ID: 905664270

View in Genome Browser
Species Human (GRCh38)
Location 1:39753147-39753169
Sequence CTCCCGCTGGACACAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 6, 3: 10, 4: 248}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664270_905664276 1 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664276 1:39753171-39753193 GGCTGCTGCTGCCCAGGTTCCGG 0: 1
1: 0
2: 2
3: 48
4: 469
905664270_905664277 2 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664277 1:39753172-39753194 GCTGCTGCTGCCCAGGTTCCGGG 0: 1
1: 1
2: 1
3: 55
4: 503
905664270_905664281 12 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664281 1:39753182-39753204 CCCAGGTTCCGGGGTGGAAGTGG 0: 1
1: 0
2: 0
3: 34
4: 357
905664270_905664288 29 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664288 1:39753199-39753221 AAGTGGGCAAATGGGCAGGCAGG 0: 1
1: 1
2: 3
3: 34
4: 313
905664270_905664289 30 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664289 1:39753200-39753222 AGTGGGCAAATGGGCAGGCAGGG 0: 1
1: 1
2: 9
3: 60
4: 437
905664270_905664287 25 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664287 1:39753195-39753217 GTGGAAGTGGGCAAATGGGCAGG 0: 1
1: 0
2: 1
3: 20
4: 263
905664270_905664278 3 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664278 1:39753173-39753195 CTGCTGCTGCCCAGGTTCCGGGG 0: 1
1: 0
2: 1
3: 27
4: 294
905664270_905664286 21 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664286 1:39753191-39753213 CGGGGTGGAAGTGGGCAAATGGG 0: 1
1: 0
2: 1
3: 15
4: 237
905664270_905664285 20 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664285 1:39753190-39753212 CCGGGGTGGAAGTGGGCAAATGG 0: 1
1: 0
2: 1
3: 20
4: 230
905664270_905664283 13 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664283 1:39753183-39753205 CCAGGTTCCGGGGTGGAAGTGGG 0: 1
1: 0
2: 1
3: 24
4: 289
905664270_905664275 -5 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664275 1:39753165-39753187 GGGAGGGGCTGCTGCTGCCCAGG 0: 1
1: 2
2: 13
3: 126
4: 864
905664270_905664279 6 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664279 1:39753176-39753198 CTGCTGCCCAGGTTCCGGGGTGG 0: 1
1: 0
2: 0
3: 20
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664270 Original CRISPR CTCCCGCTGGACACAGCCCC TGG (reversed) Intronic