ID: 905664261

View in Genome Browser
Species Human (GRCh38)
Location 1:39753104-39753126
Sequence AGACTCTCCAGCCCTCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664261_905664265 3 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664265 1:39753130-39753152 TGGCCTGAGAGAGATGGCCAGGG 0: 1
1: 0
2: 4
3: 28
4: 312
905664261_905664264 2 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664264 1:39753129-39753151 GTGGCCTGAGAGAGATGGCCAGG 0: 1
1: 0
2: 2
3: 19
4: 266
905664261_905664266 4 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664266 1:39753131-39753153 GGCCTGAGAGAGATGGCCAGGGG 0: 1
1: 0
2: 5
3: 32
4: 319
905664261_905664269 18 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664269 1:39753145-39753167 GGCCAGGGGCTGTGTCCAGCGGG 0: 1
1: 1
2: 2
3: 37
4: 453
905664261_905664268 17 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664268 1:39753144-39753166 TGGCCAGGGGCTGTGTCCAGCGG 0: 1
1: 1
2: 4
3: 66
4: 524
905664261_905664271 21 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664271 1:39753148-39753170 CAGGGGCTGTGTCCAGCGGGAGG 0: 1
1: 0
2: 8
3: 21
4: 264
905664261_905664263 -3 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664263 1:39753124-39753146 TCTCTGTGGCCTGAGAGAGATGG 0: 1
1: 1
2: 4
3: 39
4: 444
905664261_905664273 23 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664273 1:39753150-39753172 GGGGCTGTGTCCAGCGGGAGGGG 0: 1
1: 0
2: 2
3: 28
4: 292
905664261_905664272 22 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664272 1:39753149-39753171 AGGGGCTGTGTCCAGCGGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664261 Original CRISPR AGACTCTCCAGCCCTCACAC AGG (reversed) Intronic