 3:140509310-140509332 ACCACACCAAAACCACCTGGAGG + Intronic
963052978 3:141158194-141158216 GCCAGCTCAAAGGCAACTGTAGG - Intergenic
972022060 4:34327383-34327405 GCCAGCCCAAACGAACCTGTAGG + Intergenic
974917032 4:68190710-68190732 GCCACTCCAAACCCACATGTAGG + Intergenic
975297670 4:72752125-72752147 GCCAGCCCAAACACACCTGTAGG - Intergenic
977819795 4:101458399-101458421 GGCAACCCAAAGGCACCTGTAGG - Intronic
978195687 4:105969201-105969223 GACACATCAAAGCCATCTGTGGG + Exonic
978683787 4:111415137-111415159 GCCATCCCAAAGCCATCTGTAGG + Intergenic
981750773 4:148090916-148090938 GCCAGGCCAATGCCACCTGCTGG - Intronic
985939215 5:3121120-3121142 CCCACCCTAAAGCCTGCTGTAGG - Intergenic
986955857 5:13148584-13148606 GCCACCCCCAACACCCCTGTTGG - Intergenic
989693250 5:44170391-44170413 GCCAGCCCAAATGCACCTGTAGG - Intergenic
990217041 5:53545857-53545879 GCCTCCCCAATGCTTCCTGTTGG + Intergenic
990500253 5:56389677-56389699 GCCAGCCCAAAGGCACCTATAGG - Intergenic
997438499 5:133892241-133892263 TGTATCCCAAAGCCACCTGTGGG + Intergenic
997567569 5:134901316-134901338 ACCACCCCAAACACAGCTGTTGG - Exonic
999074467 5:148781201-148781223 GCCAGCCCAAATGCATCTGTGGG - Intergenic
999666171 5:153916285-153916307 GCCAGCCCAAATGTACCTGTAGG + Intergenic
1003902492 6:10668118-10668140 GCCGGCCCAAATGCACCTGTAGG + Intergenic
1006040261 6:31246609-31246631 GCCAGCCCAAACACACCTGTAGG - Intergenic
1006502960 6:34469677-34469699 GCTACCACAGAGCCACCTGCAGG - Intronic
1007203493 6:40130815-40130837 TGCAGCCCACAGCCACCTGTTGG - Intergenic
1009289681 6:61867855-61867877 GCCAGCCCAAACGTACCTGTAGG + Intronic
1009325732 6:62345890-62345912 GCTAGCCCAAACACACCTGTAGG - Intergenic
1009888806 6:69656097-69656119 GCCATCCCAAAGGTACCTGTAGG - Intergenic
1010004492 6:70980873-70980895 GCCACCCCACAGTTTCCTGTTGG - Intergenic
1011507863 6:88067914-88067936 GCCCACCCAAAGGCATCTGTAGG + Intergenic
1012931140 6:105318023-105318045 GGCACCCAAATGCCACCTGGTGG - Intronic
1016569059 6:145492373-145492395 GCCACCCCCAAGGCCCCTGAGGG + Intergenic
1016569591 6:145497447-145497469 GCCAGCCCAAATGCACCTGCAGG + Intergenic
1016790682 6:148064429-148064451 GCCAACCCAAATGCTCCTGTAGG + Intergenic
1017174525 6:151490711-151490733 GCCACCCCAAATTCATTTGTTGG - Intergenic
1017455672 6:154599115-154599137 GCCACCCCAAATCCACGAGTAGG - Intergenic
1017766800 6:157613585-157613607 GCCACACGATAGGCACCTGTTGG + Intronic
1017892413 6:158649866-158649888 GCCACCCCAAAACCACATCAAGG - Intergenic
1019574979 7:1733283-1733305 CACTCCCCAAGGCCACCTGTCGG - Intronic
1019609388 7:1929254-1929276 TCCTCCCCAAAGACACCTCTAGG + Intronic
1019712656 7:2524631-2524653 CCCACCCCAGGGCCATCTGTGGG - Intronic
1019779558 7:2931284-2931306 CCCACCCCAAAGCCACCTGGGGG + Intronic
1020255922 7:6503217-6503239 CCCACCCCAAAGCCTGCGGTGGG - Intronic
1021175888 7:17449477-17449499 GCTGGCCCAAAGGCACCTGTAGG + Intergenic
1023886430 7:44360478-44360500 GCCAGCCCAAACGCACCTGTAGG + Intergenic
1025008487 7:55375541-55375563 GCCATTCCAAAGCCACTTGAAGG + Intronic
1025756862 7:64352325-64352347 GCCAGCCCAAAAGCACCTGTAGG + Exonic
1030391127 7:108930437-108930459 GCCAGCCCAAATGCACCTGTAGG + Intergenic
1031627185 7:124004820-124004842 GCCAGCCCAAAGACACCTGTAGG + Intergenic
1032384761 7:131514051-131514073 GCCACACCAAAGCCACTTCCTGG - Intronic
