ID: 905664271

View in Genome Browser
Species Human (GRCh38)
Location 1:39753148-39753170
Sequence CAGGGGCTGTGTCCAGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 8, 3: 21, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664260_905664271 22 Left 905664260 1:39753103-39753125 CCCTGTGTGAGGGCTGGAGAGTC 0: 1
1: 0
2: 0
3: 18
4: 218
Right 905664271 1:39753148-39753170 CAGGGGCTGTGTCCAGCGGGAGG 0: 1
1: 0
2: 8
3: 21
4: 264
905664267_905664271 -8 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664271 1:39753148-39753170 CAGGGGCTGTGTCCAGCGGGAGG 0: 1
1: 0
2: 8
3: 21
4: 264
905664261_905664271 21 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664271 1:39753148-39753170 CAGGGGCTGTGTCCAGCGGGAGG 0: 1
1: 0
2: 8
3: 21
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664271 Original CRISPR CAGGGGCTGTGTCCAGCGGG AGG Intronic