ID: 905664267

View in Genome Browser
Species Human (GRCh38)
Location 1:39753133-39753155
Sequence AGCCCCTGGCCATCTCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 242}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664267_905664278 17 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664278 1:39753173-39753195 CTGCTGCTGCCCAGGTTCCGGGG 0: 1
1: 0
2: 1
3: 27
4: 294
905664267_905664281 26 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664281 1:39753182-39753204 CCCAGGTTCCGGGGTGGAAGTGG 0: 1
1: 0
2: 0
3: 34
4: 357
905664267_905664276 15 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664276 1:39753171-39753193 GGCTGCTGCTGCCCAGGTTCCGG 0: 1
1: 0
2: 2
3: 48
4: 469
905664267_905664271 -8 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664271 1:39753148-39753170 CAGGGGCTGTGTCCAGCGGGAGG 0: 1
1: 0
2: 8
3: 21
4: 264
905664267_905664279 20 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664279 1:39753176-39753198 CTGCTGCCCAGGTTCCGGGGTGG 0: 1
1: 0
2: 0
3: 20
4: 309
905664267_905664272 -7 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664272 1:39753149-39753171 AGGGGCTGTGTCCAGCGGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 240
905664267_905664277 16 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664277 1:39753172-39753194 GCTGCTGCTGCCCAGGTTCCGGG 0: 1
1: 1
2: 1
3: 55
4: 503
905664267_905664283 27 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664283 1:39753183-39753205 CCAGGTTCCGGGGTGGAAGTGGG 0: 1
1: 0
2: 1
3: 24
4: 289
905664267_905664275 9 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664275 1:39753165-39753187 GGGAGGGGCTGCTGCTGCCCAGG 0: 1
1: 2
2: 13
3: 126
4: 864
905664267_905664273 -6 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664273 1:39753150-39753172 GGGGCTGTGTCCAGCGGGAGGGG 0: 1
1: 0
2: 2
3: 28
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664267 Original CRISPR AGCCCCTGGCCATCTCTCTC AGG (reversed) Intronic