ID: 905664275

View in Genome Browser
Species Human (GRCh38)
Location 1:39753165-39753187
Sequence GGGAGGGGCTGCTGCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1006
Summary {0: 1, 1: 2, 2: 13, 3: 126, 4: 864}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664267_905664275 9 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664275 1:39753165-39753187 GGGAGGGGCTGCTGCTGCCCAGG 0: 1
1: 2
2: 13
3: 126
4: 864
905664270_905664275 -5 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664275 1:39753165-39753187 GGGAGGGGCTGCTGCTGCCCAGG 0: 1
1: 2
2: 13
3: 126
4: 864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664275 Original CRISPR GGGAGGGGCTGCTGCTGCCC AGG Intronic