1033532132 7:142274758-142274780 GGCAGCCCAAAAGCACCTGTAGG + Intergenic
1033584307 7:142762777-142762799 GCCACCCCAAATACAACAGTTGG + Intronic
1034549260 7:151809926-151809948 GCCACCCCAGAGCCACAGGCAGG + Intronic
1037198671 8:16223493-16223515 GCCAGCCCAAACACACCTGTAGG + Intronic
1041561756 8:59226266-59226288 GCCAACCCAAAGGCACCTGTAGG - Intergenic
1042619978 8:70694166-70694188 GCCAGCTTAAAGGCACCTGTAGG + Intronic
1044447517 8:92296549-92296571 GCCAGTCCAAACGCACCTGTAGG + Intergenic
1044749391 8:95401636-95401658 GCCAAACAAAAGCCATCTGTGGG + Intergenic
1045542901 8:103103351-103103373 GCCACCCCAGGGTCACCTGGTGG + Intergenic
1047431615 8:124798189-124798211 CCCACCCCAGAGCCCCCTGGGGG - Intergenic
1048968475 8:139630596-139630618 GCCACCCCAAAGCCACTCCGCGG - Intronic
1049449895 8:142654978-142655000 GCCTCCTCAAAGCCACCTTGGGG - Intergenic
1049687611 8:143945192-143945214 GCCACCCCAAAGTCACGCGCAGG + Intronic
1049743932 8:144255072-144255094 GCCACCCCACAGGCACCTGGAGG + Intronic
1051913988 9:22185735-22185757 GCCAGCCTAAACACACCTGTAGG - Intergenic
1052311668 9:27075053-27075075 GTCAGCCCAAAGGCACCTGTAGG + Intergenic
1052626419 9:30981836-30981858 GCCAATCCAAAGGTACCTGTAGG - Intergenic
1052702977 9:31960165-31960187 GCTGACCCAAAGACACCTGTAGG - Intergenic
1053159170 9:35801577-35801599 GCCACCCCCAAGCCAACAGCAGG - Intronic
1055206800 9:73740894-73740916 AACAGCCCAAAGCCACCTTTGGG - Intergenic
1056457888 9:86781155-86781177 GTGTCCCCAAAGCCACCTGAAGG + Intergenic
1058648385 9:107152175-107152197 GAAACCCCAAAGTCACCTGGGGG - Intergenic
1060443880 9:123669618-123669640 GCTACTCCACAGCTACCTGTCGG + Intronic
1061002479 9:127910208-127910230 GCCAGCCCAAGGCCAGCAGTGGG + Intronic
1061631306 9:131874009-131874031 GCCACTCCACAGCCACCTACAGG + Intronic
1062665949 9:137671899-137671921 GCCTCTCCACAGCCACATGTCGG - Intronic
1185864730 X:3613390-3613412 ACCCCCTCCAAGCCACCTGTAGG - Intronic
1188189801 X:27159310-27159332 GCCCACCCAGAGCCACCTTTAGG + Intergenic
1190133132 X:47769056-47769078 GCCAGCCCGAATGCACCTGTAGG - Intergenic
1190803286 X:53812839-53812861 GCCAGCCCGAACACACCTGTAGG + Intergenic
1190977217 X:55417186-55417208 GCCAGCCCAAATGCACCTGTAGG - Intergenic
1191022686 X:55879029-55879051 GCCAGCCCACATGCACCTGTAGG - Intergenic
1191155195 X:57266191-57266213 GCCAGCCCGAACACACCTGTAGG - Intergenic
1191703158 X:64064557-64064579 GCCAACCAAAATACACCTGTAGG - Intergenic
1192254403 X:69443349-69443371 GCCAGCCCAAAGGCACCTGTAGG + Intergenic
1192891848 X:75398948-75398970 GCTGGCCCAAAGGCACCTGTAGG - Intronic
1192920759 X:75703394-75703416 GCCAGCCCAAATGCACCTGTAGG - Intergenic
1193258823 X:79380789-79380811 GACAGCCCAAAAGCACCTGTAGG - Intergenic
1194594011 X:95836045-95836067 GCCAGCCCTAACACACCTGTAGG + Intergenic
1194830550 X:98618581-98618603 GCCAGCCAAAATGCACCTGTAGG + Intergenic
1194854733 X:98915133-98915155 GCCAGCCCAAAAGCACCTGTAGG + Intergenic
1195473543 X:105260050-105260072 GCTAGCCCAAAGTCACCTGAAGG + Intronic
1196465825 X:115970479-115970501 CCCACCCCAAGACCACCTGCTGG + Intergenic
1196932574 X:120696131-120696153 GCTGGCCCAAAGGCACCTGTAGG - Intergenic
1197122307 X:122906722-122906744 ACCAGCCCAAACACACCTGTAGG - Intergenic
1199894852 X:152118992-152119014 GCCAGCCCTAAACCACCTGGGGG - Intergenic
1200799225 Y:7370676-7370698 ACCCCCTCCAAGCCACCTGTAGG + Intergenic