ID: 905664272

View in Genome Browser
Species Human (GRCh38)
Location 1:39753149-39753171
Sequence AGGGGCTGTGTCCAGCGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664261_905664272 22 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664272 1:39753149-39753171 AGGGGCTGTGTCCAGCGGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 240
905664260_905664272 23 Left 905664260 1:39753103-39753125 CCCTGTGTGAGGGCTGGAGAGTC 0: 1
1: 0
2: 0
3: 18
4: 218
Right 905664272 1:39753149-39753171 AGGGGCTGTGTCCAGCGGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 240
905664267_905664272 -7 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664272 1:39753149-39753171 AGGGGCTGTGTCCAGCGGGAGGG 0: 1
1: 0
2: 3
3: 26
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664272 Original CRISPR AGGGGCTGTGTCCAGCGGGA GGG Intronic