ID: 905664276

View in Genome Browser
Species Human (GRCh38)
Location 1:39753171-39753193
Sequence GGCTGCTGCTGCCCAGGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 2, 3: 48, 4: 469}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
905664270_905664276 1 Left 905664270 1:39753147-39753169 CCAGGGGCTGTGTCCAGCGGGAG 0: 1
1: 0
2: 6
3: 10
4: 248
Right 905664276 1:39753171-39753193 GGCTGCTGCTGCCCAGGTTCCGG 0: 1
1: 0
2: 2
3: 48
4: 469
905664267_905664276 15 Left 905664267 1:39753133-39753155 CCTGAGAGAGATGGCCAGGGGCT 0: 1
1: 0
2: 2
3: 20
4: 242
Right 905664276 1:39753171-39753193 GGCTGCTGCTGCCCAGGTTCCGG 0: 1
1: 0
2: 2
3: 48
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
905664276 Original CRISPR GGCTGCTGCTGCCCAGGTTC CGG Intronic