ID: 905664273

View in Genome Browser
Species Human (GRCh38)
Location 1:39753150-39753172
Sequence GGGGCTGTGTCCAGCGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 292}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664267_905664273 -6 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664273 1:39753150-39753172 GGGGCTGTGTCCAGCGGGAGGGG 0: 1
1: 0
2: 2
3: 28
4: 292
905664261_905664273 23 Left 905664261 1:39753104-39753126 CCTGTGTGAGGGCTGGAGAGTCT 0: 1
1: 0
2: 1
3: 10
4: 175
Right 905664273 1:39753150-39753172 GGGGCTGTGTCCAGCGGGAGGGG 0: 1
1: 0
2: 2
3: 28
4: 292
905664260_905664273 24 Left 905664260 1:39753103-39753125 CCCTGTGTGAGGGCTGGAGAGTC 0: 1
1: 0
2: 0
3: 18
4: 218
Right 905664273 1:39753150-39753172 GGGGCTGTGTCCAGCGGGAGGGG 0: 1
1: 0
2: 2
3: 28
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664273 Original CRISPR GGGGCTGTGTCCAGCGGGAG GGG Intronic